Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

KCNG3 Gene

protein-coding   GIFtS: 56
GCID: GC02M042669

Potassium Voltage-Gated Channel, Subfamily G, Member 3

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Aliases
Potassium Voltage-Gated Channel, Subfamily G, Member 31 2     Potassium Voltage-Gated Channel Subfamily G Member 32
Voltage-Gated Potassium Channel Subunit Kv10.12 3     Voltage-Gated Potassium Channel 6.32
Voltage-Gated Potassium Channel Subunit Kv6.32 3     Voltage-Gated Potassium Channel Kv10.12
KV6.32 5     Voltage-Gated Potassium Channel Subunit Kv6.42
KV10.12     

External Ids:    HGNC: 183061   Entrez Gene: 1708502   Ensembl: ENSG000001711267   OMIM: 6067675   UniProtKB: Q8TAE73   

Export aliases for KCNG3 gene to outside databases

Previous GC identifers: GC02M042659 GC02M042837 GC02M042643 GC02M042580 GC02M042523 GC02M042403


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for KCNG3 Gene:
Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both
functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart
rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and
cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a
gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants
encoding distinct isoforms. (provided by RefSeq, Jul 2008)

GeneCards Summary for KCNG3 Gene: 
KCNG3 (potassium voltage-gated channel, subfamily G, member 3) is a protein-coding gene. Diseases associated with KCNG3 include fainting, and neuronitis, and among its related super-pathways are Potassium Channels and Transmission across Chemical Synapses. GO annotations related to this gene include protein binding and delayed rectifier potassium channel activity. An important paralog of this gene is KCNF1.

UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7
Function: Potassium channel subunit. Modulates channel activity

summary for KCNG3 Gene:
Voltage-gated potassium channels (KV) belong to the 6-TM family of potassium channel that also comprises the
Ca2+-activated Slo (actually 7-TM) and the Ca2+-activated SK subfamilies. The pore-forming alpha-subunits
contain a single pore-forming region and combine to form tetramers. Heteromeric channels can be formed
within subfamilies e.g. KV1.1 with KV1.2 and KCNQ2 with KCNQ3.

Gene Wiki entry for KCNG3 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000002.11  NC_018913.2  NT_022184.15  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the KCNG3 gene promoter:
         LHX3b/Lhx3b   Sp1   HTF   AP-4   S8   POU2F1   FOXO4   POU2F1a   LHX3a/Lhx3a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidKCNG3 promoter sequence
   Search SABiosciences Chromatin IP Primers for KCNG3

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat KCNG3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2p21   Ensembl cytogenetic band:  2p21   HGNC cytogenetic band: 2p21

KCNG3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KCNG3 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M042669:  view genomic region     (about GC identifiers)

Start:
42,669,157 bp from pter      End:
42,721,237 bp from pter
Size:
52,081 bases      Orientation:
minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7 (See protein sequence)
Recommended Name: Potassium voltage-gated channel subfamily G member 3  
Size: 436 amino acids; 49593 Da
Subunit: Heteromultimer with KCNB1, KCNC1 and KCNF1. Does not form homomultimers
Subcellular location: Cell membrane; Multi-pass membrane protein. Membrane; Multi-pass membrane protein. Note=Has
to be associated with KCNB1 or possibly another partner to get inserted in the plasma membrane. Remains
intracellular in the absence of KCNB1
Secondary accessions: Q53SC1
Alternative splicing: 2 isoforms:  Q8TAE7-1   Q8TAE7-2   

Explore the universe of human proteins at neXtProt for KCNG3: NX_Q8TAE7

Explore proteomics data for KCNG3 at MOPED 

Post-translational modifications:

  • View modification sites using PhosphoSitePlus
  • View neXtProt modification sites for NX_Q8TAE7

  • KCNG3 Protein expression data from MOPED1, PaxDb2 and MAXQB3 :    About this image 

    KCNG3 Protein Expression
    REFSEQ proteins (2 alternative transcripts): 
    NP_579875.1  NP_758847.1  

    ENSEMBL proteins: 
     ENSP00000304127   ENSP00000378424  
    Reactome Protein details: Q8TAE7
    Human Recombinant Protein Products for KCNG3: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for KCNG3
    OriGene Custom MassSpec 
    OriGene Custom Protein Services for KCNG3
    GenScript Custom Purified and Recombinant Proteins Services for KCNG3
    Novus Biologicals KCNG3 Protein
    Novus Biologicals KCNG3 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates 
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for KCNG3 

    Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005783endoplasmic reticulum IDA12060745
    GO:0005886plasma membrane TAS--
    GO:0008076voltage-gated potassium channel complex IEA--
    GO:0016020membrane ----

    KCNG3 for ontologies           About GeneDecksing



    KCNG3 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for KCNG3
    GenScript Custom Superior Antibodies Services for KCNG3
    Novus Biologicals KCNG3 Antibodies
    Abcam antibodies for KCNG3
    Cloud-Clone Corp. Antibodies for KCNG3 
    ThermoFisher Antibodies for KCNG3
    LSBio Antibodies in human, mouse, rat for KCNG3 

    Assay Products for KCNG3: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for KCNG3
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for KCNG3
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for KCNG3 
    Cloud-Clone Corp. CLIAs for KCNG3


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    HGNC Gene Families: 
    KCN: Potassium channels
    Kv: Voltage-gated ion channels / Potassium channels

    IUPHAR Guide to PHARMACOLOGY protein family classification: Kv6.3 
    Voltage-gated potassium channels

    5/8 InterPro protein domains (see all 8):
     IPR005821 Ion_trans_dom
     IPR000210 BTB/POZ-like
     IPR011333 BTB/POZ_fold
     IPR027359 K_channel_four-helix_dom
     IPR003971 K_chnl_volt-dep_Kv9

    Graphical View of Domain Structure for InterPro Entry Q8TAE7

    ProtoNet protein and cluster: Q8TAE7

    3 Blocks protein domains:
    IPB000210 BTB/POZ domain
    IPB003091 Potassium channel signature
    IPB003971 Kv9 potassium channel alpha subunit signature


    UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7
    Domain: The segment S4 is probably the voltage-sensor and is characterized by a series of positively charged amino
    acids at every third position
    Similarity: Belongs to the potassium channel family. G (TC 1.A.1.2) subfamily. Kv6.3/KCNG3 sub-subfamily


    KCNG3 for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: KCNG3_HUMAN, Q8TAE7
    Function: Potassium channel subunit. Modulates channel activity

         Gene Ontology (GO): 3 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005216ion channel activity ----
    GO:0005251delayed rectifier potassium channel activity IBA--
    GO:0005515protein binding IPI11852086
         
    KCNG3 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for KCNG3:
     Increased cell death HMECs cel  Synthetic lethal with Ras 

    Animal Models:
       inGenious Targeting Laboratory - Custom generated mouse model solutions for KCNG3 
       inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for KCNG3

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for KCNG3 
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for KCNG3 

    miRNA
    Products:
        
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat KCNG3
    8/34 QIAGEN miScript miRNA Assays for microRNAs that regulate KCNG3 (see all 34):
    hsa-miR-548j hsa-miR-136 hsa-miR-4307 hsa-miR-607 hsa-miR-188-5p hsa-miR-548k hsa-miR-548l hsa-miR-548d-5p
    SwitchGear 3'UTR luciferase reporter plasmidKCNG3 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for KCNG3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KCNG3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for KCNG3
    Sirion Biotech Customized adenovirus for overexpression of KCNG3

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene clones in human, mouse for KCNG3 (see all 11)
    OriGene ORF clones in mouse, rat for KCNG3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): KCNG3 (NM_133329)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KCNG3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNG3
    Sirion Biotech Customized lentivirus for stable overexpression of KCNG3 
                         Customized lentivirus expression plasmids for stable overexpression of KCNG3 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for KCNG3
    Search LifeMap BioReagents cell lines for KCNG3
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNG3


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
    About This Section

    SuperPaths for KCNG3 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Potassium Channels
    Potassium Channels0.43
    Voltage gated Potassium channels0.43
    2Transmission across Chemical Synapses
    Neuronal System0.67
    3Dopamine-DARPP32 Feedback onto cAMP Pathway
    Dopamine-DARPP32 Feedback onto cAMP Pathway

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    1 Downloadable PowerPoint Slide of QIAGEN Pathway Central Maps for KCNG3
        Dopamine-DARPP32 Feedback onto cAMP Pathway

