Aliases for KCTD3 Gene
Aliases for KCTD3 Gene
External Ids for KCTD3 Gene
- HGNC: 21305
- Entrez Gene: 51133
- Ensembl: ENSG00000136636
- OMIM: 613272
- UniProtKB: Q9Y597
Previous GeneCards Identifiers for KCTD3 Gene
- GC01P212357
- GC01P212797
- GC01P212129
- GC01P213807
- GC01P215740
- GC01P186414
Summaries for KCTD3 Gene
-
This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
GeneCards Summary for KCTD3 Gene
KCTD3 (Potassium Channel Tetramerization Domain Containing 3) is a Protein Coding gene. Diseases associated with KCTD3 include Tic Disorder. Among its related pathways are Neuropathic Pain-Signaling in Dorsal Horn Neurons and Activation of cAMP-Dependent PKA. An important paralog of this gene is SHKBP1.
UniProtKB/Swiss-Prot for KCTD3 Gene
-
Accessory subunit of potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 (HCN3) upregulating its cell-surface expression and current density without affecting its voltage dependence and kinetics.
No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KCTD3 Gene
Genomics for KCTD3 Gene
GeneHancer (GH) Regulatory Elements for KCTD3 Gene
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH01I215565 | Promoter/Enhancer | 2.3 | EPDnew FANTOM5 Ensembl ENCODE | 552.5 | +2.0 | 2011 | 7 | HDGF PKNOX1 CLOCK FOXA2 ARNT ZFP64 ARID4B SIN3A FEZF1 ZNF2 | KCTD3 GC01M215567 LOC105372919 ENSG00000202498 GC01M215631 | |
GH01I215542 | Enhancer | 0.8 | Ensembl ENCODE | 11.4 | -24.0 | -23988 | 1.4 | ELF3 RXRA CEBPB CEBPG NR2F2 JUND CEBPA IKZF1 ID3 HNF4A | KCTD3 ENSG00000282265 | |
GH01I215523 | Enhancer | 0.5 | ENCODE | 11.1 | -43.5 | -43474 | 1.4 | CTCF GATAD2B HNF4A CUX1 RAD21 | KCTD3 ENSG00000282265 | |
GH01I215474 | Enhancer | 0.7 | ENCODE | 6.3 | -91.3 | -91282 | 2.6 | NCOA3 PKNOX1 NFIB NFRKB NEUROD1 NFXL1 ZBTB40 MTA3 CTBP1 GATA3 | KCTD3 ENSG00000282265 | |
GH01I215599 | Enhancer | 0.3 | Ensembl | 11.7 | +32.5 | 32515 | 0.2 | NFIC | KCTD3 GC01M215567 GC01M215631 ENSG00000202498 |
Regulatory Element Products
Genomic Locations for KCTD3 Gene
- chr1:215,567,185-215,621,807
- (GRCh38/hg38)
- Size:
- 54,623 bases
- Orientation:
- Plus strand
- chr1:215,740,735-215,795,149
- (GRCh37/hg19)
Genomic View for KCTD3 Gene
- Cytogenetic band:
-
- 1q41 by Ensembl
- 1q41 by Entrez Gene
- 1q41 by HGNC


RefSeq DNA sequence for KCTD3 Gene
Proteins for KCTD3 Gene
-
Protein details for KCTD3 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9Y597-KCTD3_HUMAN
- Recommended name:
- BTB/POZ domain-containing protein KCTD3
- Protein Accession:
- Q9Y597
- A0AV15
- D3DTA6
- Q49AG7
- Q504Q9
- Q6PJN6
- Q8ND58
- Q8NDJ0
- Q8WX16
Protein attributes for KCTD3 Gene
- Size:
- 815 amino acids
- Molecular mass:
- 88984 Da
- Quaternary structure:
-
- Interacts with HCN3.
- Miscellaneous:
-
- Reacts with sera from 5-25 per cent of cancer patients but not with sera from normal donors. Seventy per cent of renal cancer patients have antibodies against one or a panel of these antigens.
- SequenceCaution:
-
- Sequence=AAH13868.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};
Protein Expression for KCTD3 Gene
Post-translational modifications for KCTD3 Gene
- Ubiquitination at isoforms=2503 and posLast=510510
Other Protein References for KCTD3 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for KCTD3
- Novus Biologicals Antibodies for KCTD3
-
Abcam antibodies for KCTD3
- Invitrogen Antibodies for KCTD3
- GeneTex KCTD3 antibody for KCTD3
Protein Products
-
OriGene Purified Proteins for KCTD3
- Search Origene for MassSpec and Protein Over-expression Lysates for KCTD3
- Origene Custom Protein Services for KCTD3
- Novus Biologicals proteins for KCTD3
- Search GeneTex for Proteins for KCTD3
-
Abcam proteins for KCTD3
Assay Products
No data available for DME Specific Peptides for KCTD3 Gene
Domains & Families for KCTD3 Gene
Gene Families for KCTD3 Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Predicted intracellular proteins
Protein Domains for KCTD3 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for KCTD3 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q9Y597- Family:
-
- Belongs to the KCTD3 family.
