Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

KCNA5 Gene

protein-coding   GIFtS: 62
GCID: GC12P005153

potassium voltage-gated channel, shaker-related subfamily,...
 Explore 19 diseases affiliated with
KCNA5 via
MalaCards
our new
 Human Malady Compendium 
Biological research products
for KCNA5    

Aliases
for KCNA5 gene

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section
Aliases
Potassium Voltage-Gated Channel, Shaker-Related Subfamily, Member 51 2     KV1.52
HPCN11 2 3     PCN12
HK21 2     Cardiac Potassium Channel2
Voltage-Gated Potassium Channel HK22 3     Insulinoma And Islet Potassium Channel2
Voltage-Gated Potassium Channel Subunit Kv1.52 3     Potassium Channel 12
ATFB72 5     Potassium Voltage-Gated Channel Subfamily A Member 52
Kv1.51     Voltage-Gated Potassium Channel Protein Kv1.52
HCK12     

External Ids:    HGNC: 62241   Entrez Gene: 37412   Ensembl: ENSG000001300377   OMIM: 1762675   UniProtKB: P224603   

Export aliases for KCNA5 gene to outside databases

Previous GC identifers: GC12P004890 GC12P005045 GC12P005023


Summaries
for KCNA5 gene

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section
Entrez Gene summary for KCNA5:
Potassium channels represent the most complex class of voltage-gated ino channels from both functional and structural
standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion,
neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four
sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each
has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated,
shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth
segment. It belongs to the delayed rectifier class, the function of which could restore the resting membrane potential
of beta cells after depolarization and thereby contribute to the regulation of insulin secretion. This gene is
intronless, and the gene is clustered with genes KCNA1 and KCNA6 on chromosome 12. Defects in this gene are a cause of
familial atrial fibrillation type 7 (ATFB7). (provided by RefSeq, May 2012)

UniProtKB/Swiss-Prot: KCNA5_HUMAN, P22460
Function: Mediates the voltage-dependent potassium ion permeability of excitable membranes. Assuming opened or closed
conformations in response to the voltage difference across the membrane, the protein forms a potassium-selective
channel through which potassium ions may pass in accordance with their electrochemical gradient. This channel displays
rapid activation and slow inactivation. May play a role in regulating the secretion of insulin in normal pancreatic
islets. Isoform 2 exhibits a voltage-dependent recovery from inactivation and an excessive cumulative inactivation

summary for KCNA5:
Voltage-gated potassium channels (KV) belong to the 6-TM family of potassium channel that also comprises the
Ca2+-activated Slo (actually 7-TM) and the Ca2+-activated SK subfamilies. The pore-forming alpha-subunits
contain a single pore-forming region and combine to form tetramers. Heteromeric channels can be formed
within subfamilies e.g. KV1.1 with KV1.2 and KCNQ2 with KCNQ3.

Gene Wiki entry for KCNA5


Genomic Views
for KCNA5 gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000012.11  NC_018923.1  NT_009759.16  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the KCNA5 gene promoter:
         GR   Pax-5   GR-beta   AP-2gamma   Nkx6-1   AP-2beta   GR-alpha   AP-2alpha   LyF-1   AP-2alphaA   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmid: KCNA5 promoter sequence
   Search SABiosciences Chromatin IP Primers for KCNA5

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat KCNA5


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12p13   Ensembl cytogenetic band:  12p13.32   HGNC cytogenetic band: 12p13

KCNA5 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KCNA5 gene location

GeneLoc information about chromosome 12         GeneLoc Exon Structure

GeneLoc location for GC12P005153:  view genomic region     (about GC identifiers)

Start:
 5,153,085 bp from pter      End:
 5,155,949 bp from pter
Size:
 2,865 bases      Orientation:
 plus strand

Proteins
for KCNA5 gene

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section
UniProtKB/Swiss-Prot: KCNA5_HUMAN, P22460 (See protein sequence)
Recommended Name: Potassium voltage-gated channel subfamily A member 5  
Size: 613 amino acids; 67228 Da
Subunit: Heterotetramer of potassium channel proteins. Interacts with DLG1, which enhances channel currents. Forms a
ternary complex with DLG1 and CAV3 (By similarity). Interacts with UBE2I
Subcellular location: Membrane; Multi-pass membrane protein
Sequence caution: Sequence=AAA60146.1; Type=Frameshift; Positions=579;
Secondary accessions: Q4KKT8 Q4VAJ1 Q4VAJ2 Q9UDA4
Alternative splicing: 2 isoforms:  P22460-1   P22460-2   

Explore the universe of human proteins at neXtProt for KCNA5: NX_P22460

Post-translational modifications:

  • Sumoylated on Lys-221, and Lys-536, preferentially with SUMO3. Sumoylation regulates the voltage sensitivity of the
    • channel1
  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_P22460

    • KCNA5 Protein expression data from MOPED and PaxDb:    About this image 
    KCNA5 Protein Expression
    REFSEQ proteins: NP_002225.2  
    ENSEMBL proteins: 
     ENSP00000252321  
    Reactome Protein details: P22460
    Human Recombinant Protein Products for KCNA5: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for KCNA5 
    GenScript Custom Purified and Recombinant Proteins Services for KCNA5
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for KCNA5

    Gene Ontology (GO): 5/6 cellular component terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005794Golgi apparatus IDA16780588
    GO:0005886plasma membrane TAS--
    GO:0005901colocalizes with caveola TAS17060380
    GO:0008076voltage-gated potassium channel complex IDA1986382
    GO:0014704intercalated disc IDA7615797

    KCNA5 for ontologies           About GeneDecksing



    KCNA5 Antibody Products: 
    EMD Millipore Mono- and Polyclonal Antibodies for the study of KCNA5
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for KCNA5 
    GenScript Custom Superior Antibodies Services for KCNA5
    Novus Biologicals KCNA5 Antibodies
    Abcam antibodies for KCNA5 
    Uscn Antibodies for KCNA5
    ThermoFisher Antibodies for KCNA5

    Assay Products for KCNA5: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for KCNA5
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for KCNA5

    Protein Domains /
    Families
    for KCNA5 gene

    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section
    KCNA5 for domains           About GeneDecksing

    5/8 InterPro domains/families (see all 8):
     IPR005821 Ion_trans_dom
     IPR000210 BTB/POZ-like
     IPR011333 BTB/POZ_fold
     IPR003972 K_chnl_volt-dep_Kv1
     IPR003968 K_chnl_volt-dep_Kv

    Graphical View of Domain Structure for InterPro Entry P22460

    ProtoNet protein and cluster: P22460

    4 Blocks protein families:
    IPB000210 BTB/POZ domain
    IPB003091 Potassium channel signature
    IPB003972 Skaker voltage-gated K+ channel family signature
    IPB004052 Kv1.5 voltage-gated K+ channel signature


    UniProtKB/Swiss-Prot: KCNA5_HUMAN, P22460
    Domain: The amino terminus may be important in determining the rate of inactivation of the channel while the C-terminal
    PDZ-binding motif may play a role in modulation of channel activity and/or targeting of the channel to specific
    subcellular compartments
    Domain: The segment S4 is probably the voltage-sensor and is characterized by a series of positively charged amino
    acids at every third position
    Similarity: Belongs to the potassium channel family. A (Shaker) (TC 1.A.1.2) subfamily. Kv1.5/KCNA5 sub-subfamily


    Function
    for KCNA5 gene

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section
    Molecular Function:

         UniProtKB/Swiss-Prot Summary: KCNA5_HUMAN, P22460
    Function: Mediates the voltage-dependent potassium ion permeability of excitable membranes. Assuming opened or closed
    conformations in response to the voltage difference across the membrane, the protein forms a potassium-selective
    channel through which potassium ions may pass in accordance with their electrochemical gradient. This channel displays
    rapid activation and slow inactivation. May play a role in regulating the secretion of insulin in normal pancreatic
    islets. Isoform 2 exhibits a voltage-dependent recovery from inactivation and an excessive cumulative inactivation

         Genatlas biochemistry entry for KCNA5:
    potassium voltage-gated channel,Drosophila shaker-related subfamily,member 5 (mouse Kv1.5 homolog)

         Gene Ontology (GO): 5/10 molecular function terms (GO ID links to tree view) (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005102receptor binding IEA--
    GO:0005249voltage-gated potassium channel activity ----
    GO:0005251delayed rectifier potassium channel activity IMP19343045
    GO:0005515protein binding ----
    GO:0015271outward rectifier potassium channel activity IMP16236819
         
    KCNA5 for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for KCNA5:
     Increased cell death HMECs cel  Synthetic lethal with Ras 

         7 MGI mutant phenotypes (inferred from 2 alleles) (MGI details for Kcna5):
     cardiovascular system  cellular  hematopoietic system  homeostasis/metabolism  immune system 
     muscle  nervous system 

    KCNA5 for phenotypes           About GeneDecksing

    Animal Models:
         Mouse knock-out Kcna5tm1Hket for KCNA5
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for KCNA5 

    miRNA
    Products:            		 OriGene 3'-UTR Clone: KCNA5
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat KCNA5
    8/15 QIAGEN miScript miRNA Assays for microRNAs that regulate KCNA5 (see all 15):
    hsa-miR-3673 hsa-miR-206 hsa-miR-1283 hsa-miR-3688-3p hsa-miR-3193 hsa-miR-1539 hsa-miR-450b-3p hsa-miR-1
    SwitchGear 3'UTR luciferase reporter plasmid: KCNA5 3' UTR sequence
    Inhib. RNA
    Products:            		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for KCNA5 (see all 7)
    OriGene shRNA RFP: KCNA5
    OriGene siRNA: KCNA5
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KCNA5
    Sirion Biotech Custom design and validation of potent shRNA sequences against KCNA5 

    Gene Editing
    Products:    		DNA2.0 Custom Protein Engineering Service for KCNA5
    Sirion Biotech Customized adenovirus for overexpression of KCNA5 
    Sirion Biotech Customized adenovirus for potent knockdown of KCNA5

    Clone
    Products:             		EMD Millipore Clones for the Expression of KCNA5
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for KCNA5 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for KCNA5 (see all 2)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: KCNA5 (NM_002234)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KCNA5
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNA5 

    Cell Line
    Products:             		GenScript Custom overexpressing Cell Line Services for KCNA5
    Search LifeMap BioReagents cell lines for KCNA5
    Sirion Biotech Customized stable knockdown cell line services for KCNA5 
    Sirion Biotech Customized inducible knockdown cell line services for KCNA5
    Sirion Biotech Customized stable overexpressing cell line services for KCNA5
    Sirion Biotech Customized inducible overexpressing cell line services for KCNA5

    In Situ Assay
    Products:       
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNA5


    Pathways & Interactions
    for KCNA5 gene

    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Potassium Channels
    		Potassium Channels1.00
    		Potassium transporters: outward current0.42
    		Voltage gated Potassium channels0.43
    2Antiarrhythmic Pathway, Pharmacodynamics
    		Antiarrhythmic Pathway, Pharmacodynamics1.00
    3Dopamine-DARPP32 Feedback onto cAMP Pathway
    		Dopamine-DARPP32 Feedback onto cAMP Pathway1.00
    4Transmission across Chemical Synapses
    		Neuronal System0.67

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    1 EMD Millipore Pathway for KCNA5
        Potassium transporters- outward current

    1 Downloadable PowerPoint Slide of QIAGEN Pathway Central Maps for KCNA5
        Dopamine-DARPP32 Feedback onto cAMP Pathway

    3        Reactome Pathways for KCNA5
        Potassium Channels
    Neuronal System
    Voltage gated Potassium channels

    1 PharmGKB Pathway for KCNA5
        Antiarrhythmic Pathway, Pharmacodynamics


    KCNA5 for pathways           About GeneDecksing

    Interactions:

        SABiosciences Gene Network CentralTM Interacting Genes and Proteins Network for KCNA5

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/51 Interacting proteins for KCNA5 (P224602, 3 ENSP000002523214) via UniProtKB, MINT, STRING, and/or I2D (see all 51)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ACTN2P356092, 3, ENSP000003555374MINT-17650 MINT-17651 I2D: score=3 STRING: ENSP00000355537
    DLG1Q129593, ENSP000003457314I2D: score=2 STRING: ENSP00000345731
    DLG4P783523, ENSP000002938134I2D: score=2 STRING: ENSP00000293813
    KCNA2P163893, ENSP000003145204I2D: score=2 STRING: ENSP00000314520
    PTPREP234693, ENSP000002546674I2D: score=2 STRING: ENSP00000254667
    About this table

    Gene Ontology (GO): 5/17 biological process terms (GO ID links to tree view) (see all 17):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001666response to hypoxia IEA--
    GO:0006813potassium ion transport IDA8576199
    GO:0007268synaptic transmission TAS--
    GO:0019229regulation of vasoconstriction IEA--
    GO:0042391regulation of membrane potential IDA1986382

    KCNA5 for ontologies           About GeneDecksing



    Drugs & Compounds
    for KCNA5 gene

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    KCNA5 for compounds           About GeneDecksing

    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for KCNA5 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    AM 92016 hydrochlorideKV channel blocker[178894-81-0]
    KN-93CaM kinase II inhibitor. Also K+ channel blocker (KV)[139298-40-1]
    4-AminopyridineNon-selective KV channel blocker[504-24-5]
    9 Novoseek chemical compound relationships for KCNA5 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    dichloroacetate 73.8 1 17085423 (1)
    4-aminopyridine 70.8 5 17267549 (1), 15140747 (1), 11950153 (1)
    potassium 67.9 16 15541182 (2), 7587392 (1), 9694927 (1), 12208779 (1) (see all 14)
    terfenadine 60.9 5 8772706 (3), 11575008 (1)
    benzocaine 60.3 2 12237171 (1), 10533586 (1)
    bupivacaine 37.3 1 8527655 (1)
    calcium 20.7 3 15353504 (1), 17085423 (1)
    oxygen 3.64 2 16735674 (1), 8524851 (1)
    h2o2 0 1 16735674 (1)

    Search CenterWatch for drugs/clinical trials and news about KCNA5 

    Transcripts
    for KCNA5 gene

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section
    REFSEQ mRNAs for KCNA5 gene: 
    NM_002234.3  

    Unigene Cluster for KCNA5:

    Potassium voltage-gated channel, shaker-related subfamily, member 5
    Hs.150208  [show with all ESTs]
    Unigene Representative Sequence: NM_002234
    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000252321(uc001qni.3)

    miRNA
    Products:             		 OriGene 3'-UTR Clone: KCNA5
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat KCNA5
    8/15 QIAGEN miScript miRNA Assays for microRNAs that regulate KCNA5 (see all 15):
    hsa-miR-3673 hsa-miR-206 hsa-miR-1283 hsa-miR-3688-3p hsa-miR-3193 hsa-miR-1539 hsa-miR-450b-3p hsa-miR-1
    SwitchGear 3'UTR luciferase reporter plasmid: KCNA5 3' UTR sequence
    Inhib. RNA
    Products:             		Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for KCNA5 (see all 7)
    OriGene shRNA RFP: KCNA5
    OriGene siRNA: KCNA5
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KCNA5
    Sirion Biotech Custom design and validation of potent shRNA sequences against KCNA5 
    Clone
    Products:             		 OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for KCNA5 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for KCNA5 (see all 2)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: KCNA5 (NM_002234)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KCNA5
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNA5 
    Primer
    Products:            		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for KCNA5
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat KCNA5
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KCNA5
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KCNA5

    Additional cDNA sequence: 

    BC096357.3 BC096358.3 BC099665.3 BC099666.3 M55513.1 M60451.1 M83254.1 

    1 DOTS entry:

    DT.87015787 

    24/25 AceView cDNA sequences (see all 25):

    NM_002234 BM663787 BQ189575 BM692565 AA975384 BQ417402 M60451 AW074733 
    CK823379 BM893755 AI377563 BX280957 BV205997 CK823380 M83254 BE350646 
    AA218863 BM967038 BQ287945 BV205996 M55513 BI764377 AW242568 AA220960 

    GeneLoc Exon Structure


    Expression
    for KCNA5 gene

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    KCNA5 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: --
    KCNA5 Expression
    About this image

    KCNA5 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table

    10 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    EyeInner Nuclear LayerGABAergic Amacrine CellsAmacrine, Retina
    EyeInner Nuclear LayerMature Rod Bipolar CellsBipolar, Retina
    EyeInner Nuclear LayerType1 Off Cone Bipolar CellsBipolar, Retina
    Gut TubeMidgutMidgut Endoderm CellsEndoderm
    BrainMedulla OblongataBrain
    Gut TubeMidgutGut Tube
    HeartAtrioventricular CanalHeart
    Neural TubeDiencephalic Roof PlateNeural Tube
    Neural TubeDiencephalic Ventricular ZoneNeural Tube
    Neural TubeMesencephalic Ventricular ZoneNeural Tube
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization

    See KCNA5 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for KCNA5

    SOURCE GeneReport for Unigene cluster: Hs.150208

    UniProtKB/Swiss-Prot: KCNA5_HUMAN, P22460
    Tissue specificity: Pancreatic islets and insulinoma

        SABiosciences Expression via Pathway-Focused PCR Arrays including KCNA5: 
              cAMP / Ca2+ Signaling PathwayFinder in human mouse rat
              Neuronal Ion Channels in human mouse rat

    Primer
    Products:    		 OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for KCNA5
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat KCNA5
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KCNA5
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KCNA5
    In Situ
    Assay Products:     
         		Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNA5

    Orthologs
    for KCNA5 gene

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section
    This gene was present in the common ancestor of animals.

    Orthologs for KCNA5 gene from 5/18 species (see all 18)    About this table
    Organism Taxonomic
    classification    		 Gene Description Human
    Similarity    		 Orthology
    Type    		 Details
    chicken
    (Gallus gallus)    		 Aves KCNA51 potassium voltage-gated channel, shaker-related subfamily, more 75.88(n)
    80.46(a)    		   395115  XM_417226.3  XP_417226.2 
    lizard
    (Anolis carolinensis)    		 Reptilia KCNA56
    		 --
    		 71(a)
    		 1 ↔ 1
    		 5(80751125-80752846)
    zebrafish
    (Danio rerio)    		 Actinopterygii LOC1000041601 potassium voltage-gated channel subfamily A member more 73.1(n)
    78.51(a)    		   100004160  XM_002661837.1  XP_002661883.1 
    fruit fly
    (Drosophila melanogaster)    		 Insecta Sh3 courtship behavior voltage-gated potassium
    channel    		 69(a)     --
    worm
    (Caenorhabditis elegans)    		 Secernentea Y55F3C.33   -- 31(a)   IV(742316-752934)   --


    ENSEMBL Gene Tree for KCNA5 (if available)
    TreeFam Gene Tree for KCNA5 (if available) 

    Paralogs
    for KCNA5 gene

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for KCNA5 gene
    KCNA62  KCNA22  KCNC22  KCNC42  KCND22  KCND12  KCNA72  KCNA12  
    KCNC12  KCNA42  KCNC32  KCND32  KCNA32  KCNA102  
    13 SIMAP similar genes for KCNA5 using alignment to 1 protein entry:     KCNA5_HUMAN:
    KCNA2    KCNA10    KCNA7    KCNA1    KCNA6    KCNA3
    KCNA4    KCND3    KCNB1    KCNB2    KCND2    KCND1
    KCNS3

    KCNA5 for paralogs           About GeneDecksing



    Genomic Variants
    for KCNA5 gene

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/163 NCBI SNPs in KCNA5 are shown (see all 163)     About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance    		Chr 12 posSequence#AA
    Chg    		TypeMore#Allele
    freq    		PopTotal
    sample    		More
    ----------
    rs1219085911,2
    		Cpathogenic5878101(+) GGAAAC/TGGATC 2 T M mis10--------
    rs1134148701,2
    		--5008472(+) CAATAT/CTTGTA 1 -- us2k12Minor allele frequency- C:0.05CSA WA 120
    rs678145611,2
    		C--5008502(+) NNNNAT/AAATGA 1 -- us2k15Minor allele frequency- A:0.14NA WA 1324
    rs725466731,2
    		C,F--5008611(+) ACCCTC/TAGTCT 1 -- us2k14Minor allele frequency- T:0.08WA NA EA 1440
    rs672218231,2
    		C,F--5008821(+) AGGTCT/CGTACT 1 -- us2k12Minor allele frequency- C:0.00--1948
    rs116155521,2
    		C,F,A,H--5008930(+) ATACAT/CGTATT 1 -- us2k124Minor allele frequency- C:0.07NA NS EA 4088
    rs725466771,2
    		C,F--5009121(+) CCAGCG/AGGTTC 1 -- us2k12Minor allele frequency- A:0.01WA 766
    rs725466781,2
    		F--5009312(+) TGCCAC/GGAGAC 1 -- us2k11Minor allele frequency- G:0.01--648
    rs725466791,2
    		C,F--5009313(+) GCCACG/AAGACC 1 -- us2k12Minor allele frequency- A:0.02WA 766
    rs1448796741,2
    		F--5009878(+) CGCTGCCGGACCCGGGAGTGCG
    GCCCTTGCCTCCGCTG    /-    CCAGA     		1 -- cds11Minor allele frequency- -:0.00--1628

    HapMap Linkage Disequilibrium report for KCNA5 (5153085 - 5155949 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for KCNA5
         1 CNV: 49084
    Human Gene Mutation Database (HGMD): KCNA5

    SABiosciences Cancer Mutation PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing KCNA5
    DNA2.0 Custom Variant and Variant Library Synthesis for KCNA5

    Disorders / Diseases
    for KCNA5 gene

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section
    KCNA5 for disorders           About GeneDecksing

    OMIM gene information: 176267   
    OMIM disorders: 612240  
    UniProtKB/Swiss-Prot: KCNA5_HUMAN, P22460
  • Defects in KCNA5 are the cause of familial atrial fibrillation type 7 (ATFB7) [MIM:612240]. Atrial
    • fibrillation is a common disorder of cardiac rhythm that is hereditary in a small subgroup of patients. It is
    characterized by disorganized atrial electrical activity, progressive deterioration of atrial electromechanical
    function and ineffective pumping of blood into the ventricles. It can be associated with palpitations, syncope,
    thromboembolic stroke, and congestive heart failure

    19 diseases for KCNA5:    About MalaCards
    atrial fibrillation    familial atrial fibrillation    insulinoma    patent ductus arteriosus
    long qt syndrome    myokymia    neuronitis    hepatopulmonary syndrome
    pulmonary hypertension    hypertension    liver disease    gastric cancer
    breast carcinoma    lung cancer    cerebritis    hypoxia
    cholesterol    carcinoma    pancreatitis

    2 diseases from the University of Copenhagen DISEASES database for KCNA5:
    Long QT syndrome     Hypertension

    6 Novoseek disease relationships for KCNA5 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    hypertension arterial 60.5 5 17267549 (1), 15140747 (1), 11950153 (1), 20018952 (1)
    atrial fibrillation 16.5 1 15807513 (1)
    arrhythmia 10.8 2 17266934 (1)
    metastasis 0 1 11212253 (1)
    tumors 0 1 15541182 (1)
    cancer 0 1 15541182 (1)

    Human Genome Epidemiology (HuGE) Navigator: KCNA5 (8 documents)

    Export disorders for KCNA5 gene to outside databases

    Publications
    for KCNA5 gene

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for KCNA5 gene, integrated from 9 sources (see all 133):
    (articles sorted by number of sources associating them with KCNA5)    		    Utopia: connect your pdf to the dynamic
    world of online information

    1. Sequence and functional expression in Xenopus oocytes of a human insulinoma and islet potassium channel. (PubMed id 1986382)1, 2, 9 Philipson L.H.... Steiner D.F. (1991)
    2. A specific N-terminal residue in Kv1.5 is required for upregulation of the channel by SAP97. (PubMed id 16466689)1, 2, 9 Mathur R....Fedida D. (2006)
    3. SUMO modification regulates inactivation of the voltage-gated potassium channel Kv1.5. (PubMed id 17261810)1, 2 Benson M.D.... Martens J.R. (2007)
    4. International Union of Pharmacology. LIII. Nomenclatu re and molecular relationships of voltage-gated potassium channels. (PubMed id 16382104)1, 3 Gutman G.A....Wang X. (2005)
    5. Molecular cloning, characterization, and genomic localization of a human potassium channel gene. (PubMed id 1349297)1, 2 Curran M.E.... Keating M.T. (1992)
    6. Molecular cloning and characterization of two voltage-gated K+ channel cDNAs from human ventricle. (PubMed id 2001794)1, 2 Tamkun M.M....Glover D.M. (1991)
    7. Overexpression of human KCNA5 increases IK V and enhances apoptosis. (PubMed id 15140747)1, 9 Brevnova E.E....Yuan J.X. (2004)
    8. Function of Kv1.5 channels and genetic variations of KCNA5 in patients with idiopathic pulmonary arterial hypertension. (PubMed id 17267549)1, 9 Remillard C.V....Yuan J.X. (2007)
    9. Acute hypoxia selectively inhibits KCNA5 channels in pulmonary artery smooth muscle cells. (PubMed id 16236819)1, 9 Platoshyn O....Yuan J.X. (2006)
    10. Expression of voltage-gated potassium channels Kv1.3 and Kv1.5 in human gliomas. (PubMed id 12850541)1, 9 Preussat K....Patt S. (2003)

    External Searches for KCNA5 gene

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  
      Query String
    		PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    Genome Databases showing KCNA5 gene

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 3741 HGNC: 6224 AceView: KCNA5 Ensembl:ENSG00000130037 euGenes: HUgn3741
    ECgene: KCNA5 H-InvDB: KCNA5

    Other Databases showing KCNA5 gene

    (According to HUGE)
    About This Section
    		   --

    Specialized Databases showing KCNA5 gene

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for KCNA5 Pharmacogenomics, SNPs, Pathways

    Intellectual Property
    for KCNA5 gene

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    		Patent Information for KCNA5 gene:
    Search GeneIP for patents involving KCNA5

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    Products
    for KCNA5 gene

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     Browse Small Molecules at EMD Millipore
     Browse for Gene Knock-down Tools from EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of KCNA5
     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Clones for the Expression of KCNA5
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for KCNA5  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for KCNA5   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for KCNA5  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for KCNA5   OriGene 3'-UTR Clone for KCNA5  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for KCNA5   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for KCNA5  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for KCNA5   OriGene Custom Protein Services for KCNA5  
     OriGene Custom Immunoassay Development  

         		 
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat KCNA5
     Search QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing KCNA5
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat KCNA5
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat KCNA5
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat KCNA5
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat KCNA5
     GenScript Custom Purified and Recombinant Proteins Services for KCNA5 GenScript cDNA clones with any tag delivered in your preferred vector for KCNA5
     GenScript Custom Assay Services for KCNA5 GenScript Custom Superior Antibodies Services for KCNA5
     GenScript Custom overexpressing Cell Line Services for KCNA5 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in KCNA5 promoter
     Search Chromatin IP Primers for KCNA5
     RT2 qPCR Primer Assay in human, mouse, rat KCNA5
     GNC Network for KCNA5
     SABiosciences PCR Arrays including human, mouse, rat KCNA5
     Tocris compounds for KCNA5
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     KCNA5 antibodies
     Antibodies for KCNA5
     See all of Abcam's Antibodies, Kits and Proteins for KCNA5
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     KCNA5 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for KCNA5
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KCNA5
     SwitchGear 3'UTR luciferase reporter plasmids for KCNA5
     SwitchGear Promoter luciferase reporter plasmids for KCNA5
     ThermoFisher Antibodies for KCNA5
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KCNA5
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for KCNA5
    Sirion Biotech Customized:
     stable knockdown cell line services for KCNA5
     inducible knockdown cell line services for KCNA5
     design and validation of potent shRNA sequences against KCNA5
     adenovirus for potent knockdown of KCNA5
     adenovirus for overexpression of KCNA5
     stable overexpressing cell line services for KCNA5
     inducible overexpressing cell line services for KCNA5
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013 , 14 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Copyright © 1996-2013 , Weizmann Institute of Science. All Rights Reserved.
    Hot genes      Disease genes      KCNA5 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4