Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



KCNG3 Gene

protein-coding   GIFtS: 55
GCID: GC02M042669

Potassium Voltage-Gated Channel, Subfamily G, Member 3

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Potassium Voltage-Gated Channel, Subfamily G, Member 31 2     Potassium Voltage-Gated Channel Subfamily G Member 32
Voltage-Gated Potassium Channel Subunit Kv10.12 3     Voltage-Gated Potassium Channel 6.32
Voltage-Gated Potassium Channel Subunit Kv6.32 3     Voltage-Gated Potassium Channel Kv10.12
KV6.32 5     Voltage-Gated Potassium Channel Subunit Kv6.42
KV10.12     

External Ids:    HGNC: 183061   Entrez Gene: 1708502   Ensembl: ENSG000001711267   OMIM: 6067675   UniProtKB: Q8TAE73   

Export aliases for KCNG3 gene to outside databases

Previous GC identifers: GC02M042659 GC02M042837 GC02M042643 GC02M042580 GC02M042523 GC02M042403


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for KCNG3 Gene:
Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both
functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart
rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and
cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a
gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants
encoding distinct isoforms. (provided by RefSeq, Jul 2008)

GeneCards Summary for KCNG3 Gene:
KCNG3 (potassium voltage-gated channel, subfamily G, member 3) is a protein-coding gene. GO annotations related to this gene include delayed rectifier potassium channel activity. An important paralog of this gene is KCNF1.

UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7
Function: Potassium channel subunit. Modulates channel activity

summary for KCNG3 Gene:
Voltage-gated potassium channels (KV) belong to the 6-TM family of potassium channel that also comprises the
Ca2+-activated Slo (actually 7-TM) and the Ca2+-activated SK subfamilies. The pore-forming alpha-subunits
contain a single pore-forming region and combine to form tetramers. Heteromeric channels can be formed
within subfamilies e.g. KV1.1 with KV1.2 and KCNQ2 with KCNQ3.

Gene Wiki entry for KCNG3 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000002.11  NC_018913.2  NT_022184.16  
Regulatory elements:
   Regulatory transcription factor binding sites in the KCNG3 gene promoter:
         LHX3b/Lhx3b   Sp1   HTF   AP-4   S8   POU2F1   FOXO4   POU2F1a   LHX3a/Lhx3a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidKCNG3 promoter sequence
   Search Chromatin IP Primers for KCNG3

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KCNG3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2p21   Ensembl cytogenetic band:  2p21   HGNC cytogenetic band: 2p21

KCNG3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KCNG3 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M042669:  view genomic region     (about GC identifiers)

Start:
42,669,157 bp from pter      End:
42,721,237 bp from pter
Size:
52,081 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7 (See protein sequence)
Recommended Name: Potassium voltage-gated channel subfamily G member 3  
Size: 436 amino acids; 49593 Da
Subunit: Heteromultimer with KCNB1, KCNC1 and KCNF1. Does not form homomultimers
Secondary accessions: Q53SC1
Alternative splicing: 2 isoforms:  Q8TAE7-1   Q8TAE7-2   

Explore the universe of human proteins at neXtProt for KCNG3: NX_Q8TAE7

Explore proteomics data for KCNG3 at MOPED


See KCNG3 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

REFSEQ proteins (2 alternative transcripts): 
NP_579875.1  NP_758847.1  

ENSEMBL proteins: 
 ENSP00000304127   ENSP00000378424  
Reactome Protein details: Q8TAE7

KCNG3 Human Recombinant Protein Products:

Browse Purified and Recombinant Proteins at EMD Millipore
Browse R&D Systems for human recombinant proteins
Browse recombinant and purified proteins available from Enzo Life Sciences
Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
OriGene Protein Over-expression Lysate for KCNG3
OriGene Custom MassSpec
OriGene Custom Protein Services for KCNG3
GenScript Custom Purified and Recombinant Proteins Services for KCNG3
Novus Biologicals KCNG3 Protein
Novus Biologicals KCNG3 Lysate
Browse Sino Biological Recombinant Proteins
Browse Sino Biological Cell Lysates
Browse ProSpec Recombinant Proteins
Cloud-Clone Corp. Proteins for KCNG3

 
Search eBioscience for Proteins for KCNG3 

KCNG3 Antibody Products:

Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
Browse R&D Systems for Antibodies
OriGene Antibodies for KCNG3
OriGene Custom Antibody Services for KCNG3
Novus Biologicals KCNG3 Antibodies
Abcam antibodies for KCNG3
Cloud-Clone Corp. Antibodies for KCNG3
ThermoFisher Antibodies for KCNG3
LSBio Antibodies in human, mouse, rat for KCNG3

KCNG3 Assay Products:

Browse Kits and Assays available from EMD Millipore
OriGene Custom Assay Services for KCNG3
Browse R&D Systems for biochemical assays
GenScript Custom Assay Services for KCNG3
Browse Enzo Life Sciences for kits & assays
Cloud-Clone Corp. ELISAs for KCNG3
Cloud-Clone Corp. CLIAs for KCNG3
Search eBioscience for ELISAs for KCNG3 


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

TryGeneCards Plus
HGNC Gene Families:
KCN: Potassium channels
Kv: Voltage-gated ion channels / Potassium channels

IUPHAR Guide to PHARMACOLOGY protein family classification: Kv6.3
Voltage-gated potassium channels

Selected InterPro protein domains (see all 9):
 IPR005821 Ion_trans_dom
 IPR000210 BTB/POZ-like
 IPR011333 BTB/POZ_fold
 IPR027359 Channel_four-helix_dom
 IPR003971 K_chnl_volt-dep_Kv9

Graphical View of Domain Structure for InterPro Entry Q8TAE7

ProtoNet protein and cluster: Q8TAE7

3 Blocks protein domains:
IPB000210 BTB/POZ domain
IPB003091 Potassium channel signature
IPB003971 Kv9 potassium channel alpha subunit signature


UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7
Domain: The segment S4 is probably the voltage-sensor and is characterized by a series of positively charged amino
acids at every third position
Similarity: Belongs to the potassium channel family. G (TC 1.A.1.2) subfamily. Kv6.3/KCNG3 sub-subfamily


Find genes that share domains with KCNG3           About GenesLikeMe


(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Molecular Function:

     UniProtKB/Swiss-Prot Summary: KCNG3_HUMAN, Q8TAE7
Function: Potassium channel subunit. Modulates channel activity

     Gene Ontology (GO): 3 molecular function terms:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0005216ion channel activity ----
GO:0005251delayed rectifier potassium channel activity IBA--
GO:0005515protein binding IPI11852086
     
Find genes that share ontologies with KCNG3           About GenesLikeMe


Phenotypes:
     2 GenomeRNAi human phenotypes for KCNG3:
 Increased cell death HMECs cel  Synthetic lethal with Ras 

Animal Models:
   inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for KCNG3
   inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for KCNG3

   genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for KCNG3
   genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for KCNG3

miRNA
Products:
    
miRTarBase miRNAs that target KCNG3:
hsa-mir-101-3p (MIRT027271), hsa-mir-103a-3p (MIRT027010), hsa-mir-16-5p (MIRT031572)

Block miRNA regulation of human, mouse, rat KCNG3 using miScript Target Protectors
Selected qRT-PCR Assays for microRNAs that regulate KCNG3 (see all 34):
hsa-miR-548j hsa-miR-136 hsa-miR-4307 hsa-miR-607 hsa-miR-188-5p hsa-miR-548k hsa-miR-548l hsa-miR-548d-5p
SwitchGear 3'UTR luciferase reporter plasmidKCNG3 3' UTR sequence
Inhib. RNA
Products:
    
OriGene RNAi products in human, mouse, rat for KCNG3
Predesigned siRNA for gene silencing in human, mouse, rat KCNG3

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for KCNG3

Clone
Products:
     
OriGene clones in human, mouse for KCNG3 (see all 11)
OriGene ORF clones in mouse, rat for KCNG3
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector (see all 2): KCNG3 (NM_133329)
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for KCNG3
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNG3

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for KCNG3
Browse ESI BIO Cell Lines and PureStem Progenitors for KCNG3 
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNG3


(According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
About This Section

TryGeneCards Plus

Subcellular locations from UniProtKB/Swiss-Prot
KCNG3_HUMAN, Q8TAE7: Cell membrane; Multi-pass membrane protein. Membrane; Multi-pass membrane protein. Note=Has
to be associated with KCNB1 or possibly another partner to get inserted in the plasma membrane. Remains
intracellular in the absence of KCNB1
Subcellular locations from COMPARTMENTS: 

CompartmentConfidence
endoplasmic reticulum5
plasma membrane5
peroxisome1

Gene Ontology (GO): 4 cellular component terms:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0005783endoplasmic reticulum IDA12060745
GO:0005886plasma membrane TAS--
GO:0008076voltage-gated potassium channel complex IEA--
GO:0016020membrane ----

Find genes that share ontologies with KCNG3           About GenesLikeMe


(SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
About This Section

TryGeneCards Plus

SuperPaths for KCNG3 About    
See pathways by source

SuperPathContained pathways About
1Potassium Channels
Potassium Channels0.43
Voltage gated Potassium channels0.43
2Transmission across Chemical Synapses
Neuronal System0.68
3Dopamine-DARPP32 Feedback onto cAMP Pathway
Dopamine-DARPP32 Feedback onto cAMP Pathway


Find genes that share SuperPaths with KCNG3           About GenesLikeMe

Pathways by source                                                                                                                                                                 See SuperPaths
Show all pathways

1 Downloadable PowerPoint Slide of GeneGlobe Pathway Central Maps for KCNG3
    Dopamine-DARPP32 Feedback onto cAMP Pathway

1 Reactome Pathway for KCNG3
    Voltage gated Potassium channels


    Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for KCNG3
Interactions:

    GeneGlobe Interaction Network for KCNG3

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

Selected Interacting proteins for KCNG3 (Q8TAE73 ENSP000003041274) via UniProtKB, MINT, STRING, and/or I2D (see all 42)
InteractantInteraction Details
GeneCardExternal ID(s)
KCNB1Q147213, ENSP000003608064I2D: score=2 STRING: ENSP00000360806
MYCP011063, ENSP000003672074I2D: score=1 STRING: ENSP00000367207
KCNC1P485473, ENSP000002659694I2D: score=1 STRING: ENSP00000265969
KCNF1Q9H3M03, ENSP000002950824I2D: score=2 STRING: ENSP00000295082
KCNA10ENSP000003587864STRING: ENSP00000358786
About this table

Gene Ontology (GO): 4 biological process terms:    About this table

GO IDQualified GO termEvidencePubMed IDs
GO:0006811ion transport ----
GO:0007268synaptic transmission TAS--
GO:0051260protein homooligomerization IEA--
GO:0055085transmembrane transport ----

Find genes that share ontologies with KCNG3           About GenesLikeMe



(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
About This Section

TryGeneCards Plus
Browse Small Molecules at EMD Millipore
   Browse drugs & compounds from Enzo Life Sciences
  Browse compounds at ApexBio 

Compounds for KCNG3 available from Tocris Bioscience    About this table
CompoundAction CAS #
ICA 110381KV7.2/7.3 activator; displays anticonvulsant properties[325457-99-6]
XE 991 dihydrochloride Potent, selective KV7 (KCNQ) channel blocker; blocks M-current [122955-42-4]
JNJ 303Potent and selective IKs blocker[878489-28-2]
E-4031 dihydrochlorideKV11.1 (hERG) channel blocker; inhibits rapid delayed rectifier K+ current (IKr)[113559-13-0]
ShK-Dap22Extremely potent and selective KV1.3 blocker; suppresses T cell activation in vitro[220384-25-8]



(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
About This Section

TryGeneCards Plus

REFSEQ mRNAs for KCNG3 gene (2 alternative transcripts): 
NM_133329.5  NM_172344.2  

Unigene Cluster for KCNG3:

Potassium voltage-gated channel, subfamily G, member 3
Hs.352633  [show with all ESTs]
Unigene Representative Sequence: NM_133329
2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
ENST00000306078(uc002rsm.3 uc002rsn.3) ENST00000394973
miRNA
Products:
     
Block miRNA regulation of human, mouse, rat KCNG3 using miScript Target Protectors
Selected qRT-PCR Assays for microRNAs that regulate KCNG3 (see all 34):
hsa-miR-548j hsa-miR-136 hsa-miR-4307 hsa-miR-607 hsa-miR-188-5p hsa-miR-548k hsa-miR-548l hsa-miR-548d-5p
SwitchGear 3'UTR luciferase reporter plasmidKCNG3 3' UTR sequence
Inhib. RNA
Products:
     
