Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)


ITSN2 Gene

protein-coding   GIFtS: 61
GCID: GC02M024425

Intersectin 2

(Previous name: SH3 domain protein 1B)
(Previous symbol: SH3D1B)
  See related diseases

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Intersectin 21 2     KIAA12563 5
SH3D1B1 2 3 5     SH3 Domain Protein 1B1
SWAP2 3 5     SH3P18-Like WASP Associated Protein1
SH3P182 3     PRO20152
SH3 Domain-Containing Protein 1B2 3     SWA2
SH3P18-Like WASP-Associated Protein2 3     intersectin-22

External Ids:    HGNC: 61841   Entrez Gene: 506182   Ensembl: ENSG000001983997   OMIM: 6044645   UniProtKB: Q9NZM33   

Export aliases for ITSN2 gene to outside databases

Previous GC identifers: GC02M024341 GC02M024518 GC02M024400 GC02M024337 GC02M024164

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ITSN2 Gene:
This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of
proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of
clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis.
Alternatively spliced transcript variants have been found for this gene that encode three distinct isoforms.
Additional variants have been found but their full length nature has not been determined. (provided by RefSeq,
Jul 2008)

GeneCards Summary for ITSN2 Gene:
ITSN2 (intersectin 2) is a protein-coding gene. Diseases associated with ITSN2 include factor xi deficiency, and schistosomiasis. GO annotations related to this gene include Rho guanyl-nucleotide exchange factor activity and calcium ion binding. An important paralog of this gene is REPS1.

UniProtKB/Swiss-Prot: ITSN2_HUMAN, Q9NZM3
Function: Adapter protein that may provide indirect link between the endocytic membrane traffic and the actin
assembly machinery. May regulate the formation of clathrin-coated vesicles (CCPs). Seems to be involved in CCPs
maturation including invagination or budding. Involved in endocytosis of integrin beta-1 (ITGB1) and transferrin
receptor (TFR)

Gene Wiki entry for ITSN2 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000002.12  NC_018913.2  NT_022184.16  
Regulatory elements:
   Regulatory transcription factor binding sites in the ITSN2 gene promoter:
         RelA   AP-4   STAT5A   Arnt   GATA-2   Evi-1   Roaz   PPAR-gamma1   PPAR-gamma2   NF-kappaB1   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidITSN2 promoter sequence
   Search Chromatin IP Primers for ITSN2

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ITSN2

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 2p23.3   Ensembl cytogenetic band:  2p23.3   HGNC cytogenetic band: 2p23.3

ITSN2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ITSN2 gene location

GeneLoc information about chromosome 2         GeneLoc Exon Structure

GeneLoc location for GC02M024425:  view genomic region     (about GC identifiers)

24,425,733 bp from pter      End:
24,583,583 bp from pter
157,851 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: ITSN2_HUMAN, Q9NZM3 (See protein sequence)
Recommended Name: Intersectin-2  
Size: 1697 amino acids; 193461 Da
Subunit: Belongs to a complex that may contain multimers of ITSN1, ITSN2 and EPS15, and different partners
according to the step in the endocytic process. Interacts with ADAM15. Interacts with FASLG. Interacts with
ANKRD54 (By similarity). Interacts with FCHO2
Miscellaneous: Overexpression results in the inhibition of the transferrin uptake and the blockage of the
clathrin-mediated endocytosis
Caution: It is uncertain whether Met-1 or Met-2 is the initiator
Caution: Studies in clathrin-mediated endocytosis of ITGB1 and TFR used a siRNA mixture of ISTN1 and ISTN2
suggesting a partially overlapping role of the EH domain-containing proteins (PubMed:22648170)
Sequence caution: Sequence=AAF59903.1; Type=Erroneous initiation; Note=Translation N-terminally extended;
Sequence=AAF59904.1; Type=Erroneous initiation; Note=Translation N-terminally extended; Sequence=AAF63600.1;
Type=Erroneous initiation; Note=Translation N-terminally shortened; Sequence=BAA86570.1; Type=Erroneous
initiation; Note=Translation N-terminally shortened;
Selected PDB 3D structures from and Proteopedia for ITSN2 (see all 8):
1J3T (3D)        1UDL (3D)        1UE9 (3D)        1UFF (3D)        1UHF (3D)        3GF9 (3D)    
Secondary accessions: O95062 Q15812 Q9HAK4 Q9NXE6 Q9NYG0 Q9NZM2 Q9ULG4
Alternative splicing: 4 isoforms:  Q9NZM3-1   Q9NZM3-2   Q9NZM3-3   Q9NZM3-4   (Ref.1 (AAF59904) sequence is in conflict in position: 1235:R->W)

