Aliases for KCTD3 Gene
Aliases for KCTD3 Gene
External Ids for KCTD3 Gene
- HGNC: 21305
- Entrez Gene: 51133
- Ensembl: ENSG00000136636
- OMIM: 613272
- UniProtKB: Q9Y597
Previous GeneCards Identifiers for KCTD3 Gene
- GC01P212357
- GC01P212797
- GC01P212129
- GC01P213807
- GC01P215740
- GC01P186414
Summaries for KCTD3 Gene
-
This gene encodes a member of the potassium channel tetramerization-domain containing (KCTD) protein family. Members of this protein family regulate the biophysical characteristics of ion channels. In mouse, this protein interacts with hyperpolarization-activated cyclic nucleotide-gated channel complex 3 and enhances its cell surface expression and current density. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
GeneCards Summary for KCTD3 Gene
KCTD3 (Potassium Channel Tetramerization Domain Containing 3) is a Protein Coding gene. Diseases associated with KCTD3 include Tic Disorder and Autism Spectrum Disorder. Among its related pathways are Neuropathic Pain-Signaling in Dorsal Horn Neurons and Sweet Taste Signaling. An important paralog of this gene is SHKBP1.
No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KCTD3 Gene
Genomics for KCTD3 Gene
Regulatory Elements for KCTD3 Gene
Enhancers for KCTD3 Gene
| GeneHancer Identifier | Enhancer Score | Enhancer Sources | Gene-Enhancer Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites within enhancer | Gene Targets for Enhancer |
|---|---|---|---|---|---|---|---|---|
| GH01G215542 | 0.9 | Ensembl ENCODE | 11.4 | -24.0 | -23988 | 1.4 | ELF3 CEBPB CEBPG NR2F2 JUND IKZF1 CEBPA ID3 CREB1 HNF4A | KCTD3 ENSG00000282265 |
| GH01G215523 | 0.6 | ENCODE | 11.1 | -43.5 | -43474 | 1.4 | CTCF PBX2 SMC3 GATAD2B HNF4A CUX1 RAD21 | KCTD3 ENSG00000282265 |
| GH01G215474 | 0.8 | ENCODE | 6.2 | -91.3 | -91282 | 2.6 | ATF1 PKNOX1 NFIB NFRKB ZBTB40 YY1 TCF12 FOS ZHX2 GATAD2B | KCTD3 ENSG00000282265 |
| GH01G215599 | 0.4 | Ensembl | 11.7 | +32.5 | 32516 | 0.2 | NFIC | KCTD3 ENSG00000202498 GC01M215567 GC01M215631 |
| GH01G215273 | 0.6 | ENCODE | 6.3 | -293.0 | -292954 | 1.5 | JUND GATA2 JUN CREB1 FOS ATF2 | KCTD3 GC01P215194 VDAC1P10 |
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around KCTD3 on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Location for KCTD3 Gene
- Chromosome:
- 1
- Start:
- 215,567,185 bp from pter
- End:
- 215,621,807 bp from pter
- Size:
- 54,623 bases
- Orientation:
- Plus strand
Genomic View for KCTD3 Gene
Genes around KCTD3 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1q41 by Ensembl
- 1q41 by Entrez Gene
- 1q41 by HGNC
KCTD3 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for KCTD3 Gene
Proteins for KCTD3 Gene
-
Protein details for KCTD3 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9Y597-KCTD3_HUMAN
- Recommended name:
- BTB/POZ domain-containing protein KCTD3
- Protein Accession:
- Q9Y597
- A0AV15
- D3DTA6
- Q49AG7
- Q504Q9
- Q6PJN6
- Q8ND58
- Q8NDJ0
- Q8WX16
Protein attributes for KCTD3 Gene
- Size:
- 815 amino acids
- Molecular mass:
- 88984 Da
- Quaternary structure:
- No Data Available
- Miscellaneous:
-
- Reacts with sera from 5-25 per cent of cancer patients but not with sera from normal donors. Seventy per cent of renal cancer patients have antibodies against one or a panel of these antigens.
- SequenceCaution:
-
- Sequence=AAH13868.1; Type=Miscellaneous discrepancy; Note=Contaminating sequence. Potential poly-A sequence.; Evidence={ECO:0000305};
Protein Expression for KCTD3 Gene
Post-translational modifications for KCTD3 Gene
Other Protein References for KCTD3 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
-
Custom Antibody ServicesOriGene Antibodies for KCTD3
- Novus Biologicals Antibodies for KCTD3
- Invitrogen Antibodies for KCTD3
- GeneTex KCTD3 antibody for KCTD3
Protein Products
-
OriGene Purified Proteins for KCTD3
- Search Origene for MassSpec and Protein Over-expression Lysates for KCTD3
- Origene Custom Protein Services for KCTD3
- Novus Biologicals proteins for KCTD3
- Search GeneTex for Proteins for KCTD3
Assay Products
No data available for DME Specific Peptides for KCTD3 Gene
Domains & Families for KCTD3 Gene
Protein Domains for KCTD3 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for KCTD3 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
Q9Y597- Family:
-
- Belongs to the KCTD3 family.
