Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



KBTBD4 Gene

protein-coding   GIFtS: 46
GCID: GC11M049907

Kelch Repeat And BTB (POZ) Domain Containing 4

(Previous name: BTB and kelch domain containing 4)
(Previous symbol: BKLHD4)
  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Kelch Repeat And BTB (POZ) Domain Containing 41 2
BKLHD41 2 3
BTB And Kelch Domain Containing 41 2
BTB And Kelch Domain-Containing Protein 42 3
HSPC2522
Kelch Repeat And BTB Domain-Containing Protein 42

External Ids:    HGNC: 237611   Entrez Gene: 557092   Ensembl: ENSG000001234447   UniProtKB: Q9NVX73   

Export aliases for KBTBD4 gene to outside databases

Previous GC identifers: GC11M047558 GC11M047550 GC11M047597 GC11M047294 GC11M047707 GC11M048079 GC11M048802


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for KBTBD4 Gene:
KBTBD4 (kelch repeat and BTB (POZ) domain containing 4) is a protein-coding gene. An important paralog of this gene is SPOP.


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
Regulatory elements:
   Regulatory transcription factor binding sites in the KBTBD4 gene promoter:
         MEF-2A   C/EBPbeta   ATF-2   c-Jun   aMEF-2   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidKBTBD4 promoter sequence
   Search Chromatin IP Primers for KBTBD4

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KBTBD4


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 11p11.2   Ensembl cytogenetic band:  11p11.2   HGNC cytogenetic band: 11p11.2

KBTBD4 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
KBTBD4 gene location

GeneLoc information about chromosome 11         GeneLoc Exon Structure

GeneLoc location for GC11M049907:  view genomic region     (about GC identifiers)

Start:
47,593,749 bp from pter      End:
47,600,567 bp from pter
Size:
6,819 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, and/or antibodies-online,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: KBTB4_HUMAN, Q9NVX7 (See protein sequence)
Recommended Name: Kelch repeat and BTB domain-containing protein 4  
Size: 518 amino acids; 58144 Da
1 PDB 3D structure from and Proteopedia for KBTBD4:
2EQX (3D)    
Secondary accessions: D3DQS1 D3DQS2 Q6IA85 Q9BUC3 Q9NV76
Alternative splicing: 2 isoforms:  Q9NVX7-1   Q9NVX7-2   

Explore the universe of human proteins at neXtProt for KBTBD4: NX_Q9NVX7

Explore proteomics data for KBTBD4 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys232
  • Modification sites at PhosphoSitePlus

  • See KBTBD4 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_057590.3  NP_060565.4  

    ENSEMBL proteins: 
     ENSP00000433340   ENSP00000436713   ENSP00000415106   ENSP00000434477   ENSP00000435850  
     ENSP00000433404   ENSP00000433653   ENSP00000435651   ENSP00000433124   ENSP00000378703  

    KBTBD4 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for KBTBD4
    OriGene Protein Over-expression Lysate for KBTBD4
    OriGene Custom MassSpec
    OriGene Custom Protein Services for KBTBD4
    GenScript Custom Purified and Recombinant Proteins Services for KBTBD4
    Novus Biologicals KBTBD4 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for KBTBD4

     
    Search eBioscience for Proteins for KBTBD4 

     
    antibodies-online proteins for KBTBD4 (3 products) 

     
    Search antibodies-online for peptides for KBTBD4

    KBTBD4 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for KBTBD4
    Novus Biologicals KBTBD4 Antibodies
    Abcam antibodies for KBTBD4
    Cloud-Clone Corp. Antibodies for KBTBD4
    ThermoFisher Antibodies for KBTBD4
    antibodies-online antibodies for KBTBD4 (6 products) 

    KBTBD4 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for KBTBD4
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for KBTBD4
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for KBTBD4
    Cloud-Clone Corp. CLIAs for KBTBD4
    Search eBioscience for ELISAs for KBTBD4 
    antibodies-online kits for KBTBD4 (4 products) 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    BTBD: BTB/POZ domain containing

    5 InterPro protein domains:
     IPR000210 BTB/POZ-like
     IPR011333 BTB/POZ_fold
     IPR013069 BTB_POZ
     IPR011705 BACK
     IPR015915 Kelch-typ_b-propeller