Explore the universe of human proteins at neXtProt for ITSN2: NX_Q9NZM3

Explore proteomics data for ITSN2 at MOPED

Post-translational modifications: 

  • Ubiquitination2 at Lys566
  • Modification sites at PhosphoSitePlus

  • See ITSN2 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (3 alternative transcripts): 
    NP_006268.2  NP_062541.3  NP_671494.2  

    ENSEMBL proteins: 
     ENSP00000354561   ENSP00000347244   ENSP00000395682   ENSP00000411319   ENSP00000384499  
     ENSP00000389013   ENSP00000391224   ENSP00000391715  

    ITSN2 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for ITSN2
    GenScript Custom Purified and Recombinant Proteins Services for ITSN2
    Novus Biologicals ITSN2 Protein
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for ITSN2

    ITSN2 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for ITSN2
    Novus Biologicals ITSN2 Antibodies
    Abcam antibodies for ITSN2
    Cloud-Clone Corp. Antibodies for ITSN2
    Search ThermoFisher Antibodies for ITSN2
    LSBio Antibodies in human, mouse, rat for ITSN2

    ITSN2 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ITSN2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for ITSN2
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for ITSN2
    Cloud-Clone Corp. CLIAs for ITSN2

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    EFHAND: EF-hand domain containing
    ARHGEF: Rho guanine nucleotide exchange factors

    Selected InterPro protein domains (see all 11):
     IPR011992 EF-hand-dom_pair
     IPR002048 EF_hand_dom
     IPR000219 DH-domain
     IPR001849 Pleckstrin_homology
     IPR001452 SH3_domain

    Graphical View of Domain Structure for InterPro Entry Q9NZM3

    ProtoNet protein and cluster: Q9NZM3

    5 Blocks protein domains:
    IPB000008 C2 domain
    IPB000219 DH domain
    IPB000261 EPS15 homology (EH)
    IPB001849 Pleckstrin-like
    IPB011511 Variant SH3

    UniProtKB/Swiss-Prot: ITSN2_HUMAN, Q9NZM3
    Similarity: Contains 1 C2 domain
    Similarity: Contains 1 DH (DBL-homology) domain
    Similarity: Contains 1 EF-hand domain
    Similarity: Contains 2 EH domains
    Similarity: Contains 1 PH domain
    Similarity: Contains 5 SH3 domains

    ITSN2 for domains           About GeneDecksing

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ITSN2_HUMAN, Q9NZM3
    Function: Adapter protein that may provide indirect link between the endocytic membrane traffic and the actin
    assembly machinery. May regulate the formation of clathrin-coated vesicles (CCPs). Seems to be involved in CCPs
    maturation including invagination or budding. Involved in endocytosis of integrin beta-1 (ITGB1) and transferrin
    receptor (TFR)

         Gene Ontology (GO): 4 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005070SH3/SH2 adaptor activity TAS9630982
    GO:0005089Rho guanyl-nucleotide exchange factor activity IEA--
    GO:0005509calcium ion binding IEA--
    GO:0005515protein binding IPI17696407
    ITSN2 for ontologies           About GeneDecksing

         7 GenomeRNAi human phenotypes for ITSN2:
     Cell division defect  Decreased NANOG protein expres  Decreased OCT4 protein express  Decreased POU5F1-GFP protein e 
     Decreased cilium length after   Increased G2M DNA content, inc  Increased cell size 