    3        Reactome Pathways for KCNG3
        Potassium Channels
    Neuronal System
    Voltage gated Potassium channels



    KCNG3 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for KCNG3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/42 Interacting proteins for KCNG3 (Q8TAE73 ENSP000003041274) via UniProtKB, MINT, STRING, and/or I2D (see all 42)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    KCNB1Q147213, ENSP000003608064I2D: score=2 STRING: ENSP00000360806
    MYCP011063, ENSP000003672074I2D: score=1 STRING: ENSP00000367207
    KCNC1P485473, ENSP000002659694I2D: score=1 STRING: ENSP00000265969
    KCNF1Q9H3M03, ENSP000002950824I2D: score=2 STRING: ENSP00000295082
    KCNA10ENSP000003587864STRING: ENSP00000358786
    About this table

    Gene Ontology (GO): 4 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006811ion transport ----
    GO:0007268synaptic transmission TAS--
    GO:0051260protein homooligomerization IEA--
    GO:0055085transmembrane transport ----

    KCNG3 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for KCNG3 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    ICA 110381KV7.2/7.3 activator; displays anticonvulsant properties[325457-99-6]
    XE 991 dihydrochloride Potent, selective KV7 (KCNQ) channel blocker; blocks M-current [122955-42-4]
    JNJ 303Potent and selective IKs blocker[878489-28-2]
    E-4031 dihydrochlorideKV11.1 (hERG) channel blocker; inhibits rapid delayed rectifier K+ current (IKr)[113559-13-0]
    ShK-Dap22Extremely potent and selective KV1.3 blocker; suppresses T cell activation in vitro[220384-25-8]

    Search CenterWatch for drugs/clinical trials and news about KCNG3

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for KCNG3 gene (2 alternative transcripts): 
    NM_133329.5  NM_172344.2  

    Unigene Cluster for KCNG3:

    Potassium voltage-gated channel, subfamily G, member 3
    Hs.352633  [show with all ESTs]
    Unigene Representative Sequence: NM_133329
    2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000306078(uc002rsm.3 uc002rsn.3) ENST00000394973
    miRNA
    Products:
         
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat KCNG3
    8/34 QIAGEN miScript miRNA Assays for microRNAs that regulate KCNG3 (see all 34):
    hsa-miR-548j hsa-miR-136 hsa-miR-4307 hsa-miR-607 hsa-miR-188-5p hsa-miR-548k hsa-miR-548l hsa-miR-548d-5p
    SwitchGear 3'UTR luciferase reporter plasmidKCNG3 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene RNAi products in human, mouse, rat for KCNG3
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KCNG3
    Clone
    Products:
         
    OriGene clones in human, mouse for KCNG3 (see all 11)
    OriGene ORF clones in mouse, rat for KCNG3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): KCNG3 (NM_133329)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KCNG3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNG3
    Sirion Biotech Customized lentivirus for stable overexpression of KCNG3 
                         Customized lentivirus expression plasmids for stable overexpression of KCNG3 
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for KCNG3
    OriGene qSTAR qPCR primer pairs in human, mouse for KCNG3
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat KCNG3
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KCNG3
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KCNG3

    Additional mRNA sequence: 

    AB070604.1 AF348982.1 AF454547.1 AF454548.1 BC071558.1 

    2 DOTS entries:

    DT.97824200  DT.100017441 

    9 AceView cDNA sequences:

    BC071558 NM_133329 AB070604 NM_172344 AF348982 AF454547 AF454548 BF966122 
    AF450110 

    GeneLoc Exon Structure

    2 Alternative Splicing Database (ASD) splice patterns (SP) for KCNG3    About this scheme

    ExUns: 1a · 1b · 1c ^ 2a · 2b
    SP1:                              
    SP2:              -               


    ECgene alternative splicing isoforms for KCNG3

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    KCNG3 expression in normal human tissues (normalized intensities)      KCNG3 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    KCNG3 Expression
    About this image


    KCNG3 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database 
     5/2 selected tissues (see all 2) fully expand
     
     Inner Cell Mass (Early Embryonic Tissues)    fully expand to see all 3 entries
             Line H9 (WA09)
     
     Lung (Respiratory System)

    See KCNG3 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for KCNG3

    SOURCE GeneReport for Unigene cluster: Hs.352633

    UniProtKB/Swiss-Prot: KCNG3_HUMAN, Q8TAE7
    Tissue specificity: Detected in many parts of the brain with the exception of the cerebellum, in testis, pancreas,
    lung, kidney, ovary, small intestine, colon, thymus, adrenal gland and spinal cord

        SABiosciences Custom PCR Arrays for KCNG3
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for KCNG3
    OriGene qSTAR qPCR primer pairs in human, mouse for KCNG3
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat KCNG3
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KCNG3
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KCNG3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNG3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for KCNG3 gene from 4/10 species (see all 10)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Kcng31 , 5 potassium voltage-gated channel, subfamily G, member more1, 5 93.38(n)1
    96.54(a)1
      17 (53.64 cM)5
    2250301  NM_153512.11  NP_705732.11 
     835859575 
    chicken
    (Gallus gallus)
    Aves KCNG31 potassium voltage-gated channel, subfamily G, member more 82.83(n)
    86.77(a)
      421393  XM_419451.3  XP_419451.3 
    lizard
    (Anolis carolinensis)
    Reptilia KCNG36
    Uncharacterized protein
    74(a)
    1 ↔ 1
    GL343231.1(82192-106543)
    zebrafish
    (Danio rerio)
    Actinopterygii kcng31 potassium voltage-gated channel, subfamily G, member more 68.98(n)
    80.14(a)
      565643  XM_688909.2  XP_694001.2 


    ENSEMBL Gene Tree for KCNG3 (if available)
    TreeFam Gene Tree for KCNG3 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for KCNG3 gene
    KCNF12  KCNB22  KCNV12  KCNG22  KCNS22  KCNS32  KCNB12  KCNV22  
    KCNG42  KCNG12  KCNS12  
    17 SIMAP similar genes for KCNG3 using alignment to 1 protein entry:     KCNG3_HUMAN:
    KCNG1    KCNG2    KCNG4    KCNB1    KCNB2    KCNS2
    KCNS1    KCNS3    KCNV1    KCNF1    KCNV2    KCND3
    KCNA1    KCNA3    KCNC1    KCNA7    KCNC4

    KCNG3 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1185 SNPs in KCNG3 are shown (see all 1185)    About this table     
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 2 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs106390141,2
    C--42544426(+) cccac-/TTAT  
            
    ttatt
    2 -- int10--------
    rs1867392061,2
    --42668675(+) ATCACA/GTCTCA 2 -- ds50010--------
    rs1918788221,2
    --42668779(+) CAACAA/GGAGAT 2 -- ds50010--------
    rs1430628941,2
    C--42668843(+) TACAT-/TATATAT 2 -- ds50010--------
    rs1995481301,2
    C--42668870(+) CATATA/CCCTAT 2 -- ds50010--------
    rs1464075471,2
    C--42668872(+) ATCCC-/TATATATAAAATATATACACA
    TATATATACCTATATG
    /TATATG
    TATAT
    4 -- ds5001 cds10--------
    rs1390569751,2
    --42668912(+) ATGTAC/TGTATA 2 -- ds50010--------
    rs728000271,2
    C,F--42668913(+) TGTATA/GTATAA 2 -- ds50014Minor allele frequency- G:0.40WA NA 10
    rs1451657581,2
    C--42668923(+) AATAT-/ATACAC
            
    ATATA
    2 -- cds10--------
    rs1842245421,2
    --42668973(+) TTCTCC/TTCGTC 2 -- ds50010--------

    HapMap Linkage Disequilibrium report for KCNG3 (42669157 - 42721237 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 4 variations for KCNG3:    About this table     
    Variant IDTypeSubtypePubMed ID
    esv2671664CNV Deletion23128226
    esv23097CNV Loss19812545
    nsv524679CNV Loss19592680
    nsv873970CNV Gain21882294

    SABiosciences Cancer Mutation PCR Assays
    SeqTarget long-range PCR primers for resequencing KCNG3
    DNA2.0 Custom Variant and Variant Library Synthesis for KCNG3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    OMIM gene information: 606767    OMIM disorders: --

    2 diseases for KCNG3:    About MalaCards
    fainting    neuronitis


    KCNG3 for disorders           About GeneDecksing

    Genetic Association Database (GAD): KCNG3
    Human Genome Epidemiology (HuGE) Navigator: KCNG3 (1 document)

    Export disorders for KCNG3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for KCNG3 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with KCNG3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Molecular cloning and characterization of Kv6.3, a novel modulatory subunit for voltage-gated K(+) channel Kv2.1. (PubMed id 11852086)1, 2, 3 Sano Y.... Furuichi K. (2002)
    2. International Union of Pharmacology. LIII. Nomenclatu re and molecular relationships of voltage-gated potassium channels. (PubMed id 16382104)1, 3 Gutman G.A....Wang X. (2005)
    3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    4. Obligatory heterotetramerization of three previously uncharacterized Kv channel alpha-subunits identified in the human genome. (PubMed id 12060745)1, 2 Ottschytsch N.... Snyders D.J. (2002)
    5. Modification of Kv2.1 K+ currents by the silent Kv10 subunits. (PubMed id 15046870)1, 9 Vega-Saenz de Miera E.C. (2004)
    6. Approaches targeting K(V)10.1 open a novel window for cancer diagnosis and therapy. (PubMed id 22204340)1 Pardo L.A....Stuhmer W. (2012)
    7. Mutation of histidine 105 in the t1 domain of the potassium channel kv2.1 disrupts heteromerization with kv6.3 and kv6.4. (PubMed id 19074135)1 Mederos Y Schnitzler M.... Preisig-Muller R. (2009)
    8. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (2007)
    9. Generation and annotation of the DNA sequences of human chromosomes 2 and 4. (PubMed id 15815621)2 Hillier L.W....Wilson R.K. (2005)
    10. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 170850 HGNC: 18306 AceView: KCNG3 Ensembl:ENSG00000171126 euGenes: HUgn170850
    ECgene: KCNG3 H-InvDB: KCNG3

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for KCNG3 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for KCNG3 gene:
    Search GeneIP for patents involving KCNG3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
     Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for KCNG3  
     OriGene qPCR primer pairs and template standards for KCNG3   OriGene Protein Over-expression Lysate for KCNG3  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for KCNG3  
     OriGene qSTAR qPCR primer pairs in human, mouse for KCNG3   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for KCNG3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for KCNG3   OriGene Custom Protein Services for KCNG3  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat KCNG3
     QIAGEN SeqTarget long-range PCR primers for resequencing KCNG3
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat KCNG3
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KCNG3
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KCNG3
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KCNG3
     GenScript Custom Purified and Recombinant Proteins Services for KCNG3 GenScript cDNA clones with any tag delivered in your preferred vector for KCNG3
     GenScript Custom Assay Services for KCNG3 GenScript Custom Superior Antibodies Services for KCNG3
     GenScript Custom overexpressing Cell Line Services for KCNG3 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in KCNG3 promoter
     Search Chromatin IP Primers for KCNG3
     RT2 qPCR Primer Assay in human, mouse, rat KCNG3
     GNC Network for KCNG3
     SABiosciences PCR Arrays including human, mouse, rat KCNG3
     Tocris compounds for KCNG3
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     KCNG3 antibodies
     KCNG3 proteins
     KCNG3 lysates
     Antibodies for KCNG3
     See all of Abcam's Antibodies, Kits and Proteins for KCNG3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     Proteins for KCNG3
     Antibodies for KCNG3
     ELISAs for KCNG3
     CLIAs for KCNG3
     Search LifeMap BioReagents cell lines for KCNG3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNG3
     SwitchGear 3'UTR luciferase reporter plasmids for KCNG3
     SwitchGear Promoter luciferase reporter plasmids for KCNG3
     ThermoFisher Antibodies for KCNG3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNG3
     inGenious Targeting Laboratory - Custom generated mouse model solutions for KCNG3
     inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for KCNG3
    Customized:
     lentivirus for stable overexpression of KCNG3
     lentivirus expression plasmids for stable overexpression of KCNG3
     adenovirus for overexpression of KCNG3
     LSBio Antibodies in human, mouse, rat for KCNG3
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
           
    GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

    View Random Gene

    Category
    (GIFtS: 73)
    transforming growth factor, beta 1
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      KCNG3 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4