    Graphical View of Domain Structure for InterPro Entry Q9NVX7

    ProtoNet protein and cluster: Q9NVX7

    3 Blocks protein domains:
    IPB000210 BTB/POZ domain
    IPB011498 Kelch
    IPB011705 BTB/Kelch-associated


    UniProtKB/Swiss-Prot: KBTB4_HUMAN, Q9NVX7
    Similarity: Contains 1 BACK (BTB/Kelch associated) domain
    Similarity: Contains 1 BTB (POZ) domain
    Similarity: Contains 5 Kelch repeats


    Find genes that share domains with KBTBD4           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

         Gene Ontology (GO): 1 molecular function term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding ----
         
    Find genes that share ontologies with KBTBD4           About GenesLikeMe


    Phenotypes:
         2 GenomeRNAi human phenotypes for KBTBD4:
     Increased gamma-H2AX phosphory  Synthetic lethal with c-Myc af 

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for KBTBD4

    miRNA
    Products:
        
    miRTarBase miRNAs that target KBTBD4:
    hsa-mir-18a-3p (MIRT040842)

    Block miRNA regulation of human, mouse, rat KBTBD4 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate KBTBD4 (see all 12):
    hsa-miR-4251 hsa-miR-561 hsa-miR-15a hsa-miR-4299 hsa-miR-497 hsa-miR-424 hsa-miR-544 hsa-miR-138
    SwitchGear 3'UTR luciferase reporter plasmidKBTBD4 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for KBTBD4
    Predesigned siRNA for gene silencing in human, mouse, rat KBTBD4

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for KBTBD4

    Clone
    Products:
         
    OriGene clones in human, mouse for KBTBD4 (see all 14)
    OriGene ORF clones in mouse, rat for KBTBD4
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): KBTBD4 (NM_018095)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KBTBD4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KBTBD4

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for KBTBD4
    Browse ESI BIO Cell Lines and PureStem Progenitors for KBTBD4 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KBTBD4


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol3
    nucleus2

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for KBTBD4
    Interactions:

        Search GeneGlobe Interaction Network for KBTBD4

    STRING Interaction Network Preview (showing 2 interactants - click image to see more details)

    4 Interacting proteins for KBTBD4 (Q9NVX73 ENSP000004151064) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    MPP3Q133683I2D: score=3 
    NKD1Q969G93I2D: score=1 
    UBCENSP000003448184STRING: ENSP00000344818
    DLG3ENSP000003634804STRING: ENSP00000363480
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for KBTBD4 (KBTB4)



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for KBTBD4 gene (2 alternative transcripts): 
    NM_016506.5  NM_018095.4  

    10 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000526005 ENST00000533290(uc001nfw.2) ENST00000430070(uc001nfz.3 uc001nfy.3)
    ENST00000525720 ENST00000530668 ENST00000529499 ENST00000531067 ENST00000529946
    ENST00000534239 ENST00000395288(uc001nfx.3)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat KBTBD4 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate KBTBD4 (see all 12):
    hsa-miR-4251 hsa-miR-561 hsa-miR-15a hsa-miR-4299 hsa-miR-497 hsa-miR-424 hsa-miR-544 hsa-miR-138
    SwitchGear 3'UTR luciferase reporter plasmidKBTBD4 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for KBTBD4
    Predesigned siRNA for gene silencing in human, mouse, rat KBTBD4
    Clone
    Products:
         
    OriGene clones in human, mouse for KBTBD4 (see all 14)
    OriGene ORF clones in mouse, rat for KBTBD4
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): KBTBD4 (NM_018095)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for KBTBD4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KBTBD4
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for KBTBD4
    OriGene qSTAR qPCR primer pairs in human, mouse for KBTBD4
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KBTBD4
      QuantiTect SYBR Green Assays in human, mouse, rat KBTBD4
      QuantiFast Probe-based Assays in human, mouse, rat KBTBD4

    Selected AceView cDNA sequences (see all 149):

    AL539902 BU154139 AL545694 BX325285 BQ057933 BQ221609 BM457188 BQ066797 
    BI836155 BI767307 CR616082 AL713735 BE895299 BI598003 CF994882 BI831955 
    BU155772 BU192838 CR611741 BM758422 BM926918 AA360184 BM783251 BM758688 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    KBTBD4 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GAGGTGTTCT
    KBTBD4 Expression
    About this image


    KBTBD4 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 4) fully expand
     
     Brain (Nervous System)    fully expand to see all 7 entries
             Cerebral Cortex
             brain/midbrain/lateral wall   
     