Function for KCTD3 Gene
Molecular function for KCTD3 Gene
- UniProtKB/Swiss-Prot Function:
- Accessory subunit of potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 3 (HCN3) upregulating its cell-surface expression and current density without affecting its voltage dependence and kinetics.
Phenotypes for KCTD3 Gene
- GenomeRNAi human phenotypes for KCTD3:
-
- Increased vaccinia virus (VACV) infection
- shRNA abundance <= 50%
- Synthetic lethal with Ras
- Mildly decreased CFP-tsO45G cell surface transport
- Decreased shRNA abundance (Z-score < -2)
- Resistant to vaccinia virus (VACV-A4L) infection
- Synthetic lethal with c-Myc after tamoxifen stimulation
- Increased shRNA abundance (Z-score > 2)
- Increased cell death HMECs cells
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for KCTD3
-
-
ViGene Biosciences lentiviral particle packaged cDNA for KCTD3 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
- Search ViGene Biosciences for KCTD3
CRISPR Products
-
OriGene CRISPR knockouts for KCTD3
- genomics-online: gRNA clones - Search results for available KCTD3 gene related products
- Applied Biological Materials CRISPR for KCTD3
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for KCTD3
- GenScript: Design CRISPR guide RNA sequences for KCTD3
miRNA for KCTD3 Gene
- miRTarBase miRNAs that target KCTD3
miRNA Products
- Search ViGene Biosciences for KCTD3
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for KCTD3
- Browse OriGene Inhibitory RNA Products For KCTD3
- genomics-online: shRNA clones - Search results for available KCTD3 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
Clone Products
- Sino Biological Human cDNA Clone for KCTD3
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for KCTD3
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KCTD3
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- genomics-online: cdna clones - Search results for available KCTD3 gene related products
- orf clones - Search results for available KCTD3 gene related products
- Applied Biological Materials Clones for KCTD3
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for KCTD3
-
ViGene Biosciences adenoviral particle packaged cDNA for KCTD3 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for KCTD3 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for KCTD3 Gene
Localization for KCTD3 Gene
Subcellular locations from UniProtKB/Swiss-Prot for KCTD3 Gene
- Cell membrane.
- Cytosol (2)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005886 | plasma membrane | ISS | -- |
GO:0016020 | membrane | IEA | -- |
Pathways & Interactions for KCTD3 Gene
SuperPathway | Contained pathways | ||
---|---|---|---|
1 | Sweet Taste Signaling |
.37
|
|
2 | Activation of cAMP-Dependent PKA |
.77
|
.56
|
3 | Neuropathic Pain-Signaling in Dorsal Horn Neurons | ||
4 | Hepatic ABC Transporters |
Pathways by source for KCTD3 Gene
13 Qiagen pathways for KCTD3 Gene
Interacting Proteins for KCTD3 Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0051260 | protein homooligomerization | IEA | -- |
No data available for SIGNOR curated interactions for KCTD3 Gene
Transcripts for KCTD3 Gene
mRNA/cDNA for KCTD3 Gene
- (4) REFSEQ mRNAs :
- (12) Additional mRNA sequences :
- (227) Selected AceView cDNA sequences:
- (5) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for KCTD3 Gene
CRISPR Products
-
OriGene CRISPR knockouts for KCTD3
- genomics-online: gRNA clones - Search results for available KCTD3 gene related products
- Applied Biological Materials CRISPR for KCTD3
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for KCTD3
- GenScript: Design CRISPR guide RNA sequences for KCTD3
miRNA Products
- Search ViGene Biosciences for KCTD3
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for KCTD3
- Browse OriGene Inhibitory RNA Products For KCTD3
- genomics-online: shRNA clones - Search results for available KCTD3 gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
Clone Products
- Sino Biological Human cDNA Clone for KCTD3
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for KCTD3
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KCTD3
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- genomics-online: cdna clones - Search results for available KCTD3 gene related products
- orf clones - Search results for available KCTD3 gene related products
- Applied Biological Materials Clones for KCTD3
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7a | · | 7b | ^ | 8 | ^ | 9a | · | 9b | ^ | 10a | · | 10b | ^ | 11 | ^ | 12a | · | 12b | ^ | 13 | ^ | 14a | · | 14b | · | 14c | ^ | 15 | ^ | 16a | · | 16b | ^ | 17 | ^ | 18a | · | 18b | · |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
SP1: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
SP2: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
SP3: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
SP4: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
SP5: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
SP6: |
ExUns: | 18c | · | 18d |
---|---|---|---|
SP1: | |||
SP2: | |||
SP3: | |||
SP4: | |||
SP5: | |||
SP6: |
Expression for KCTD3 Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for KCTD3 Gene
NURSA nuclear receptor signaling pathways regulating expression of KCTD3 Gene:
KCTD3SOURCE GeneReport for Unigene cluster for KCTD3 Gene:
Hs.335139mRNA Expression by UniProt/SwissProt for KCTD3 Gene:
Q9Y597-KCTD3_HUMANEvidence on tissue expression from TISSUES for KCTD3 Gene
- Nervous system(4.7)
- Liver(4.3)
Primer Products
-