OriGene RNAi products in human, mouse, rat for KCNG3
Predesigned siRNA for gene silencing in human, mouse, rat KCNG3
Clone
Products:
     
OriGene clones in human, mouse for KCNG3 (see all 11)
OriGene ORF clones in mouse, rat for KCNG3
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript: all cDNA clones in your preferred vector (see all 2): KCNG3 (NM_133329)
DNA2.0 Custom Codon Optimized Gene Synthesis Service for KCNG3
Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNG3
Primer
Products:
    
OriGene qPCR primer pairs and template standards for KCNG3
OriGene qSTAR qPCR primer pairs in human, mouse for KCNG3
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KCNG3
  QuantiTect SYBR Green Assays in human, mouse, rat KCNG3
  QuantiFast Probe-based Assays in human, mouse, rat KCNG3

Additional mRNA sequence: 

AB070604.1 AF348982.1 AF454547.1 AF454548.1 BC071558.1 

2 DOTS entries:

DT.97824200  DT.100017441 

9 AceView cDNA sequences:

BC071558 AB070604 NM_172344 NM_133329 AF348982 AF454548 AF454547 BF966122 
AF450110 

GeneLoc Exon Structure

2 Alternative Splicing Database (ASD) splice patterns (SP) for KCNG3    About this scheme

ExUns: 1a · 1b · 1c ^ 2a · 2b
SP1:                              
SP2:              -               


ECgene alternative splicing isoforms for KCNG3

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

TryGeneCards Plus

KCNG3 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: --
KCNG3 Expression
About this image


KCNG3 expression in embryonic tissues and stem cells    About this table
Data from LifeMap, the Embryonic Development and Stem Cells Database
 selected tissues (see all 2) fully expand
 
 Inner Cell Mass (Early Embryonic Tissues)    fully expand to see all 4 entries
         Human embryonic stem cells (family)
 
 Lung (Respiratory System)
KCNG3 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

KCNG3 Protein Expression

SOURCE GeneReport for Unigene cluster: Hs.352633

UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7
Tissue specificity: Detected in many parts of the brain with the exception of the cerebellum, in testis, pancreas,
lung, kidney, ovary, small intestine, colon, thymus, adrenal gland and spinal cord

    Custom PCR Arrays for KCNG3
Primer
Products:
OriGene qPCR primer pairs and template standards for KCNG3
OriGene qSTAR qPCR primer pairs in human, mouse for KCNG3
Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KCNG3
QuantiTect SYBR Green Assays in human, mouse, rat KCNG3
QuantiFast Probe-based Assays in human, mouse, rat KCNG3
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNG3

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

TryGeneCards Plus

This gene was present in the common ancestor of chordates.

Orthologs for KCNG3 gene from Selected species (see all 11)    About this table
Organism Taxonomic
classification
Gene Description Human
Similarity
Orthology
Type
Details
mouse
(Mus musculus)
Mammalia Kcng31 , 5 potassium voltage-gated channel, subfamily G, member more1, 5 93.38(n)1
96.54(a)1
  17 (53.64 cM)5
2250301  NM_153512.11  NP_705732.11 
 835859575 
chicken
(Gallus gallus)
Aves KCNG31 potassium voltage-gated channel, subfamily G, member more 82.83(n)
86.77(a)
  421393  XM_419451.4  XP_419451.3 
lizard
(Anolis carolinensis)
Reptilia KCNG36
potassium voltage-gated channel, subfamily G, memb...
75(a)
1 ↔ 1
GL343231.1(82192-106543)
tropical clawed frog
(Xenopus tropicalis)
Amphibia kcng31 potassium voltage-gated channel, subfamily G, member more 75.72(n)
82.9(a)
  100485370  XM_002932395.2  XP_002932441.1 
zebrafish
(Danio rerio)
Actinopterygii kcng31 potassium voltage-gated channel, subfamily G, member more 68.82(n)
80.38(a)
  565643  XM_688909.3  XP_694001.2 


ENSEMBL Gene Tree for KCNG3 (if available)
TreeFam Gene Tree for KCNG3 (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section

TryGeneCards Plus
Paralogs for KCNG3 gene
KCNF12  KCNB22  KCNV12  KCNG22  KCNS22  KCNS32  KCNB12  KCNV22  
KCNG42  KCNG12  KCNS12  
17 SIMAP similar genes for KCNG3 using alignment to 1 protein entry:     KCNG3_HUMAN:
KCNG1    KCNG2    KCNG4    KCNB1    KCNB2    KCNS2
KCNS1    KCNS3    KCNV1    KCNF1    KCNV2    KCND3
KCNA1    KCNA3    KCNC1    KCNA7    KCNC4

Find genes that share paralogs with KCNG3           About GenesLikeMe



(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
About This Section

TryGeneCards Plus

Selected SNPs for KCNG3 (see all 1185)    About this table                                 

Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 2 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs106390141,2
C--42544426(+) cccac-/TTAT  
        
ttatt
2 -- int10--------
rs1867392061,2
--42668675(+) ATCACA/GTCTCA 2 -- ds50010--------
rs1918788221,2
--42668779(+) CAACAA/GGAGAT 2 -- ds50010--------
rs1430628941,2
C--42668843(+) TACAT-/TATATAT 2 -- ds50010--------
rs1995481301,2
C--42668870(+) CATATA/CCCTAT 2 -- ds50010--------
rs1464075471,2
C--42668872(+) ATCCC-/TATATATAAAATATATACACA
TATATATACCTATATG
/TATATG
TATAT
4 -- ds5001 cds10--------
rs1390569751,2
--42668912(+) ATGTAC/TGTATA 2 -- ds50010--------
rs728000271,2
C,F--42668913(+) TGTATA/GTATAA 2 -- ds50014Minor allele frequency- G:0.40WA NA 10
rs1451657581,2
C--42668923(+) AATAT-/ATACAC
        
ATATA
2 -- cds10--------
rs1842245421,2
--42668973(+) TTCTCC/TTCGTC 2 -- ds50010--------

HapMap Linkage Disequilibrium report for KCNG3 (42669157 - 42721237 bp)

Structural Variations
     Database of Genomic Variants (DGV) 4 variations for KCNG3:    About this table    
Variant IDTypeSubtypePubMed ID
esv2671664CNV Deletion23128226
esv23097CNV Loss19812545
nsv524679CNV Loss19592680
nsv873970CNV Gain21882294

Site Specific Mutation Identification with PCR Assays
SeqTarget long-range PCR primers for resequencing KCNG3
DNA2.0 Custom Variant and Variant Library Synthesis for KCNG3

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

TryGeneCards Plus
OMIM gene information: 606767    OMIM disorders: --


Find genes that share disorders with KCNG3           About GenesLikeMe

Genetic Association Database (GAD): KCNG3
Human Genome Epidemiology (HuGE) Navigator: KCNG3 (1 document)

Export disorders for KCNG3 gene to outside databases

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

TryGeneCards Plus

PubMed articles for KCNG3 gene integrated from 10 sources:
(articles sorted by number of sources associating them with KCNG3)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Molecular cloning and characterization of Kv6.3, a novel modulatory subunit for voltage-gated K(+) channel Kv2.1. (PubMed id 11852086)1, 2, 3 Sano Y.... Furuichi K. (FEBS Lett. 2002)
  2. International Union of Pharmacology. LIII. Nomenclature and molecular relationships of voltage-gated potassium channels. (PubMed id 16382104)1, 3 Gutman G.A....Wang X. (Pharmacol. Rev. 2005)
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
  4. Obligatory heterotetramerization of three previously uncharacterized Kv channel alpha-subunits identified in the human genome. (PubMed id 12060745)1, 2 Ottschytsch N.... Snyders D.J. (Proc. Natl. Acad. Sci. U.S.A. 2002)
  5. Modification of Kv2.1 K+ currents by the silent Kv10 subunits. (PubMed id 15046870)1, 9 Vega-Saenz de Miera E.C. (Brain Res. Mol. Brain Res. 2004)
  6. Approaches targeting K(V)10.1 open a novel window for cancer diagnosis and therapy. (PubMed id 22204340)1 Pardo L.A....StA1hmer W. (Curr. Med. Chem. 2012)
  7. Mutation of histidine 105 in the T1 domain of the potassium channel Kv2.1 disrupts heteromerization with Kv6.3 and Kv6.4. (PubMed id 19074135)1 Mederos Y Schnitzler M.... Preisig-Muller R. (J. Biol. Chem. 2009)
  8. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (Genomics 2007)
  9. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PubMed id 15815621)2 Hillier L.W.... Wilson R.K. (Nature 2005)
  10. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

