Free for academic non-profit institutions. Other users need a Commercial license

KCTD3 Gene(Protein Coding)

Potassium Channel Tetramerization Domain Containing 3

GCID:
GC01P215567
GIFtS:
42
Genes Participants
UDN Logo

Aliases for KCTD3 Gene

Aliases for KCTD3 Gene

  • Potassium Channel Tetramerization Domain Containing 3 2 3 5
  • Potassium Channel Tetramerisation Domain Containing 3 2 3
  • Renal Carcinoma Antigen NY-REN-45 3 4
  • BTB/POZ Domain-Containing Protein KCTD3 3
  • NY-REN-45 Antigen 3
  • NY-REN-45 3

External Ids for KCTD3 Gene

Previous GeneCards Identifiers for KCTD3 Gene

  • GC01P212357
  • GC01P212797
  • GC01P212129
  • GC01P213807
  • GC01P215740
  • GC01P186414

Summaries for KCTD3 Gene

Entrez Gene Summary for KCTD3 Gene

  • This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

GeneCards Summary for KCTD3 Gene

KCTD3 (Potassium Channel Tetramerization Domain Containing 3) is a Protein Coding gene. Diseases associated with KCTD3 include Tic Disorder. Among its related pathways are Neuropathic Pain-Signaling in Dorsal Horn Neurons and Activation of cAMP-Dependent PKA. An important paralog of this gene is SHKBP1.

UniProtKB/Swiss-Prot for KCTD3 Gene

  • Accessory subunit of potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 (HCN3) upregulating its cell-surface expression and current density without affecting its voltage dependence and kinetics.

Additional gene information for KCTD3 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KCTD3 Gene

Genomics for KCTD3 Gene

Products:

  1. Regulatory Element

GeneHancer (GH) Regulatory Elements for KCTD3 Gene

Promoters and enhancers for KCTD3 Gene
GeneHancer (GH) Identifier GH Type GH
Score		 GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites		 Gene Targets
GH01I215565 Promoter/Enhancer 2.3 EPDnew FANTOM5 Ensembl ENCODE 552.5 +2.0 2011 7 HDGF PKNOX1 CLOCK FOXA2 ARNT ZFP64 ARID4B SIN3A FEZF1 ZNF2 KCTD3 GC01M215567 LOC105372919 ENSG00000202498 GC01M215631
GH01I215542 Enhancer 0.8 Ensembl ENCODE 11.4 -24.0 -23988 1.4 ELF3 RXRA CEBPB CEBPG NR2F2 JUND CEBPA IKZF1 ID3 HNF4A KCTD3 ENSG00000282265
GH01I215523 Enhancer 0.5 ENCODE 11.1 -43.5 -43474 1.4 CTCF GATAD2B HNF4A CUX1 RAD21 KCTD3 ENSG00000282265
GH01I215474 Enhancer 0.7 ENCODE 6.3 -91.3 -91282 2.6 NCOA3 PKNOX1 NFIB NFRKB NEUROD1 NFXL1 ZBTB40 MTA3 CTBP1 GATA3 KCTD3 ENSG00000282265
GH01I215599 Enhancer 0.3 Ensembl 11.7 +32.5 32515 0.2 NFIC KCTD3 GC01M215567 GC01M215631 ENSG00000202498
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around KCTD3 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the KCTD3 gene promoter:

Genomic Locations for KCTD3 Gene

Genomic Locations for KCTD3 Gene
chr1:215,567,185-215,621,807
(GRCh38/hg38)
Size:
54,623 bases
Orientation:
Plus strand
chr1:215,740,735-215,795,149
(GRCh37/hg19)

Genomic View for KCTD3 Gene

Genes around KCTD3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KCTD3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KCTD3 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for KCTD3 Gene

Proteins for KCTD3 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

  • Protein details for KCTD3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q9Y597-KCTD3_HUMAN
    Recommended name:
    BTB/POZ domain-containing protein KCTD3
    Protein Accession:
    Q9Y597
    Secondary Accessions:
    • A0AV15
    • D3DTA6
    • Q49AG7
    • Q504Q9
    • Q6PJN6
    • Q8ND58
    • Q8NDJ0
    • Q8WX16