     Neural Tube (Nervous System)    fully expand to see all 6 entries
             Diencephalic Roof Plate
             brain/midbrain/lateral wall   
     
     Kidney (Urinary System)
             Metanephros
     
     Spinal Cord (Nervous System)
    KBTBD4 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    KBTBD4 Protein Expression
        Custom PCR Arrays for KBTBD4
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for KBTBD4
    OriGene qSTAR qPCR primer pairs in human, mouse for KBTBD4
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KBTBD4
    QuantiTect SYBR Green Assays in human, mouse, rat KBTBD4
    QuantiFast Probe-based Assays in human, mouse, rat KBTBD4
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KBTBD4

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for KBTBD4 gene from Selected species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Kbtbd41 , 5 kelch repeat and BTB (POZ) domain containing 41, 5 91.76(n)1
    99.42(a)1
      2 (50.44 cM)5
    671361  NM_025991.31  NP_080267.11 
     909047405 
    chicken
    (Gallus gallus)
    Aves KBTBD41 kelch repeat and BTB (POZ) domain containing 4 78.76(n)
    90.35(a)
      423180  NM_001199645.1  NP_001186574.1 
    lizard
    (Anolis carolinensis)
    Reptilia KBTBD46
    kelch repeat and BTB (POZ) domain containing 4
    85(a)
    1 ↔ 1
    1(44268880-44276055)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia MGC761292 hypothetical protein MGC76129 75.52(n)    BC064867.1 
    zebrafish
    (Danio rerio)
    Actinopterygii zgc562042 hypothetical protein MGC56204 73.42(n)   393178  BC045989.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta CG70586
    --
    5(a)
    1 ↔ 1
    X(18700727-18706035)
    worm
    (Caenorhabditis elegans)
    Secernentea bath-416
    bath-426
    (see all 3)
    Protein BATH-42 (bath-42) mRNA, complete cds
    (see all 3)
    9(a)
    14(a)
    (see all 3)
    1 ↔ many
    1 ↔ many
    (see all 3)
    III(6720415-6722258) WBGene00018137
    III(8161449-8163383) WBGene00016803


    ENSEMBL Gene Tree for KBTBD4 (if available)
    TreeFam Gene Tree for KBTBD4 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for KBTBD4 gene
    SPOP2  SPOPL2  
    12 SIMAP similar genes for KBTBD4 using alignment to 10 protein entries:     KBTB4_HUMAN (see all proteins):
    KLHL2    BTBD9    KLHL7    KLHL26    KLHL28    KBTBD3
    KLHL24    KBTBD8    KLHL3    KEAP1    KLHL18    ZBTB38

    Find genes that share paralogs with KBTBD4           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for KBTBD4 (see all 72)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 11 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1481815971,2
    C--47522083(+) AAACT-/CCATCTCTCTCTCTCTAGC
    CTGGGCAACAAGAGCGAAACTC
    CCATC
    3 -- int10--------
    rs1915901501,2
    --47595523(+) CCGGGC/TGGAGA 3 -- int10--------
    rs1838445281,2
    --47595538(+) GTTGTA/TTTCAT 3 -- int10--------
    rs1466943391,2
    --47595658(+) GGTGGC/TACTGG 3 -- int10--------
    rs1393708381,2
    C--47595771(+) TGGCCA/GGGCAC 3 -- int10--------
    rs354994031,2
    --47595986(+) GGAGGA/TTGCAG 3 -- int10--------
    rs1910056531,2
    --47596099(+) ATAATA/CTGGCC 3 -- int10--------
    rs1821131221,2
    --47596322(+) AATCGC/TTTGAA 3 -- int10--------
    rs1867115521,2
    --47596361(+) AGATCA/GCACCA 3 -- int10--------
    rs758252781,2
    C--47596440(+) AAACT-/CCCATC 3 -- int11Minor allele frequency- C:0.00CSA 2

    HapMap Linkage Disequilibrium report for KBTBD4 (47593749 - 47600567 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 5 variations for KBTBD4:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv509405CNV Insertion20534489
    nsv897325CNV Loss21882294
    nsv314CNV Loss18451855
    nsv832142CNV Loss17160897
    nsv825872CNV Gain20364138

    Site Specific Mutation Identification with PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing KBTBD4
    DNA2.0 Custom Variant and Variant Library Synthesis for KBTBD4

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
      --

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for KBTBD4 gene, integrated from 10 sources (see all 13):
    (articles sorted by number of sources associating them with KBTBD4)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    3. Cloning and functional analysis of cDNAs with open reading frames for 300 previously undefined genes expressed in CD34+ hematopoietic stem/progenitor cells. (PubMed id 11042152)1, 3 Zhang Q.-H.... Chen Z. (Genome Res. 2000)
    4. Quantitative analysis of HSP90-client interactions reveals principles of substrate recognition. (PubMed id 22939624)1 Taipale M....Lindquist S. (Cell 2012)
    5. Systematic and quantitative assessment of the ubiquitin-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (Mol. Cell 2011)
    6. A proteome-wide, quantitative survey of in vivo ubiquitylation sites reveals widespread regulatory roles. (PubMed id 21890473)1 Wagner S.A....Choudhary C. (amp 2011)
    7. Global identification of modular cullin-RING ligase substrates. (PubMed id 21963094)1 Emanuele M.J....Elledge S.J. (Cell 2011)
    8. Dynamics of cullin-RING ubiquitin ligase network revealed by systematic quantitative proteomics. (PubMed id 21145461)1 Bennett E.J....Harper J.W. (Cell 2010)
    9. The full-ORF clone resource of the German cDNA consortium. (PubMed id 17974005)2 Bechtel S.... Schupp I. (BMC Genomics 2007)
    10. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)1 Kimura K.... Sugano S. (Genome Res. 2006)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 55709 HGNC: 23761 AceView: KBTBD4 Ensembl:ENSG00000123444 euGenes: HUgn55709
    ECgene: KBTBD4 H-InvDB: KBTBD4

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for KBTBD4 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for KBTBD4 gene:
    Search GeneIP for patents involving KBTBD4

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for KBTBD4  
     OriGene qPCR primer pairs and template standards for KBTBD4   OriGene Protein Over-expression Lysate for KBTBD4  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for KBTBD4  
     OriGene qSTAR qPCR primer pairs in human, mouse for KBTBD4   OriGene Purified Protein for KBTBD4  
     OriGene ORF clones in mouse, rat for KBTBD4   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for KBTBD4   OriGene Custom Protein Services for KBTBD4  

     
     
     Block miRNA regulation of human, mouse, rat KBTBD4 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing KBTBD4
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat KBTBD4 Predesigned siRNA for gene silencing in human, mouse, rat KBTBD4
     QuantiFast Probe-based Assays in human, mouse, rat KBTBD4 QuantiTect SYBR Green Assays in human, mouse, rat KBTBD4
     Custom PCR Arrays for KBTBD4 Search Chromatin IP Primers for KBTBD4
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat KBTBD4  Search GeneGlobe Interaction Network for KBTBD4
     Regulatory tfbs in KBTBD4 promoter
     GenScript Custom Purified and Recombinant Proteins Services for KBTBD4 GenScript cDNA clones with any tag delivered in your preferred vector for KBTBD4
     GenScript Custom Assay Services for KBTBD4 GenScript Custom overexpressing Cell Line Services for KBTBD4
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for KBTBD4 (KBTB4)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     KBTBD4 antibodies
     KBTBD4 lysates
     Antibodies for KBTBD4
     See all of Abcam's Antibodies, Kits and Proteins for KBTBD4
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for KBTBD4
     Antibodies for KBTBD4
     ELISAs for KBTBD4
     CLIAs for KBTBD4



     Browse ESI BIO Cell Lines and PureStem Progenitors for KBTBD4
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for KBTBD4
     SwitchGear 3'UTR luciferase reporter plasmids for KBTBD4
     SwitchGear Promoter luciferase reporter plasmids for KBTBD4
     ThermoFisher Antibodies for KBTBD4
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat KBTBD4
     Browse compounds at ApexBio
     Search Addgene for plasmids for KBTBD4
      Search eBioscience for proteins for KBTBD4
      Search eBioscience for elisas for KBTBD4
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for KBTBD4
     antibodies-online antibodies for KBTBD4 (6 products)
     antibodies-online kits for KBTBD4 (4 products)
      Search antibodies-online for peptides for KBTBD4
     antibodies-online proteins for KBTBD4 (3 products)
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 7 Oct 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      KBTBD4 gene at Home site.
    Version: 3.12.258 10 Dec 2014
    hostname: 356980-web2.xennexinc.com index build: 128 solr: 1.4