TryGeneCards Plus
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

TryGeneCards Plus
Entrez Gene: 170850 HGNC: 18306 AceView: KCNG3 Ensembl:ENSG00000171126 euGenes: HUgn170850
ECgene: KCNG3 H-InvDB: KCNG3

(According to HUGE)
About This Section

TryGeneCards Plus
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
About This Section

TryGeneCards Plus
NameDescription
PharmGKB entry for KCNG3 Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section

TryGeneCards Plus
Patent Information for KCNG3 gene:
Search GeneIP for patents involving KCNG3

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

TryGeneCards Plus

 
 EMD Millipore genomic analysis products

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
 Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 OriGene Antibodies for KCNG3   OriGene RNAi products in human, mouse, rat for KCNG3  
 OriGene qPCR primer pairs and template standards for KCNG3   OriGene Protein Over-expression Lysate for KCNG3  
 OriGene Custom Mass Spec   OriGene clones in human, mouse for KCNG3  
 OriGene qSTAR qPCR primer pairs in human, mouse for KCNG3   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
 OriGene ORF clones in mouse, rat for KCNG3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for KCNG3   OriGene Custom Protein Services for KCNG3  

 
 
 Block miRNA regulation of human, mouse, rat KCNG3 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing KCNG3
 DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KCNG3 Predesigned siRNA for gene silencing in human, mouse, rat KCNG3
 QuantiFast Probe-based Assays in human, mouse, rat KCNG3 QuantiTect SYBR Green Assays in human, mouse, rat KCNG3
 Custom PCR Arrays for KCNG3 Search Chromatin IP Primers for KCNG3
 Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KCNG3  GeneGlobe Interaction Network for KCNG3
 Regulatory tfbs in KCNG3 promoter
 GenScript Custom Purified and Recombinant Proteins Services for KCNG3 GenScript cDNA clones with any tag delivered in your preferred vector for KCNG3
 GenScript Custom Assay Services for KCNG3 GenScript Custom overexpressing Cell Line Services for KCNG3
 CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
 Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
 Plasmid Preparation Custom Peptide Services
 Search for Antibodies & Assays

 Tocris compounds for KCNG3
 Browse Sino Biological Proteins
 Browse Sino Biological Cell Lysates
 Browse Sino Biological cDNA Clones
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

 Novus Tissue Slides
 KCNG3 antibodies
 KCNG3 proteins
 KCNG3 lysates
 Antibodies for KCNG3
 See all of Abcam's Antibodies, Kits and Proteins for KCNG3
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins
 Proteins for KCNG3
 Antibodies for KCNG3
 ELISAs for KCNG3
 CLIAs for KCNG3



 Browse ESI BIO Cell Lines and PureStem Progenitors for KCNG3
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNG3
 SwitchGear 3'UTR luciferase reporter plasmids for KCNG3
 SwitchGear Promoter luciferase reporter plasmids for KCNG3
 ThermoFisher Antibodies for KCNG3
 Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNG3
 inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for KCNG3
 inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for KCNG3
 LSBio Antibodies in human, mouse, rat for KCNG3
Customized transgenic rodents for:
 Humanization
 Biomarker expression
 Off-target effect monitoring
 Translational medicine
 Tissue-specific gene expresssion
 Time-controlled gene expresssion
 Browse compounds at ApexBio
 Search Addgene for plasmids for KCNG3
  Search eBioscience for proteins for KCNG3
  Search eBioscience for elisas for KCNG3
  eBioscience FlowRNA Probe Sets
       
GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

View Random Gene

Category
(GIFtS: )
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      KCNG3 gene at Home site.
Version: 3.12.224 13 Oct 2014
hostname: 356980-web2.xennexinc.com index build: 128 solr: 1.4