No data available for Gene Families for KCTD3 Gene
Function for KCTD3 Gene
Phenotypes for KCTD3 Gene
- GenomeRNAi human phenotypes for KCTD3:
-
- Increased vaccinia virus (VACV) infection
- shRNA abundance <= 50%
- Synthetic lethal with Ras
- Mildly decreased CFP-tsO45G cell surface transport
- Decreased shRNA abundance (Z-score < -2)
- Resistant to vaccinia virus (VACV-A4L) infection
- Synthetic lethal with c-Myc after tamoxifen stimulation
- Increased shRNA abundance (Z-score > 2)
- Increased cell death HMECs cells
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for KCTD3
-
-
ViGene Biosciences lentiviral particle packaged cDNA for KCTD3 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
- Search ViGene Biosciences for KCTD3
CRISPR Products
-
OriGene CRISPR knockouts for KCTD3
-
Santa Cruz Biotechnology (SCBT) CRISPR for KCTD3
- GenScript: Design CRISPR guide RNA sequences for KCTD3
miRNA for KCTD3 Gene
- miRTarBase miRNAs that target KCTD3
miRNA Products
- Search ViGene Biosciences for KCTD3
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for KCTD3
- Browse OriGene Inhibitory RNA Products For KCTD3
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
Clone Products
-
OriGene ORF clones in human for KCTD3
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for KCTD3
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for KCTD3
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KCTD3
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
Horizon Cell Lines for KCTD3
-
ViGene Biosciences adenoviral particle packaged cDNA for KCTD3 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for KCTD3 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
Flow Cytometry Products
No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for KCTD3 Gene
Localization for KCTD3 Gene
| Compartment | Confidence |
|---|---|
| cytosol | 3 |
| plasma membrane | 1 |
| mitochondrion | 1 |
| peroxisome | 1 |
| nucleus | 1 |
| endoplasmic reticulum | 1 |
No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KCTD3 Gene
Pathways & Interactions for KCTD3 Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Sweet Taste Signaling |
.37
|
|
| 2 | Activation of cAMP-Dependent PKA |
.77
|
.56
|
| 3 | Neuropathic Pain-Signaling in Dorsal Horn Neurons | ||
| 4 | Hepatic ABC Transporters | ||
Pathways by source for KCTD3 Gene
13 Qiagen pathways for KCTD3 Gene
Interacting Proteins for KCTD3 Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0051260 | protein homooligomerization | IEA | -- |
No data available for SIGNOR curated interactions for KCTD3 Gene
Transcripts for KCTD3 Gene
mRNA/cDNA for KCTD3 Gene
- (4) REFSEQ mRNAs :
- (12) Additional mRNA sequences :
- (227) Selected AceView cDNA sequences:
- (5) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for KCTD3 Gene
CRISPR Products
-
OriGene CRISPR knockouts for KCTD3
-
Santa Cruz Biotechnology (SCBT) CRISPR for KCTD3
- GenScript: Design CRISPR guide RNA sequences for KCTD3
miRNA Products
- Search ViGene Biosciences for KCTD3
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for KCTD3
- Browse OriGene Inhibitory RNA Products For KCTD3
-
ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
Clone Products
-
OriGene ORF clones in human for KCTD3
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for KCTD3
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for KCTD3
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KCTD3
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Flow Cytometry Products
| ExUns: | 1 | ^ | 2 | ^ | 3 | ^ | 4 | ^ | 5 | ^ | 6 | ^ | 7a | · | 7b | ^ | 8 | ^ | 9a | · | 9b | ^ | 10a | · | 10b | ^ | 11 | ^ | 12a | · | 12b | ^ | 13 | ^ | 14a | · | 14b | · | 14c | ^ | 15 | ^ | 16a | · | 16b | ^ | 17 | ^ | 18a | · | 18b | · |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| SP1: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP2: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP3: | - | - | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||
| SP4: | - | - | ||||||||||||||||||||||||||||||||||||||||||||||||||
| SP5: | ||||||||||||||||||||||||||||||||||||||||||||||||||||
| SP6: |
| ExUns: | 18c | · | 18d |
|---|---|---|---|
| SP1: | |||
| SP2: | |||
| SP3: | |||
| SP4: | |||
| SP5: | |||
| SP6: |
Expression for KCTD3 Gene
This gene is overexpressed in Lung (62.2).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for KCTD3 Gene
NURSA nuclear receptor signaling pathways regulating expression of KCTD3 Gene:
KCTD3SOURCE GeneReport for Unigene cluster for KCTD3 Gene:
Hs.335139mRNA Expression by UniProt/SwissProt for KCTD3 Gene:
Q9Y597-KCTD3_HUMAN
Tissue specificity:
Broadly expressed in normal tissues.
