Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



ITGA3 Gene

protein-coding   GIFtS: 69
GCID: GC17P048133

Integrin, Alpha 3 (Antigen CD49C, Alpha 3 Subunit Of VLA-3...

(Previous name: antigen identified by monoclonal antibody J143)
(Previous symbol: MSK18)
  See ITGA3-related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Integrin, Alpha 3 (Antigen CD49C, Alpha 3 Subunit Of VLA-3
Receptor)1 2
     ILNEB2 5
MSK181 2 3     GAP-B32
GAPB32 3 5     VCA-22
Antigen Identified By Monoclonal Antibody J1431 2     VL3A2
Galactoprotein B32 3     VLA3a2
FRP-22 3     Integrin Alpha-32
CD49 Antigen-Like Family Member C2 3     Very Late Activation Protein 3 Receptor, Alpha-3 Subunit2
VLA-3 Subunit Alpha2 3     CD49c Antigen3
CD49C2 5     

External Ids:    HGNC: 61391   Entrez Gene: 36752   Ensembl: ENSG000000058847   OMIM: 6050255   UniProtKB: P260063   

Export aliases for ITGA3 gene to outside databases

Previous GC identifers: GC17P047940 GC17P050613 GC17P048475 GC17P048608 GC17P045488 GC17P043500


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for ITGA3 Gene:
The protein encoded by this gene belongs to the family of integrins. Integrins are heterodimeric integral membrane
proteins composed of an alpha chain and a beta chain, and function as cell surface adhesion molecules. This gene
encodes alpha 3 subunit, which undergoes post-translational cleavage in the extracellular domain to yield
disulfide-linked light and heavy chains that join with beta 1 subunit to form an integrin that interacts with
many extracellular-matrix proteins. Alternatively spliced transcript variants encoding different isoforms have
been identified for this gene. (provided by RefSeq, Oct 2008)

GeneCards Summary for ITGA3 Gene:
ITGA3 (integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)) is a protein-coding gene. Diseases associated with ITGA3 include interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital, and interstitial lung disease. An important paralog of this gene is ITGA1.

UniProtKB/Swiss-Prot: ITA3_HUMAN, P26006
Function: Integrin alpha-3/beta-1 is a receptor for fibronectin, laminin, collagen, epiligrin, thrombospondin and
CSPG4. Alpha-3/beta-1 may mediate with LGALS3 the stimulation by CSPG4 of endothelial cells migration

Gene Wiki entry for ITGA3 (CD49c) Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000017.10  NT_010783.16  NC_018928.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the ITGA3 gene promoter:
         GR   STAT5B   Sp1   GR-beta   STAT1beta   AP-4   Nkx2-5   HEN1   GR-alpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidITGA3 promoter sequence
   Search Chromatin IP Primers for ITGA3

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ITGA3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 17q21.33   Ensembl cytogenetic band:  17q21.33   HGNC cytogenetic band: 17q21.33

ITGA3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
ITGA3 gene location

GeneLoc information about chromosome 17         GeneLoc Exon Structure

GeneLoc location for GC17P048133:  view genomic region     (about GC identifiers)

Start:
48,133,332 bp from pter      End:
48,167,849 bp from pter
Size:
34,518 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: ITA3_HUMAN, P26006 (See protein sequence)
Recommended Name: Integrin alpha-3 precursor  
Size: 1051 amino acids; 116612 Da
Subunit: Heterodimer of an alpha and a beta subunit. The alpha subunit is composed of a heavy and a light chain
linked by a disulfide bond. Alpha-3 associates with beta-1. Interacts with HPS5
Secondary accessions: A7E246 B7ZM80 B9EGQ1 D3DTX4 D3DTX5
Alternative splicing: 2 isoforms:  P26006-2   P26006-1   

Explore the universe of human proteins at neXtProt for ITGA3: NX_P26006

Explore proteomics data for ITGA3 at MOPED

Post-translational modifications: 