OriGene qPCR primer pairs for KCTD3
- genomics-online: primer clones - Search results for available KCTD3 gene related products
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for KCTD3 Gene
Orthologs for KCTD3 Gene
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | KCTD3 33 34 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | KCTD3 34 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | KCTD3 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | KCTD3 33 34 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | KCTD3 34 |
|
OneToOne | |
mouse (Mus musculus) |
Mammalia | Kctd3 33 16 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Kctd3 33 |
|
||
chicken (Gallus gallus) |
Aves | KCTD3 33 34 |
|
||
lizard (Anolis carolinensis) |
Reptilia | KCTD3 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | kctd3 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | kctd3 33 34 |
|
||
African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP004087 33 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | CG9467 33 34 |
|
||
worm (Caenorhabditis elegans) |
Secernentea | T23B12.6 33 34 |
|
||
sea squirt (Ciona savignyi) |
Ascidiacea | -- 34 |
|
OneToMany |
- Species where no ortholog for KCTD3 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for KCTD3 Gene
(3) SIMAP similar genes for KCTD3 Gene using alignment to 4 proteins:
Variants for KCTD3 Gene
SNP ID | Clin | Chr 01 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs730882243 | likely-pathogenic, Cerebellar hypoplasia, Seizures, Severe global developmental delay | 215,602,099(+) | CCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA/ | coding_sequence_variant, frameshift | |
rs1000006835 | -- | 215,580,835(+) | A/T | intron_variant | |
rs1000073575 | -- | 215,591,149(+) | G/T | intron_variant | |
rs1000159114 | -- | 215,611,225(+) | A/T | intron_variant | |
rs1000182976 | -- | 215,606,247(+) | A/G | intron_variant |
Additional Variant Information for KCTD3 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for KCTD3 Gene
Disorders for KCTD3 Gene
Disorder | Aliases | PubMed IDs |
---|---|---|
tic disorder |
|
|
Additional Disease Information for KCTD3
No data available for UniProtKB/Swiss-Prot and Genatlas for KCTD3 Gene
Publications for KCTD3 Gene
- Antigens recognized by autologous antibody in patients with renal-cell carcinoma. (PMID: 10508479) Scanlan MJ … Old LJ (International journal of cancer 1999) 2 3 4 58
- The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory SG … Prigmore E (Nature 2006) 3 4 58
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
- Architecture of the human interactome defines protein communities and disease networks. (PMID: 28514442) Huttlin EL … Harper JW (Nature 2017) 3 58
- An organelle-specific protein landscape identifies novel diseases and molecular mechanisms. (PMID: 27173435) Boldt K … UK10K Rare Diseases Group (Nature communications 2016) 3 58
Products for KCTD3 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for KCTD3
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for KCTD3
- Search Origene for MassSpec and Protein Over-expression Lysates for KCTD3
- Origene Custom Protein Services for KCTD3
- Origene shrna, sirna, and RNAi products in human, mouse, rat for KCTD3
- Browse OriGene Inhibitory RNA Products For KCTD3
- OriGene qPCR primer pairs for KCTD3
- OriGene CRISPR knockouts for KCTD3
- OriGene ORF clones in human for KCTD3
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For KCTD3
- GenScript: Next-day shipping of latest version cDNA ORF clones for KCTD3 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for KCTD3
- GenScript Custom Assay Services for KCTD3
- GenScript Custom overexpressing Cell Line Services for KCTD3
- GenScript: Design CRISPR guide RNA sequences for KCTD3
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for KCTD3
- Sino Biological Human cDNA Clone for KCTD3
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for KCTD3
- Novus Biologicals proteins for KCTD3
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for KCTD3
- Abcam proteins for KCTD3
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for KCTD3
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for KCTD3
- VectorBuilder custom plasmid, inducible vectors for KCTD3
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KCTD3
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- antibodies-online: Search results for available KCTD3 related products ranked by validation data
- antibodies-online: Search results for available KCTD3 related products ranked by validation data
- antibodies-online: Search results for available KCTD3 related products ranked by validation data
- GeneTex KCTD3 antibody for KCTD3
- Search GeneTex for Proteins for KCTD3
- ViGene Biosciences adenoviral particle packaged cDNA for KCTD3 gene
- ViGene Biosciences lentiviral particle packaged cDNA for KCTD3 gene
- ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
- Search ViGene Biosciences for KCTD3
- Horizon Cell Lines for KCTD3
- genomics-online: cdna clones - Search results for available KCTD3 gene related products
- orf clones - Search results for available KCTD3 gene related products
- genomics-online: gRNA clones - Search results for available KCTD3 gene related products
- genomics-online: primer clones - Search results for available KCTD3 gene related products
- genomics-online: shRNA clones - Search results for available KCTD3 gene related products
Sources for KCTD3 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew