Free for academic non-profit institutions. Other users need a Commercial license

Aliases for KCNQ1-AS1 Gene

Subcategory (RNA class) for KCNQ1-AS1 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for KCNQ1-AS1 Gene

  • KCNQ1 Antisense RNA 1 2 3 5
  • KCNQ1 Antisense RNA 1 (Non-Protein Coding) 2

External Ids for KCNQ1-AS1 Gene

Previous GeneCards Identifiers for KCNQ1-AS1 Gene

  • GC00U933107

Summaries for KCNQ1-AS1 Gene

GeneCards Summary for KCNQ1-AS1 Gene

KCNQ1-AS1 (KCNQ1 Antisense RNA 1) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for KCNQ1-AS1 Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for KCNQ1-AS1 Gene

Genomics for KCNQ1-AS1 Gene

Regulatory Elements for KCNQ1-AS1 Gene

Enhancers for KCNQ1-AS1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11H002939 1.6 FANTOM5 Ensembl ENCODE dbSUPER 5.7 -79.4 -79405 1 GTF2F1 PKNOX1 MAX BMI1 RAD21 ZNF316 POLR2A HNF4G RCOR1 FOS NAP1L4 ENSG00000183562 SLC22A18AS SNORA54 SLC22A18 KCNQ1 PHLDA2 KCNQ1-AS1 GC11M002963 GC11M002964
GH11H002549 0.5 ENCODE dbSUPER 10.7 +310.8 310846 1 SLC22A18AS TRPM5 KCNQ1-AS1 KCNQ1DN SLC22A18 ENSG00000199550 CD81 GC11P002540 GC11P002570
GH11H002822 0.3 FANTOM5 12.2 +38.5 38501 0 KCNQ1-AS1 KCNQ1DN TSSC4 KCNQ1 COX6CP18
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around KCNQ1-AS1 on UCSC Golden Path with GeneCards custom track

Genomic Location for KCNQ1-AS1 Gene

2,840,135 bp from pter
2,861,569 bp from pter
21,435 bases
Minus strand

Genomic View for KCNQ1-AS1 Gene

Genes around KCNQ1-AS1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
KCNQ1-AS1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for KCNQ1-AS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for KCNQ1-AS1 Gene

Proteins for KCNQ1-AS1 Gene

Post-translational modifications for KCNQ1-AS1 Gene

No Post-translational modifications

No data available for DME Specific Peptides for KCNQ1-AS1 Gene

Domains & Families for KCNQ1-AS1 Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for KCNQ1-AS1 Gene

Function for KCNQ1-AS1 Gene

Phenotypes From GWAS Catalog for KCNQ1-AS1 Gene

Animal Model Products

CRISPR Products

Clone Products

  • Applied Biological Materials Clones for KCNQ1-AS1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for KCNQ1-AS1 Gene

Localization for KCNQ1-AS1 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for KCNQ1-AS1 Gene

Pathways & Interactions for KCNQ1-AS1 Gene

SuperPathways for KCNQ1-AS1 Gene

No Data Available

Interacting Proteins for KCNQ1-AS1 Gene

Gene Ontology (GO) - Biological Process for KCNQ1-AS1 Gene


No data available for Pathways by source and SIGNOR curated interactions for KCNQ1-AS1 Gene

Drugs & Compounds for KCNQ1-AS1 Gene

No Compound Related Data Available

Transcripts for KCNQ1-AS1 Gene

mRNA/cDNA for KCNQ1-AS1 Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

CRISPR Products

Clone Products

  • Applied Biological Materials Clones for KCNQ1-AS1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for KCNQ1-AS1 Gene

No ASD Table

Relevant External Links for KCNQ1-AS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for KCNQ1-AS1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for KCNQ1-AS1 Gene

mRNA differential expression in normal tissues according to GTEx for KCNQ1-AS1 Gene

This gene is overexpressed in Brain - Spinal cord (cervical c-1) (x9.9), Testis (x8.3), and Ovary (x5.5).

SOURCE GeneReport for Unigene cluster for KCNQ1-AS1 Gene:

genes like me logo Genes that share expression patterns with KCNQ1-AS1: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for KCNQ1-AS1 Gene

Orthologs for KCNQ1-AS1 Gene

Evolution for KCNQ1-AS1 Gene

Gene Tree for KCNQ1-AS1 (if available)
Gene Tree for KCNQ1-AS1 (if available)

No data available for Orthologs for KCNQ1-AS1 Gene

Paralogs for KCNQ1-AS1 Gene

No data available for Paralogs for KCNQ1-AS1 Gene

Variants for KCNQ1-AS1 Gene

Sequence variations from dbSNP and Humsavar for KCNQ1-AS1 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs199472821 Pathogenic 2,847,848(+) CCCCC(A/G)GCAGC intron-variant, reference, missense
rs397508101 Pathogenic 2,847,814(+) CTTCA(-/CCA)GCTGC intron-variant, cds-indel
rs397508103 Pathogenic 2,847,864(+) CCCCC(-/CCAGAGAGGGCGGGGCCCAC)ATCAC intron-variant, reference, frameshift-variant
rs397508104 Pathogenic 2,847,865(+) CCCCC(-/C)AGAGA intron-variant, reference, frameshift-variant
rs397508105 Pathogenic 2,847,865(+) CCCCC(-/A/C)AGAGA intron-variant, reference, frameshift-variant

Relevant External Links for KCNQ1-AS1 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for KCNQ1-AS1 Gene

Disorders for KCNQ1-AS1 Gene

Relevant External Links for KCNQ1-AS1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for KCNQ1-AS1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for KCNQ1-AS1 Gene

Publications for KCNQ1-AS1 Gene

No publications were found for KCNQ1-AS1 Gene.

Products for KCNQ1-AS1 Gene

Sources for KCNQ1-AS1 Gene

Loading form....