Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KCTD3 Gene

Aliases for KCTD3 Gene

  • Potassium Channel Tetramerization Domain Containing 3 2 3 5
  • Potassium Channel Tetramerisation Domain Containing 3 2 3
  • Renal Carcinoma Antigen NY-REN-45 3 4
  • BTB/POZ Domain-Containing Protein KCTD3 3
  • NY-REN-45 Antigen 3
  • NY-REN-45 3

External Ids for KCTD3 Gene

Previous GeneCards Identifiers for KCTD3 Gene

  • GC01P212357
  • GC01P212797
  • GC01P212129
  • GC01P213807
  • GC01P215740
  • GC01P186414

Summaries for KCTD3 Gene

Entrez Gene Summary for KCTD3 Gene

  • This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

GeneCards Summary for KCTD3 Gene

KCTD3 (Potassium Channel Tetramerization Domain Containing 3) is a Protein Coding gene. Diseases associated with KCTD3 include Tic Disorder and Autism Spectrum Disorder. Among its related pathways are Sweet Taste Signaling and Hepatic ABC Transporters. An important paralog of this gene is SHKBP1.

No data available for UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KCTD3 Gene

Genomics for KCTD3 Gene

Regulatory Elements for KCTD3 Gene

Enhancers for KCTD3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01F215599 0.2 Ensembl 11.6 +32.5 32516 0.2 KCTD3 ENSG00000202498 GC01M215567 GC01M215631
GH01F215542 0.5 Ensembl ENCODE 11.4 -24.0 -23988 1.4 ELF3 CEBPB CEBPG NR2F2 CEBPA IKZF1 ID3 SETDB1 KCTD3 ENSG00000282265
GH01F215523 0.7 Ensembl ENCODE 11.1 -43.5 -43474 1.4 CTCF PBX2 SMC3 GATAD2B RAD21 KCTD3 ENSG00000282265
GH01F215273 0.8 ENCODE 6.3 -293.0 -292954 1.5 JUND JUN FOS KCTD3 GC01P215194 VDAC1P10
GH01F215474 0.5 ENCODE 6.2 -91.3 -91282 2.6 ATF1 PKNOX1 TAL1 ZBTB40 YY1 ZNF316 GATA3 ARID3A CTBP1 NCOR1 KCTD3 ENSG00000282265
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around KCTD3 on UCSC Golden Path with GeneCards custom track

Promoters for KCTD3 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000162120 1016 3600 HDGF ZFP64 ARID4B SIN3A FEZF1 ZNF2 YY1 FOS ZNF263 SP3

Genomic Location for KCTD3 Gene

215,567,185 bp from pter
215,621,807 bp from pter
54,623 bases
Plus strand

Genomic View for KCTD3 Gene

Genes around KCTD3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KCTD3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KCTD3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KCTD3 Gene

Proteins for KCTD3 Gene

  • Protein details for KCTD3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    BTB/POZ domain-containing protein KCTD3
    Protein Accession:
    Secondary Accessions:
    • A0AV15
    • D3DTA6
    • Q49AG7
    • Q504Q9
    • Q6PJN6
    • Q8ND58
    • Q8NDJ0
    • Q8WX16

    Protein attributes for KCTD3 Gene

    815 amino acids
    Molecular mass:
    88984 Da
    Quaternary structure:
    No Data Available
    • Reacts with sera from 5-25 per cent of cancer patients but not with sera from normal donors. Seventy per cent of renal cancer patients have antibodies against one or a panel of these antigens.
    • Sequence=AAH13868.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};

    Alternative splice isoforms for KCTD3 Gene


neXtProt entry for KCTD3 Gene

Post-translational modifications for KCTD3 Gene

  • Ubiquitination at Lys 503 and Lys 510
  • Modification sites at PhosphoSitePlus

Other Protein References for KCTD3 Gene

No data available for DME Specific Peptides for KCTD3 Gene

Domains & Families for KCTD3 Gene

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 BTB (POZ) domain.
  • Belongs to the KCTD3 family.
  • Contains 8 WD repeats.
  • Contains 1 BTB (POZ) domain.
  • Belongs to the KCTD3 family.
  • Contains 8 WD repeats.
genes like me logo Genes that share domains with KCTD3: view

No data available for Gene Families for KCTD3 Gene

Function for KCTD3 Gene

genes like me logo Genes that share phenotypes with KCTD3: view

Animal Model Products

miRNA for KCTD3 Gene

miRTarBase miRNAs that target KCTD3

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for KCTD3 Gene

Localization for KCTD3 Gene

Subcellular locations from

Jensen Localization Image for KCTD3 Gene COMPARTMENTS Subcellular localization image for KCTD3 gene
Compartment Confidence
cytosol 3
endoplasmic reticulum 1
mitochondrion 1
nucleus 1
peroxisome 1
plasma membrane 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KCTD3 Gene

Pathways & Interactions for KCTD3 Gene

genes like me logo Genes that share pathways with KCTD3: view

Gene Ontology (GO) - Biological Process for KCTD3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0051260 protein homooligomerization IEA --
genes like me logo Genes that share ontologies with KCTD3: view

No data available for SIGNOR curated interactions for KCTD3 Gene

Transcripts for KCTD3 Gene

Unigene Clusters for KCTD3 Gene

Potassium channel tetramerisation domain containing 3:
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for KCTD3 Gene

ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10a · 10b ^ 11 ^ 12a · 12b ^ 13 ^ 14a · 14b · 14c ^ 15 ^ 16a · 16b ^ 17 ^ 18a · 18b ·
SP1: - -
SP2: - -
SP3: - - - -
SP4: - -

ExUns: 18c · 18d

Relevant External Links for KCTD3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KCTD3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and SAGE for KCTD3 Gene

Protein differential expression in normal tissues from HIPED for KCTD3 Gene

This gene is overexpressed in Lung (62.2).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for KCTD3 Gene

Protein tissue co-expression partners for KCTD3 Gene

NURSA nuclear receptor signaling pathways regulating expression of KCTD3 Gene:


SOURCE GeneReport for Unigene cluster for KCTD3 Gene:


mRNA Expression by UniProt/SwissProt for KCTD3 Gene:

Tissue specificity: Broadly expressed in normal tissues.
genes like me logo Genes that share expression patterns with KCTD3: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA differential expression in normal tissues for KCTD3 Gene

Orthologs for KCTD3 Gene

This gene was present in the common ancestor of animals.

Orthologs for KCTD3 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia KCTD3 34 35
  • 99.71 (n)
(Monodelphis domestica)
Mammalia KCTD3 35
  • 92 (a)
(Canis familiaris)
Mammalia KCTD3 34 35
  • 91.66 (n)
(Bos Taurus)
Mammalia KCTD3 34 35
  • 91.38 (n)
(Ornithorhynchus anatinus)
Mammalia KCTD3 35
  • 88 (a)
(Mus musculus)
Mammalia Kctd3 34 16 35
  • 83.91 (n)
(Rattus norvegicus)
Mammalia Kctd3 34
  • 83.13 (n)
(Gallus gallus)
Aves KCTD3 34 35
  • 78.18 (n)
(Anolis carolinensis)
Reptilia KCTD3 35
  • 86 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia kctd3 34
  • 74.12 (n)
(Danio rerio)
Actinopterygii kctd3 34 35
  • 68.58 (n)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP004087 34
  • 60.2 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG9467 34 35
  • 55.54 (n)
(Caenorhabditis elegans)
Secernentea T23B12.6 34 35
  • 55.33 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 35
  • 65 (a)
Species where no ortholog for KCTD3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for KCTD3 Gene

Gene Tree for KCTD3 (if available)
Gene Tree for KCTD3 (if available)

Paralogs for KCTD3 Gene

Paralogs for KCTD3 Gene

(3) SIMAP similar genes for KCTD3 Gene using alignment to 4 proteins:

genes like me logo Genes that share paralogs with KCTD3: view

Variants for KCTD3 Gene

Sequence variations from dbSNP and Humsavar for KCTD3 Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
rs730882243 Likely pathogenic 215,602,099(+) AGTTC(-/CCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA)ACTGT reference, frameshift-variant
rs10218729 -- 215,602,240(+) TTTTT(A/G)TCTTT intron-variant
rs10495002 -- 215,574,581(+) AAAAT(C/T)GGTTT intron-variant
rs10591999 -- 215,591,267(+) TTCTT(-/TC)TCTCT intron-variant
rs10592000 -- 215,591,288(+) CTTCT(-/TTCC)TTCCT intron-variant

Variation tolerance for KCTD3 Gene

Residual Variation Intolerance Score: 8.51% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.02; 84.23% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KCTD3 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for KCTD3 Gene

Disorders for KCTD3 Gene

MalaCards: The human disease database

(2) MalaCards diseases for KCTD3 Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
tic disorder
autism spectrum disorder
  • pervasive development disorder
- elite association - COSMIC cancer census association via MalaCards
Search KCTD3 in MalaCards View complete list of genes associated with diseases

Relevant External Links for KCTD3

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with KCTD3: view

No data available for UniProtKB/Swiss-Prot and Genatlas for KCTD3 Gene

Publications for KCTD3 Gene

  1. Antigens recognized by autologous antibody in patients with renal- cell carcinoma. (PMID: 10508479) Scanlan M.J. … Old L.J. (Int. J. Cancer 1999) 2 3 4 64
  2. The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory S.G. … Bentley D.R. (Nature 2006) 3 4 64
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  4. Accelerating novel candidate gene discovery in neurogenetic disorders via whole-exome sequencing of prescreened multiplex consanguineous families. (PMID: 25558065) Alazami A.M. … Alkuraya F.S. (Cell Rep 2015) 3 64
  5. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3 64

Products for KCTD3 Gene

Sources for KCTD3 Gene

Loading form....