         3 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Itsn2):
     behavior/neurological  growth/size/body  nervous system 

    ITSN2 for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Itsn2tm1Egan for ITSN2

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ITSN2
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ITSN2

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ITSN2
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ITSN2

    miRTarBase miRNAs that target ITSN2:
    hsa-mir-186-5p (MIRT044995), hsa-mir-21-5p (MIRT030879), hsa-mir-148b-3p (MIRT019375), hsa-mir-124-3p (MIRT022783), hsa-mir-149-5p (MIRT045590), hsa-mir-320c (MIRT036170)

    Block miRNA regulation of human, mouse, rat ITSN2 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ITSN2 (see all 35):
    hsa-miR-429 hsa-miR-513a-5p hsa-miR-3651 hsa-miR-128 hsa-miR-16-1* hsa-miR-138-2* hsa-miR-124 hsa-miR-506
    SwitchGear 3'UTR luciferase reporter plasmidITSN2 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for ITSN2
    Predesigned siRNA for gene silencing in human, mouse, rat ITSN2

    Gene Editing
    DNA2.0 Custom Protein Engineering Service for ITSN2

    OriGene clones in human, mouse for ITSN2 (see all 25)
    OriGene ORF clones in mouse, rat for ITSN2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ITSN2 (NM_006277)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ITSN2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ITSN2

    Cell Line
    GenScript Custom overexpressing Cell Line Services for ITSN2
    Browse ESI BIO Cell Lines and PureStem Progenitors for ITSN2 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ITSN2

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    ITSN2_HUMAN, Q9NZM3: Cytoplasm
    Subcellular locations from COMPARTMENTS: 

    golgi apparatus1
    plasma membrane1

    Gene Ontology (GO): 2 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm IEA--
    GO:0070062extracellular vesicular exosome IDA19056867

    ITSN2 for ontologies           About GeneDecksing

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for ITSN2 About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Regulation of CDC42 activity
    Regulation of CDC42 activity

    1 Downloadable PowerPoint Slide of GeneGlobe Pathway Central Maps for ITSN2
        EphB-EphrinB Signaling

    1 BioSystems Pathway for ITSN2
        Regulation of CDC42 activity

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for ITSN2

        Search GeneGlobe Interaction Network for ITSN2

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for ITSN2 (Q9NZM31, 2, 3 ENSP000003472444) via UniProtKB, MINT, STRING, and/or I2D (see all 174)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    BCCIPQ9P2872, 3MINT-65663 I2D: score=5 
    PTNP212462, 3MINT-65661 I2D: score=5 
    TBL3Q127882, 3MINT-65662 I2D: score=5 
    KIAA1549Q9HCM33, ENSP000002423654I2D: score=3 STRING: ENSP00000242365
    MAP4K3Q8IVH83, ENSP000002638814I2D: score=3 STRING: ENSP00000263881
    About this table

    Gene Ontology (GO): 3 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006897endocytosis IEA--
    GO:0009967positive regulation of signal transduction TAS9630982
    GO:0035023regulation of Rho protein signal transduction ----

    ITSN2 for ontologies           About GeneDecksing

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ITSN2

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ITSN2 gene (3 alternative transcripts): 
    NM_006277.2  NM_019595.3  NM_147152.2  

    Unigene Cluster for ITSN2:

    Intersectin 2
    Hs.432562  [show with all ESTs]
    Unigene Representative Sequence: NM_006277
    12 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000478720 ENST00000361999 ENST00000355123(uc002rfe.2) ENST00000427234
    ENST00000449392 ENST00000479575 ENST00000406921(uc002rfg.3) ENST00000416160(uc002rfh.1)
    ENST00000412011 ENST00000469848 ENST00000443927 ENST00000407704
    Block miRNA regulation of human, mouse, rat ITSN2 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ITSN2 (see all 35):
    hsa-miR-429 hsa-miR-513a-5p hsa-miR-3651 hsa-miR-128 hsa-miR-16-1* hsa-miR-138-2* hsa-miR-124 hsa-miR-506
    SwitchGear 3'UTR luciferase reporter plasmidITSN2 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for ITSN2
    Predesigned siRNA for gene silencing in human, mouse, rat ITSN2
    OriGene clones in human, mouse for ITSN2 (see all 25)
    OriGene ORF clones in mouse, rat for ITSN2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 3): ITSN2 (NM_006277)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ITSN2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ITSN2
    OriGene qSTAR qPCR primer pairs in human, mouse for ITSN2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ITSN2
      QuantiTect SYBR Green Assays in human, mouse, rat ITSN2
      QuantiFast Probe-based Assays in human, mouse, rat ITSN2

    Additional mRNA sequence: 

    AB033082.1 AF001630.1 AF038189.1 AF182198.1 AF182199.1 AF248540.1 AK000302.1 AK021545.1 
    AK025400.1 AK091859.1 AK096750.1 AK097890.1 AK127858.1 BC020921.2 BC038963.1 BC146779.1 

    17 DOTS entries:

    DT.113819  DT.92414525  DT.99993481  DT.91761251  DT.95269732  DT.100024497  DT.100784242  DT.86841735 
    DT.99930496  DT.437856  DT.433395  DT.95182304  DT.40203830  DT.65284450  DT.91989488  DT.40130526 

    Selected AceView cDNA sequences (see all 235):

    NM_006277 AI422164 AI366803 AI285232 R57124 AW072850 AI580878 NM_147152 
    AI831334 AF182199 BQ574640 CD517111 Z40060 AW183595 AA873595 AA808475 
    AK000302 AI627562 BM556859 AA258941 AA780031 AI078087 NM_019595 AA336957 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ITSN2 (see all 11)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8a · 8b ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15a · 15b ^ 16a · 16b ^ 17 ^ 18 ^ 19 ^ 20a · 20b ^ 21 ^ 22a ·
    SP2:                                      -                                                                                                                     

    ExUns: 22b ^ 23 ^ 24 ^ 25 ^ 26 ^ 27 ^ 28 ^ 29 ^ 30a · 30b ^ 31 ^ 32 ^ 33 ^ 34 ^ 35a · 35b · 35c ^ 36 ^ 37 ^ 38a · 38b ^ 39a · 39b ^ 40
    SP4:                                            -           -                                                                                       
    SP5:                                            -                                                                                                   

    ECgene alternative splicing isoforms for ITSN2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ITSN2 expression in normal human tissues (normalized intensities)      ITSN2 embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    ITSN2 Expression
    About this image

    ITSN2 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     Heart (Cardiovascular System)
             Cardiac Crescent Cells Cardiac Crescent
    ITSN2 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ITSN2 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.432562

    UniProtKB/Swiss-Prot: ITSN2_HUMAN, Q9NZM3
    Tissue specificity: Ubiquitous. Isoform 1 is primarily expressed in adult heart and liver

        Custom PCR Arrays for ITSN2
    OriGene qSTAR qPCR primer pairs in human, mouse for ITSN2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ITSN2
    QuantiTect SYBR Green Assays in human, mouse, rat ITSN2
    QuantiFast Probe-based Assays in human, mouse, rat ITSN2
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ITSN2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for ITSN2 gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Itsn21 , 5 intersectin 21, 5 88.73(n)1
      12 (2.09 cM)5
    204031  NM_001198968.21  NP_001185897.11 
    (Gallus gallus)
    Aves ITSN21 intersectin 2 77.92(n)
      421979  XM_419989.4  XP_419989.4 
    (Anolis carolinensis)
    Reptilia ITSN26
    intersectin 2
    1 ↔ 1
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia itsn21 intersectin 2 70.83(n)
      100127728  XM_004918185.1  XP_004918242.1 
    (Danio rerio)
    Actinopterygii Dr.60132 Transcribed sequence with moderate similarity to protein more 76.95(n)    CF348142.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Dap1603 neurotransmitter secretion 28(a)   39A4   --
    (Caenorhabditis elegans)
    Secernentea Y116A8C.363   -- 26(a)   IV(17119830-17122230)   --
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes TUS1(YLR425W)4 Guanine nucleotide exchange factor (GEF) that functions more   --   12(982894-986817) 851145  NP_013529.1 

    ENSEMBL Gene Tree for ITSN2 (if available)
    TreeFam Gene Tree for ITSN2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for ITSN2 gene
    REPS12  EPS15L12  EHD32  REPS22  EHD22  EHD12  EHD42  ITSN12  
    EPS152  SRL2  
    Selected SIMAP similar genes for ITSN2 using alignment to 9 protein entries:     ITSN2_HUMAN (see all proteins) (see all similar genes):
    GRAP    GRB2    GRAP2    ITSN1    SH3GL2    FYN
    GRAPL    ARHGEF7    ABI2    DKFZp686J17173    ABI1    AHI1
    ASAP1    MAP3K9    SH3GL1    REPS1    STAM    ARHGEF16

    ITSN2 for paralogs           About GeneDecksing

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ITSN2 (see all 3048)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 2 posSequence#AA
    C,A--24164043(+) AAAAAA/GGGGGG 2 -- ds50010--------
    --24164043(+) AAAAA-/GGGGGGGG 2 -- cds10--------
    --24172246(+) AAAAA-/GAAAAA 2 -- int10--------
    C--24185484(+) AAAGAA/GAGAAA 3 -- int10--------
    3 -- int11Minor allele frequency- ACAACTAACAGGAAAGCCTCAAAGTGTAAAATAAAAAA:0.00NA 2
    C--24197700(+) AATGA-/GATA  
    3 -- int10--------
    C--24199010(+) CTAGG-/AGGTCTGA 6 -- int1 cds11Minor allele frequency- AGG:0.00NA 2
    --24212888(+) TCAAA-/GAAAAA 3 -- int10--------
    C--24212965(+) TATATA/GTATGT 3 -- int10--------
    C--24212967(+) TATGTA/GTGTGT 3 -- int10--------

    HapMap Linkage Disequilibrium report for ITSN2 (24425733 - 24583583 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for ITSN2 (see all 16):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2719817CNV Deletion23290073
    esv2719816CNV Deletion23290073
    esv2719819CNV Deletion23290073
    esv1408843CNV Deletion17803354
    esv2667505CNV Deletion23128226
    esv2663621CNV Deletion23128226
    esv2719815CNV Deletion23290073
    esv2660423CNV Deletion23128226
    esv2131572CNV Deletion18987734
    esv1382590CNV Insertion17803354

    Human Gene Mutation Database (HGMD): ITSN2
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing ITSN2
    DNA2.0 Custom Variant and Variant Library Synthesis for ITSN2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 604464    OMIM disorders: --

    13 diseases for ITSN2:    About MalaCards
    factor xi deficiency    schistosomiasis    wiskott-aldrich syndrome    spasticity
    atopic dermatitis    kaposi's sarcoma    dermatitis    sarcoma
    parkinson's disease    schizophrenia    pancreatic cancer    pancreatitis
    alzheimer's disease

    ITSN2 for disorders           About GeneDecksing

    Genetic Association Database (GAD): ITSN2
    Human Genome Epidemiology (HuGE) Navigator: ITSN2 (2 documents)

    Export disorders for ITSN2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ITSN2 gene, integrated from 10 sources (see all 55):
    (articles sorted by number of sources associating them with ITSN2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Intersectin 2, a new multimodular protein involved in clathrin- mediated endocytosis. (PubMed id 10922467)1, 2, 3, 9 Pucharcos C.... de la Luna S. (FEBS Lett. 2000)
    2. The intersectin 2 adaptor links Wiskott Aldrich Syndrome protein (WASp)-mediated actin polymerization to T cell antigen receptor endocytosis. (PubMed id 11748279)1, 3, 9 McGavin M.K....Siminovitch K.A. (J. Exp. Med. 2001)
    3. The human intersectin genes and their spliced variants are differentially expressed. (PubMed id 11690630)1, 2, 9 Pucharcos C.... de la Luna S. (Biochim. Biophys. Acta 2001)
    4. Genome-wide pharmacogenomic study of neurocognition as an indicator of antipsychotic treatment response in schizophrenia. (PubMed id 21107309)1, 4 McClay J.L....van den Oord E.J. (Neuropsychopharmacology 2011)
    5. FCHo proteins are nucleators of clathrin-mediated endocytosis. (PubMed id 20448150)1, 2 Henne W.M.... McMahon H.T. (Science 2010)
    6. Mutation of ARHGAP9 in patients with coronary spastic angina. (PubMed id 19911011)1, 4 Takefuji M....Kaibuchi K. (J. Hum. Genet. 2010)
    7. Identification of SH3 domain interaction partners of human FasL (CD178) by phage display screening. (PubMed id 19807924)1, 2 Voss M.... Janssen O. (BMC Immunol. 2009)
    8. Immunoaffinity profiling of tyrosine phosphorylation in cancer cells. (PubMed id 15592455)1, 2 Rush J.... Comb M.J. (Nat. Biotechnol. 2005)
    9. Robust phosphoproteomic profiling of tyrosine phosphorylation sites from human T cells using immobilized metal affinity chromatography and tandem mass spectrometry. (PubMed id 15144186)1, 2 Brill L.M....Peters E.C. (Anal. Chem. 2004)
    10. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 50618 HGNC: 6184 AceView: ITSN2 Ensembl:ENSG00000198399 euGenes: HUgn50618
    ECgene: ITSN2 H-InvDB: ITSN2

    (According to HUGE)
    About This Section

    TryGeneCards Plus
    HUGE: KIAA1256

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    PharmGKB entry for ITSN2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ITSN2 gene:
    Search GeneIP for patents involving ITSN2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     EMD Millipore genomic analysis products

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for ITSN2  
     Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for ITSN2  
     OriGene qSTAR qPCR primer pairs in human, mouse for ITSN2   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for ITSN2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ITSN2   OriGene Custom Protein Services for ITSN2  

     Block miRNA regulation of human, mouse, rat ITSN2 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ITSN2
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ITSN2 Predesigned siRNA for gene silencing in human, mouse, rat ITSN2
     QuantiFast Probe-based Assays in human, mouse, rat ITSN2 QuantiTect SYBR Green Assays in human, mouse, rat ITSN2
     Custom PCR Arrays for ITSN2 Search Chromatin IP Primers for ITSN2
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ITSN2  Search GeneGlobe Interaction Network for ITSN2
     Regulatory tfbs in ITSN2 promoter
     GenScript Custom Purified and Recombinant Proteins Services for ITSN2 GenScript cDNA clones with any tag delivered in your preferred vector for ITSN2
     GenScript Custom Assay Services for ITSN2 GenScript Custom overexpressing Cell Line Services for ITSN2
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for ITSN2
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ITSN2 antibodies
     ITSN2 proteins
     Antibodies for ITSN2
     See all of Abcam's Antibodies, Kits and Proteins for ITSN2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for ITSN2
     Antibodies for ITSN2
     ELISAs for ITSN2
     CLIAs for ITSN2

     Browse ESI BIO Cell Lines and PureStem Progenitors for ITSN2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ITSN2
     SwitchGear 3'UTR luciferase reporter plasmids for ITSN2
     SwitchGear Promoter luciferase reporter plasmids for ITSN2
     Search ThermoFisher Antibodies for ITSN2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ITSN2
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ITSN2
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ITSN2
     LSBio Antibodies in human, mouse, rat for ITSN2
    Customized transgenic rodents for:
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ITSN2 gene at Home site.
    Version: 3.12.136 22 July 2014
    hostname: index build: 126 solr: 1.4