  • Isoform 1, but not isoform 2, is phosphorylated on serine residues. Phosphorylation increases after phorbol
    12-myristate 13-acetate stimulation1
  • Glycosylation2 at Asn86, Asn107, Asn265, Asn500, Asn511, Asn573, Asn605, Asn656, Asn697, Asn841,
                                 Asn857, Asn926, Asn935, Asn969
  • Modification sites at PhosphoSitePlus

  • See ITGA3 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (2 alternative transcripts): 
    NP_002195.1  NP_005492.1  

    ENSEMBL proteins: 
     ENSP00000422826   ENSP00000315190   ENSP00000007722   ENSP00000466652   ENSP00000425980  
     ENSP00000426142   ENSP00000467851   ENSP00000446133  
    Reactome Protein details: P26006

    ITGA3 Human Recombinant Protein Products:

    EMD Millipore Purified and/or Recombinant ITGA3 Protein
    R&D Systems Recombinant & Natural Proteins for ITGA3 (Integrin alpha 3 beta 1/VLA-3)
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for ITGA3
    OriGene Protein Over-expression Lysate for ITGA3
    OriGene Custom MassSpec
    OriGene Custom Protein Services for ITGA3
    GenScript Custom Purified and Recombinant Proteins Services for ITGA3
    Novus Biologicals ITGA3 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

     
    Search eBioscience for Proteins for ITGA3 

    ITGA3 Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of ITGA3
    R&D Systems Antibodies for ITGA3 (Integrin alpha 3/CD49c)
    OriGene Antibodies for ITGA3
    OriGene Custom Antibody Services for ITGA3
    Novus Biologicals ITGA3 Antibodies
    Abcam antibodies for ITGA3
    Browse Antibodies at Cloud-Clone Corp.
    ThermoFisher Antibodies for ITGA3
    LSBio Antibodies in human, mouse, rat for ITGA3

    ITGA3 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for ITGA3
    R&D Systems Proteome Profiler Antibody Arrays for ITGA3 (Integrin alpha 3/CD49c)
    GenScript Custom Assay Services for ITGA3
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.
    Search eBioscience for ELISAs for ITGA3 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    CD: CD molecules
    ITG: Integrins

    4 InterPro protein domains:
     IPR000413 Integrin_alpha
     IPR018184 Integrin_alpha_C_CS
     IPR013649 Integrin_alpha-2
     IPR013519 Int_alpha_beta-p

    Graphical View of Domain Structure for InterPro Entry P26006

    ProtoNet protein and cluster: P26006

    3 Blocks protein domains:
    IPB000413 Integrins alpha chain
    IPB013513 Integrin alpha chain
    IPB013517 FG-GAP


    UniProtKB/Swiss-Prot: ITA3_HUMAN, P26006
    Similarity: Belongs to the integrin alpha chain family
    Similarity: Contains 7 FG-GAP repeats


    Find genes that share domains with ITGA3           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: ITA3_HUMAN, P26006
    Function: Integrin alpha-3/beta-1 is a receptor for fibronectin, laminin, collagen, epiligrin, thrombospondin and
    CSPG4. Alpha-3/beta-1 may mediate with LGALS3 the stimulation by CSPG4 of endothelial cells migration

         Genatlas biochemistry entry for ITGA3:
    integrin,alpha 3,cell surface adhesion receptor mediating cell-adhesion to extra cellular matrix or to other
    cells,through hetero dimerization and connecting to the cytoskeleton and various signaling molecules within
    cells,dimerizing with ITGB1 in fibronectin,laminin,collagen receptors

         Gene Ontology (GO): Selected molecular function terms (see all 8):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001968fibronectin binding IEA--
    GO:0005178integrin binding IEA--
    GO:0005515protein binding IPI14676841
    GO:0005518collagen binding IEA--
    GO:0019904protein domain specific binding IEA--
         
    Find genes that share ontologies with ITGA3           About GenesLikeMe


    Phenotypes:
         3 GenomeRNAi human phenotypes for ITGA3:
     Decreased TP53 protein express  Decreased focal adhesion (FA)   Increased HPV18 LCR reporter a 