Evidence on tissue expression from TISSUES for KCTD3 Gene
- Nervous system(4.7)
- Liver(4.3)
Primer Products
-
OriGene qPCR primer pairs for KCTD3
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for KCTD3 Gene
Orthologs for KCTD3 Gene
This gene was present in the common ancestor of animals.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | KCTD3 34 35 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | KCTD3 35 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | KCTD3 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | KCTD3 34 35 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | KCTD3 35 |
|
OneToOne | |
| mouse (Mus musculus) |
Mammalia | Kctd3 34 16 35 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Kctd3 34 |
|
||
| chicken (Gallus gallus) |
Aves | KCTD3 34 35 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | KCTD3 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | kctd3 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | kctd3 34 35 |
|
||
| African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP004087 34 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | CG9467 34 35 |
|
||
| worm (Caenorhabditis elegans) |
Secernentea | T23B12.6 34 35 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 35 |
|
OneToMany |
- Species where no ortholog for KCTD3 was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for KCTD3 Gene
(3) SIMAP similar genes for KCTD3 Gene using alignment to 4 proteins:
Variants for KCTD3 Gene
| SNP ID | Clin | Chr 01 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs730882243 | Likely pathogenic | 215,602,099(+) | AGTTC(-/CCCTTGCGAATGAAAGATAATGATCTTCTTGTAACTGA)ACTGT | reference, frameshift-variant | |
| rs1000006835 | -- | 215,580,835(+) | AAAGA(A/T)TCCCA | intron-variant | |
| rs1000073575 | -- | 215,591,149(+) | AGTTG(G/T)AACTA | intron-variant | |
| rs1000159114 | -- | 215,611,225(+) | GGTGC(A/T)ACTCA | intron-variant | |
| rs1000182976 | -- | 215,606,247(+) | TTTCA(A/G)AGCCC | intron-variant |
Residual Variation Intolerance Score:
8.51% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
8.02;
84.23% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for KCTD3 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for KCTD3 Gene
Disorders for KCTD3 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| tic disorder |
|
|
| autism spectrum disorder |
|
|
Search KCTD3 in MalaCards
View complete list of genes associated with diseases
Relevant External Links for KCTD3
- Atlas of Genetics and Cytogenetics in Oncology and Haematology:
- KCTD3
No data available for UniProtKB/Swiss-Prot and Genatlas for KCTD3 Gene
Publications for KCTD3 Gene
- Antigens recognized by autologous antibody in patients with renal- cell carcinoma. (PMID: 10508479) Scanlan M.J. … Old L.J. (Int. J. Cancer 1999) 2 3 4 64
- The DNA sequence and biological annotation of human chromosome 1. (PMID: 16710414) Gregory S.G. … Bentley D.R. (Nature 2006) 3 4 64
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
- The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3 64
- A human interactome in three quantitative dimensions organized by stoichiometries and abundances. (PMID: 26496610) Hein M.Y. … Mann M. (Cell 2015) 3 64
Products for KCTD3 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for KCTD3
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for KCTD3
- Search Origene for MassSpec and Protein Over-expression Lysates for KCTD3
- Origene Custom Protein Services for KCTD3
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for KCTD3
- Browse OriGene Inhibitory RNA Products For KCTD3
- OriGene qPCR primer pairs for KCTD3
- OriGene CRISPR knockouts for KCTD3
- OriGene ORF clones in human for KCTD3
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For KCTD3
- GenScript: Next-day shipping cDNA ORF clone for KCTD3 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for KCTD3
- GenScript Custom Assay Services for KCTD3
- GenScript Custom overexpressing Cell Line Services for KCTD3
- GenScript: Design CRISPR guide RNA sequences for KCTD3
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for KCTD3
- Sino Biological Human cDNA Clone for KCTD3
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for KCTD3
- Novus Biologicals proteins for KCTD3
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- ViGene Biosciences adenoviral particle packaged cDNA for KCTD3 gene
- ViGene Biosciences lentiviral particle packaged cDNA for KCTD3 gene
- ViGene Biosciences ready-to-package AAV shRNAs for KCTD3 gene
- Search ViGene Biosciences for KCTD3
- Horizon Cell Lines for KCTD3
- Cyagen custom Knockout/knockin (KOKI) mouse models for KCTD3
- VectorBuilder custom plasmid, inducible vectors for KCTD3
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for KCTD3
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for KCTD3 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer