Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KCTD15 Gene

Aliases for KCTD15 Gene

  • Potassium Channel Tetramerization Domain Containing 15 2 3 5
  • Potassium Channel Tetramerization Domain-Containing Protein 15 4
  • Potassium Channel Tetramerisation Domain Containing 15 2

External Ids for KCTD15 Gene

Previous GeneCards Identifiers for KCTD15 Gene

  • GC19P038979
  • GC19P034287
  • GC19P030786

Summaries for KCTD15 Gene

GeneCards Summary for KCTD15 Gene

KCTD15 (Potassium Channel Tetramerization Domain Containing 15) is a Protein Coding gene. Among its related pathways are Hepatic ABC Transporters and Sweet Taste Signaling. An important paralog of this gene is KCTD1.

UniProtKB/Swiss-Prot for KCTD15 Gene

  • During embryonic development, interferes with neural crest formation (By similarity). Inhibits AP2 transcriptional activity by interaction with its activation domain.

Gene Wiki entry for KCTD15 Gene

Additional gene information for KCTD15 Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KCTD15 Gene

Genomics for KCTD15 Gene

Regulatory Elements for KCTD15 Gene

Enhancers for KCTD15 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH19H033819 1.9 FANTOM5 Ensembl ENCODE dbSUPER 19.4 +24.7 24710 2 ZFP64 ARID4B SIN3A FEZF1 ZNF302 ZNF416 SP3 ZC3H11A REST SMARCA4 GPATCH1 CEP89 ZNF599 LSM14A KIAA0355 ZNF181 ENSG00000267219 WTIP FAAP24 ENSG00000271049
GH19H033794 1.4 ENCODE dbSUPER 9.9 +1.3 1347 5 PKNOX1 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 ZNF143 SP3 ZC3H11A GPATCH1 CEP89 ZNF599 LSM14A KIAA0355 ZNF302 ZNF181 WDR88 RPL21P131 LOC100996681
GH19H033803 1.1 ENCODE dbSUPER 9.8 +8.2 8212 2 ELF3 DRAP1 FOXA2 SAP130 MAX SIN3A ZIC2 TEAD3 HNF4G MAFK KCTD15 PIR44876
GH19H033816 0.8 Ensembl dbSUPER 12.6 +21.0 20952 0 ZFHX2 KLF1 ZNF18 SPI1 KCTD15 PIR48101 GC19P033834
GH19H033767 0.8 ENCODE 12.4 -27.9 -27883 0 ELF3 SOX13 CTCF ZNF792 SAP130 ARID4B SIN3A RAD21 ZSCAN9 RARA KCTD15 GC19P033749
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around KCTD15 on UCSC Golden Path with GeneCards custom track

Promoters for KCTD15 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000108846 867 3601 PKNOX1 ARNT ARID4B SIN3A FEZF1 DMAP1 ZNF2 SP3 ZC3H11A ZHX2

Genomic Location for KCTD15 Gene

Chromosome:
19
Start:
33,795,933 bp from pter
End:
33,815,763 bp from pter
Size:
19,831 bases
Orientation:
Plus strand

Genomic View for KCTD15 Gene

Genes around KCTD15 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KCTD15 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KCTD15 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KCTD15 Gene

Proteins for KCTD15 Gene

  • Protein details for KCTD15 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96SI1-KCD15_HUMAN
    Recommended name:
    BTB/POZ domain-containing protein KCTD15
    Protein Accession:
    Q96SI1
    Secondary Accessions:
    • A8K600
    • Q9BVI6

    Protein attributes for KCTD15 Gene

    Size:
    283 amino acids
    Molecular mass:
    31942 Da
    Quaternary structure:
    • Interacts with TFAP2A; this interaction inhibits TFAP2A transcriptional activation.

    Alternative splice isoforms for KCTD15 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for KCTD15 Gene

Post-translational modifications for KCTD15 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for KCTD15 Gene

Domains & Families for KCTD15 Gene

Gene Families for KCTD15 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for KCTD15 Gene

Suggested Antigen Peptide Sequences for KCTD15 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with KCTD15: view

No data available for UniProtKB/Swiss-Prot for KCTD15 Gene

Function for KCTD15 Gene

Molecular function for KCTD15 Gene

UniProtKB/Swiss-Prot Function:
During embryonic development, interferes with neural crest formation (By similarity). Inhibits AP2 transcriptional activity by interaction with its activation domain.

Phenotypes From GWAS Catalog for KCTD15 Gene

Gene Ontology (GO) - Molecular Function for KCTD15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
GO:0042802 identical protein binding IPI 27152988
genes like me logo Genes that share ontologies with KCTD15: view
genes like me logo Genes that share phenotypes with KCTD15: view

Animal Models for KCTD15 Gene

MGI Knock Outs for KCTD15:

Animal Model Products

  • Taconic Biosciences Mouse Models for KCTD15

CRISPR Products

miRNA for KCTD15 Gene

miRTarBase miRNAs that target KCTD15

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for KCTD15
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for KCTD15 Gene

Localization for KCTD15 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for KCTD15 gene
Compartment Confidence
nucleus 4
cytosol 2
golgi apparatus 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
  • Nucleoplasm (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for KCTD15 Gene

Pathways & Interactions for KCTD15 Gene

genes like me logo Genes that share pathways with KCTD15: view

Gene Ontology (GO) - Biological Process for KCTD15 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007275 multicellular organism development IEA --
GO:0051260 protein homooligomerization IEA --
genes like me logo Genes that share ontologies with KCTD15: view

No data available for SIGNOR curated interactions for KCTD15 Gene

Drugs & Compounds for KCTD15 Gene

No Compound Related Data Available

Transcripts for KCTD15 Gene

Unigene Clusters for KCTD15 Gene

Potassium channel tetramerisation domain containing 15:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Applied Biological Materials Clones for KCTD15
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for KCTD15 Gene

ExUns: 1 ^ 2a · 2b ^ 3a · 3b · 3c ^ 4a · 4b ^ 5a · 5b ^ 6 ^ 7 ^ 8a · 8b · 8c ^ 9a · 9b · 9c · 9d ^ 10 ^ 11a · 11b
SP1: - - - -
SP2: - -
SP3: - - - - - - - - -
SP4: - - - - - - -
SP5: - - - - - -
SP6: - -
SP7: - - - -
SP8: - - -
SP9: -

Relevant External Links for KCTD15 Gene

GeneLoc Exon Structure for
KCTD15
ECgene alternative splicing isoforms for
KCTD15

Expression for KCTD15 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KCTD15 Gene

Protein differential expression in normal tissues from HIPED for KCTD15 Gene

This gene is overexpressed in Fetal Brain (17.1), Urinary Bladder (13.7), Fetal heart (12.7), Retina (12.0), and Esophagus (9.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for KCTD15 Gene



Protein tissue co-expression partners for KCTD15 Gene

NURSA nuclear receptor signaling pathways regulating expression of KCTD15 Gene:

KCTD15

SOURCE GeneReport for Unigene cluster for KCTD15 Gene:

Hs.221873

Evidence on tissue expression from TISSUES for KCTD15 Gene

  • Nervous system(4.6)
genes like me logo Genes that share expression patterns with KCTD15: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for KCTD15 Gene

Orthologs for KCTD15 Gene

This gene was present in the common ancestor of animals.