    Protein attributes for KCTD3 Gene

    Size:
    815 amino acids
    Molecular mass:
    88984 Da
    Quaternary structure:
    • Interacts with HCN3.
    Miscellaneous:
    • Reacts with sera from 5-25 per cent of cancer patients but not with sera from normal donors. Seventy per cent of renal cancer patients have antibodies against one or a panel of these antigens.
    SequenceCaution:
    • Sequence=AAH13868.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};

    Alternative splice isoforms for KCTD3 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for KCTD3 Gene

Protein Expression for KCTD3 Gene

See protein expression from ProteomicsDB, MOPED, PaxDb, and MaxQB

Post-translational modifications for KCTD3 Gene

  • Ubiquitination at isoforms=2503 and posLast=510510

Other Protein References for KCTD3 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for KCTD3 Gene

Domains & Families for KCTD3 Gene

Gene Families for KCTD3 Gene

HGNC:
Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for KCTD3 Gene

InterPro:
Blocks:
ProtoNet:

Suggested Antigen Peptide Sequences for KCTD3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q9Y597

UniProtKB/Swiss-Prot:

KCTD3_HUMAN :
  • Belongs to the KCTD3 family.
Family:
  • Belongs to the KCTD3 family.
genes like me logo Genes that share domains with KCTD3: view

Function for KCTD3 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for KCTD3 Gene

UniProtKB/Swiss-Prot Function:
Accessory subunit of potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 (HCN3) upregulating its cell-surface expression and current density without affecting its voltage dependence and kinetics.
genes like me logo Genes that share phenotypes with KCTD3: view

Animal Model Products

CRISPR Products

miRNA for KCTD3 Gene

miRTarBase miRNAs that target KCTD3

Inhibitory RNA Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for KCTD3 Gene

Localization for KCTD3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for KCTD3 Gene

Cell membrane.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KCTD3 gene
Compartment Confidence
plasma membrane 5
cytosol 3
mitochondrion 1
peroxisome 1
nucleus 1
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for KCTD3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane ISS --
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with KCTD3: view

Pathways & Interactions for KCTD3 Gene

genes like me logo Genes that share pathways with KCTD3: view

Gene Ontology (GO) - Biological Process for KCTD3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0051260 protein homooligomerization IEA --
genes like me logo Genes that share ontologies with KCTD3: view

No data available for SIGNOR curated interactions for KCTD3 Gene

Drugs & Compounds for KCTD3 Gene

Products:

  1. Drug
No Compound Related Data Available

Transcripts for KCTD3 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for KCTD3 Gene

(4) REFSEQ mRNAs :
(12) Additional mRNA sequences :
(227) Selected AceView cDNA sequences:
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for KCTD3 Gene

Potassium channel tetramerisation domain containing 3:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Alternative Splicing Database (ASD) splice patterns (SP) for KCTD3 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14a · 14b · 14c ^ 15 ^ 16a · 16b ^ 17 ^ 18a · 18b ·
SP1: - -
SP2: - -
SP3: - - - -
SP4: - -
SP5:
SP6:

ExUns: 18c · 18d
SP1:
SP2:
SP3:
SP4:
SP5:
SP6:

Relevant External Links for KCTD3 Gene

GeneLoc Exon Structure for
KCTD3
ECgene alternative splicing isoforms for
KCTD3

Expression for KCTD3 Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KCTD3 Gene

mRNA expression in normal human tissues for KCTD3 Gene
mRNA expression by BioGPS for KCTD3 GenemRNA expression by GTEx for KCTD3 Gene

Protein differential expression in normal tissues from HIPED for KCTD3 Gene

This gene is overexpressed in Lung (62.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for KCTD3 Gene



Protein tissue co-expression partners for KCTD3 Gene

NURSA nuclear receptor signaling pathways regulating expression of KCTD3 Gene:

KCTD3

SOURCE GeneReport for Unigene cluster for KCTD3 Gene:

Hs.335139

mRNA Expression by UniProt/SwissProt for KCTD3 Gene:

Q9Y597-KCTD3_HUMAN
Tissue specificity: Broadly expressed in normal tissues.

Evidence on tissue expression from TISSUES for KCTD3 Gene

  • Nervous system(4.7)
  • Liver(4.3)
genes like me logo Genes that share expression patterns with KCTD3: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for KCTD3 Gene

Orthologs for KCTD3 Gene

This gene was present in the common ancestor of animals.

Orthologs for KCTD3 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
 Mammalia KCTD3 33 34
  • 99.71 (n)
oppossum
(Monodelphis domestica)
 Mammalia KCTD3 34
  • 92 (a)
 OneToOne
dog
(Canis familiaris)
 Mammalia KCTD3 33 34
  • 91.66 (n)
cow
(Bos Taurus)
 Mammalia KCTD3 33 34
  • 91.38 (n)
platypus
(Ornithorhynchus anatinus)
 Mammalia KCTD3 34
  • 88 (a)
 OneToOne
mouse
(Mus musculus)
 Mammalia Kctd3 33 16 34
  • 83.91 (n)
rat
(Rattus norvegicus)
 Mammalia Kctd3 33
  • 83.13 (n)
chicken
(Gallus gallus)
 Aves KCTD3 33 34
  • 78.18 (n)
lizard
(Anolis carolinensis)
 Reptilia KCTD3 34
  • 86 (a)
 OneToOne
tropical clawed frog
(Silurana tropicalis)
 Amphibia kctd3 33
  • 74.12 (n)
zebrafish
(Danio rerio)
 Actinopterygii kctd3 33 34
  • 68.58 (n)
African malaria mosquito
(Anopheles gambiae)
 Insecta AgaP_AGAP004087 33
  • 60.2 (n)
fruit fly
(Drosophila melanogaster)
 Insecta CG9467 33 34
  • 55.54 (n)
worm
(Caenorhabditis elegans)
 Secernentea T23B12.6 33 34
  • 55.33 (n)
sea squirt
(Ciona savignyi)
 Ascidiacea -- 34
  • 65 (a)
 OneToMany
Species where no ortholog for KCTD3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for KCTD3 Gene

ENSEMBL:
Gene Tree for KCTD3 (if available)
TreeFam:
Gene Tree for KCTD3 (if available)

Paralogs for KCTD3 Gene

Paralogs for KCTD3 Gene

(3) SIMAP similar genes for KCTD3 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with KCTD3: view

Variants for KCTD3 Gene

Sequence variations from dbSNP and Humsavar for KCTD3 Gene

SNP ID Clin Chr 01 pos Variation AA Info Type
rs730882243 likely-pathogenic, Cerebellar hypoplasia, Seizures, Severe global developmental delay 215,602,099(+) CCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA/ coding_sequence_variant, frameshift
rs1000006835 -- 215,580,835(+) A/T intron_variant
rs1000073575 -- 215,591,149(+) G/T intron_variant
rs1000159114 -- 215,611,225(+) A/T intron_variant
rs1000182976 -- 215,606,247(+) A/G intron_variant

Variation tolerance for KCTD3 Gene

Residual Variation Intolerance Score: 8.51% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.02; 84.23% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for KCTD3 Gene

Human Gene Mutation Database (HGMD)
KCTD3
SNPedia medical, phenotypic, and genealogical associations of SNPs for
KCTD3

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for KCTD3 Gene

Disorders for KCTD3 Gene

MalaCards: The human disease database

(1) MalaCards diseases for KCTD3 Gene - From: HGMD and DISEASES

Disorder Aliases PubMed IDs
tic disorder
  • tics
- elite association - COSMIC cancer census association via MalaCards
Search KCTD3 in MalaCards View complete list of genes associated with diseases

Additional Disease Information for KCTD3

ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with KCTD3: view

No data available for UniProtKB/Swiss-Prot and Genatlas for KCTD3 Gene

Publications for KCTD3 Gene

  1. Antigens recognized by autologous antibody in patients with renal-cell carcinoma. (PMID: 10508479) Scanlan MJ … Old LJ (International journal of cancer 1999) 2 3 4 58
  2. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 58
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
  4. Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
  5. An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 58

Products for KCTD3 Gene

Sources for KCTD3 Gene

Content
Loading form....