Free for academic non-profit institutions. Other users need a Commercial license

Aliases for JMJD7-PLA2G4B Gene

Aliases for JMJD7-PLA2G4B Gene

  • JMJD7-PLA2G4B Readthrough 2 3
  • Jumonji Domain Containing 7-Phospholipase A2, Group IVB (Cytosolic) Read-Through 3
  • CPLA2-Beta 3
  • HsT16992 3

External Ids for JMJD7-PLA2G4B Gene

Previous GeneCards Identifiers for JMJD7-PLA2G4B Gene

  • GC15P039910
  • GC15P042122
  • GC15P018968

Summaries for JMJD7-PLA2G4B Gene

Entrez Gene Summary for JMJD7-PLA2G4B Gene

  • This locus represents naturally-occurring readthrough transcription between the neighboring jumonji domain containing 7 (JMJD7) and phospholipase A2, group IVB (cytosolic) (PLA2G4B) genes. Readthrough transcripts encode fusion proteins that share amino acid sequence with each individual gene product, including a partial JmjC domain and downstream C2 and phospholipase A2 domains. Alternatively spliced transcript variants have been observed. [provided by RefSeq, Oct 2013]

GeneCards Summary for JMJD7-PLA2G4B Gene

JMJD7-PLA2G4B (JMJD7-PLA2G4B Readthrough) is a Protein Coding gene. Among its related pathways are MAPK signaling pathway and Ras signaling pathway. GO annotations related to this gene include calcium ion binding and phospholipase activity. An important paralog of this gene is PLA2G4C.

Gene Wiki entry for JMJD7-PLA2G4B Gene

No data available for UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for JMJD7-PLA2G4B Gene

Genomics for JMJD7-PLA2G4B Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for JMJD7-PLA2G4B Gene

Chromosome:
15
Start:
41,828,085 bp from pter
End:
41,848,155 bp from pter
Size:
20,071 bases
Orientation:
Plus strand

Genomic View for JMJD7-PLA2G4B Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for JMJD7-PLA2G4B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for JMJD7-PLA2G4B Gene

No data available for Regulatory Elements for JMJD7-PLA2G4B Gene

Proteins for JMJD7-PLA2G4B Gene

  • Protein details for JMJD7-PLA2G4B Gene (UniProtKB/TrEMBL)

    Protein Symbol:
    H0Y9G9
    Recommended name:
    Protein JMJD7-PLA2G4B
    Protein Accession:
    H0Y9G9

    Protein attributes for JMJD7-PLA2G4B Gene

    Size:
    81 amino acids
    Molecular mass:
    9403 Da
    Quaternary structure:
    No Data Available

neXtProt entry for JMJD7-PLA2G4B Gene

Proteomics data for JMJD7-PLA2G4B Gene at MOPED

Protein Expression for JMJD7-PLA2G4B Gene

Post-translational modifications for JMJD7-PLA2G4B Gene

No Post-translational modifications

Other Protein References for JMJD7-PLA2G4B Gene

Antibody Products

No data available for DME Specific Peptides for JMJD7-PLA2G4B Gene

Domains & Families for JMJD7-PLA2G4B Gene

Protein Domains for JMJD7-PLA2G4B Gene

InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with JMJD7-PLA2G4B: view

No data available for Gene Families , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for JMJD7-PLA2G4B Gene

Function for JMJD7-PLA2G4B Gene

Gene Ontology (GO) - Molecular Function for JMJD7-PLA2G4B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004620 phospholipase activity --
GO:0005515 protein binding --
genes like me logo Genes that share ontologies with JMJD7-PLA2G4B: view

Phenotypes for JMJD7-PLA2G4B Gene

genes like me logo Genes that share phenotypes with JMJD7-PLA2G4B: view

Animal Model Products

CRISPR Products

miRNA for JMJD7-PLA2G4B Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for JMJD7-PLA2G4B Gene

Localization for JMJD7-PLA2G4B Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for JMJD7-PLA2G4B Gene

Pathways & Interactions for JMJD7-PLA2G4B Gene

genes like me logo Genes that share pathways with JMJD7-PLA2G4B: view

Pathways by source for JMJD7-PLA2G4B Gene

Interacting Proteins for JMJD7-PLA2G4B Gene

Gene Ontology (GO) - Biological Process for JMJD7-PLA2G4B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008152 metabolic process --
GO:0009395 phospholipid catabolic process --
genes like me logo Genes that share ontologies with JMJD7-PLA2G4B: view

No data available for SIGNOR curated interactions for JMJD7-PLA2G4B Gene

Drugs & Compounds for JMJD7-PLA2G4B Gene

No Compound Related Data Available

Transcripts for JMJD7-PLA2G4B Gene

Unigene Clusters for JMJD7-PLA2G4B Gene

JMJD7-PLA2G4B readthrough:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for JMJD7-PLA2G4B Gene

No ASD Table

Relevant External Links for JMJD7-PLA2G4B Gene

GeneLoc Exon Structure for
JMJD7-PLA2G4B
ECgene alternative splicing isoforms for
JMJD7-PLA2G4B

Expression for JMJD7-PLA2G4B Gene

mRNA expression in normal human tissues for JMJD7-PLA2G4B Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for JMJD7-PLA2G4B Gene

This gene is overexpressed in Cervix (33.0) and Urine (32.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from PaxDb for JMJD7-PLA2G4B Gene



SOURCE GeneReport for Unigene cluster for JMJD7-PLA2G4B Gene Hs.198161

genes like me logo Genes that share expression patterns with JMJD7-PLA2G4B: view

Protein tissue co-expression partners for JMJD7-PLA2G4B Gene

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

In Situ Assay Products

No data available for mRNA differential expression in normal tissues and mRNA Expression by UniProt/SwissProt for JMJD7-PLA2G4B Gene

Orthologs for JMJD7-PLA2G4B Gene

This gene was present in the common ancestor of chordates.

Orthologs for JMJD7-PLA2G4B Gene

Organism Taxonomy Gene Similarity Type Details
mouse
(Mus musculus)
Mammalia Pla2g4b 16
Pla2g4b 36
  • 84 (a)
ManyToMany
PLA2G4B 36
  • 81 (a)
ManyToMany
cow
(Bos Taurus)
Mammalia PLA2G4B 36
  • 84 (a)
OneToMany
dog
(Canis familiaris)
Mammalia PLA2G4B 36
  • 81 (a)
OneToMany
platypus
(Ornithorhynchus anatinus)
Mammalia -- 36
  • 69 (a)
OneToMany
chimpanzee
(Pan troglodytes)
Mammalia -- 36
  • 97 (a)
ManyToMany
-- 36
  • 98 (a)
ManyToMany
chicken
(Gallus gallus)
Aves -- 36
  • 46 (a)
OneToMany
lizard
(Anolis carolinensis)
Reptilia -- 36
  • 46 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 23 (a)
ManyToMany
-- 36
  • 19 (a)
ManyToMany
Species with no ortholog for JMJD7-PLA2G4B:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for JMJD7-PLA2G4B Gene

ENSEMBL:
Gene Tree for JMJD7-PLA2G4B (if available)
TreeFam:
Gene Tree for JMJD7-PLA2G4B (if available)

Paralogs for JMJD7-PLA2G4B Gene

Paralogs for JMJD7-PLA2G4B Gene

(1) SIMAP similar genes for JMJD7-PLA2G4B Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with JMJD7-PLA2G4B: view

Variants for JMJD7-PLA2G4B Gene

Sequence variations from dbSNP and Humsavar for JMJD7-PLA2G4B Gene

SNP ID Clin Chr 15 pos Sequence Context AA Info Type MAF
rs747287338 -- 41,847,563(+) CAGTC(-/CCCCACACCTCCTCCGTCCCCTGTG)CCTCT intron-variant
rs765731111 -- 41,847,571(+) CACAC(-/CTCCTCCGTCCCCTGTGCCTCTCCAAACCTGTCTTCCCCACAA)CGTGT intron-variant
rs773745185 -- 41,847,575(+) CCTCC(-/TCCGTCCCCTGTGCCTCT)CCAAA intron-variant
rs776996660 -- 41,847,569(+) CCCAC(-/ACCTCCTCCGTCCCCTGTGCCTCTCCAA)ACCTG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for JMJD7-PLA2G4B Gene

Variant ID Type Subtype PubMed ID
dgv740e1 CNV Complex 17122850
nsv904115 CNV Loss 21882294
nsv904116 CNV Loss 21882294
nsv517631 CNV Loss 19592680
dgv2364n71 CNV Loss 21882294
nsv904119 CNV Loss 21882294
dgv2365n71 CNV Loss 21882294
nsv9244 CNV Gain 18304495
nsv1506 CNV Insertion 18451855
nsv904126 CNV Loss 21882294

Variation tolerance for JMJD7-PLA2G4B Gene

Residual Variation Intolerance Score: 95.86% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for JMJD7-PLA2G4B Gene

HapMap Linkage Disequilibrium report
JMJD7-PLA2G4B
Human Gene Mutation Database (HGMD)
JMJD7-PLA2G4B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for JMJD7-PLA2G4B Gene

Disorders for JMJD7-PLA2G4B Gene

Relevant External Links for JMJD7-PLA2G4B

Human Genome Epidemiology (HuGE) Navigator
JMJD7-PLA2G4B
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
JMJD7-PLA2G4B
genes like me logo Genes that share disorders with JMJD7-PLA2G4B: view

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for JMJD7-PLA2G4B Gene

Publications for JMJD7-PLA2G4B Gene

  1. Identification of the expressed form of human cytosolic phospholipase A2beta (cPLA2beta): cPLA2beta3 is a novel variant localized to mitochondria and early endosomes. (PMID: 16617059) Ghosh M. … Leslie C.C. (J. Biol. Chem. 2006) 23 67
  2. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 67
  3. The palmitoyl acyltransferase HIP14 shares a high proportion of interactors with huntingtin: implications for a role in the pathogenesis of Huntington's disease. (PMID: 24705354) Butland S.L. … Hayden M.R. (Hum. Mol. Genet. 2014) 67
  4. Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. (PMID: 20967262) Prakash T. … Taylor T.D. (PLoS ONE 2010) 67
  5. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PMID: 20628086) Bailey S.D. … Anand S. (Diabetes Care 2010) 67

Products for JMJD7-PLA2G4B Gene

Sources for JMJD7-PLA2G4B Gene

Back to Top

Content