Orthologs for KCTD15 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia KCTD15 33 34
  • 99.53 (n)
cow
(Bos Taurus)
Mammalia KCTD15 33 34
  • 93.99 (n)
dog
(Canis familiaris)
Mammalia KCTD15 33 34
  • 93.4 (n)
oppossum
(Monodelphis domestica)
Mammalia KCTD15 34
  • 91 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia KCTD15 34
  • 91 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Kctd15 33
  • 90.22 (n)
mouse
(Mus musculus)
Mammalia Kctd15 33 16 34
  • 88.46 (n)
chicken
(Gallus gallus)
Aves KCTD15 33 34
  • 74.97 (n)
lizard
(Anolis carolinensis)
Reptilia KCTD15 34
  • 79 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia kctd15 33
  • 74.38 (n)
MGC76138 33
zebrafish
(Danio rerio)
Actinopterygii kctd15a 34
  • 88 (a)
OneToMany
kctd15b 33
  • 81.32 (n)
KCTD15 (2 of 2) 34
  • 78 (a)
OneToMany
Dr.15592 33
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP007044 33
  • 62.59 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG10440 33 34
  • 60.71 (n)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 37 (a)
OneToMany
Species where no ortholog for KCTD15 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for KCTD15 Gene

ENSEMBL:
Gene Tree for KCTD15 (if available)
TreeFam:
Gene Tree for KCTD15 (if available)

Paralogs for KCTD15 Gene

Paralogs for KCTD15 Gene

(5) SIMAP similar genes for KCTD15 Gene using alignment to 7 proteins:

genes like me logo Genes that share paralogs with KCTD15: view

Variants for KCTD15 Gene

Sequence variations from dbSNP and Humsavar for KCTD15 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs1000205617 -- 33,812,689(+) AAGGT(A/G)CCCTT intron-variant, utr-variant-3-prime
rs1000225232 -- 33,797,053(+) GATAC(C/G)GAGAA intron-variant, upstream-variant-2KB
rs1000313717 -- 33,800,927(+) TGATT(C/T)CTTAT intron-variant
rs1000438558 -- 33,796,823(+) GGCGG(-/GAGGGGTGGGTGGGGGGAGGGTTGGGGGCGA)GAGAG intron-variant, upstream-variant-2KB
rs1000620068 -- 33,806,452(+) CGGGG(C/T)GTTGG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for KCTD15 Gene

Variant ID Type Subtype PubMed ID
dgv139e55 CNV gain 17911159
esv2758755 CNV gain 17122850
nsv2464 CNV insertion 18451855
nsv579339 CNV gain 21841781
nsv828528 CNV gain 20364138
nsv833809 CNV loss 17160897
nsv953278 CNV deletion 24416366

Variation tolerance for KCTD15 Gene

Residual Variation Intolerance Score: 41.3% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.74; 15.74% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for KCTD15 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
KCTD15

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for KCTD15 Gene

Disorders for KCTD15 Gene

Relevant External Links for KCTD15

Genetic Association Database (GAD)
KCTD15
Human Genome Epidemiology (HuGE) Navigator
KCTD15
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
KCTD15

No disorders were found for KCTD15 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KCTD15 Gene

Publications for KCTD15 Gene

  1. Inhibition of neural crest formation by Kctd15 involves regulation of transcription factor AP-2. (PMID: 23382213) Zarelli VE … Dawid IB (Proceedings of the National Academy of Sciences of the United States of America 2013) 3 4 60
  2. Evaluating the discriminative power of multi-trait genetic risk scores for type 2 diabetes in a northern Swedish population. (PMID: 20571754) Fontaine-Bisson B … Franks PW (Diabetologia 2010) 3 45 60
  3. Obesity and diabetes genes are associated with being born small for gestational age: results from the Auckland Birthweight Collaborative study. (PMID: 20712903) Morgan AR … Mitchell EA (BMC medical genetics 2010) 3 45 60
  4. Obesity and diabetes genetic variants associated with gestational weight gain. (PMID: 20816152) Stuebe AM … Siega-Riz AM (American journal of obstetrics and gynecology 2010) 3 45 60
  5. Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (PMID: 20935630) Speliotes EK … Loos RJ (Nature genetics 2010) 3 45 60

Products for KCTD15 Gene

Sources for KCTD15 Gene

Content
Loading form....