         Selected MGI mutant phenotypes (inferred from 4 alleles(MGI details for Itga3) (see all 17):
     behavior/neurological  cardiovascular system  cellular  digestive/alimentary  embryogenesis 
     endocrine/exocrine gland  growth/size/body  homeostasis/metabolism  immune system  integument 
     limbs/digits/tail  mortality/aging  nervous system  renal/urinary system  respiratory system 

    Find genes that share phenotypes with ITGA3           About GenesLikeMe

    Animal Models:
         MGI mouse knock-out Itga3tm1Jak for ITGA3

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ITGA3
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ITGA3

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for ITGA3
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for ITGA3

    miRNA
    Products:
        
    miRTarBase miRNAs that target ITGA3:
    hsa-mir-26b-5p (MIRT029991), hsa-mir-124-3p (MIRT022979), hsa-mir-1 (MIRT023953)

    Block miRNA regulation of human, mouse, rat ITGA3 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ITGA3 (see all 43):
    hsa-miR-300 hsa-miR-199a-3p hsa-miR-139-5p hsa-miR-624* hsa-miR-486-3p hsa-miR-223 hsa-miR-124 hsa-miR-1244
    SwitchGear 3'UTR luciferase reporter plasmidITGA3 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for ITGA3
    Predesigned siRNA for gene silencing in human, mouse, rat ITGA3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for ITGA3

    Clone
    Products:
         
    OriGene clones in human, mouse for ITGA3 (see all 12)
    OriGene ORF clones in mouse, rat for ITGA3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ITGA3 (NM_005501)
    Sino Biological Human cDNA Clone for ITGA3
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ITGA3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ITGA3

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for ITGA3
    Browse ESI BIO Cell Lines and PureStem Progenitors for ITGA3 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ITGA3

    Flow Cytometry
    Products:
       

     
    eBioscience FlowRNA Probe Sets ( VA1-12267) for ITGA3 


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    ITA3_HUMAN, P26006: Membrane; Single-pass type I membrane protein
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    plasma membrane4
    golgi apparatus3
    extracellular2
    cytoskeleton1
    endoplasmic reticulum1

    Gene Ontology (GO): Selected cellular component terms (see all 10):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005886plasma membrane TAS--
    GO:0008305integrin complex TAS1655803
    GO:0009986cell surface IDA--
    GO:0016323basolateral plasma membrane IEA--
    GO:0030426growth cone IEA--

    Find genes that share ontologies with ITGA3           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for ITGA3 About   (see all 34)  
    See pathways by source

    SuperPathContained pathways About
    1Focal adhesion
    Focal adhesion0.65
    HGF Pathway0.34
    Focal Adhesion0.65
    ECM-receptor interaction0.31
    Integrin-mediated cell adhesion0.38
    2Hypertrophic cardiomyopathy (HCM)
    Hypertrophic cardiomyopathy (HCM)0.75
    Arrhythmogenic right ventricular cardiomyopathy (ARVC)0.54
    Dilated cardiomyopathy0.75
    Arrhythmogenic right ventricular cardiomyopathy0.54
    3Integrin Pathway
    FAK1 Signaling0.67
    UPA-UPAR Pathway0.56
    Integrin Pathway0.67
    Transendothelial Migration of Leukocytes0.38
    GnRH Signaling0.56
    4Apoptotic Pathways in Synovial Fibroblasts
    PPAR Pathway0.66
    Actin-Based Motility by Rho Family GTPases0.62
    Rac1 Pathway0.65
    Rap1 Pathway0.57
    Glioma Invasiveness0.64
    5ERK Signaling
    Rho Family GTPases0.61
    MAPK Signaling0.58
    ERK Signaling0.61
    Molecular Mechanisms of Cancer0.51


    Find genes that share SuperPaths with ITGA3           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    Selected Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for ITGA3 (see all 33)
        RhoA Pathway
    Paxillin Interactions
    Molecular Mechanisms of Cancer
    CDK5 Pathway
    Tec Kinases Signaling

    4 GeneGo (Thomson Reuters) Pathways for ITGA3
        Cell adhesion Endothelial cell contacts by non-junctional mechanisms
    Cytoskeleton remodeling Integrin outside-in signaling
    Cell adhesion Cell-matrix glycoconjugates
    Cell adhesion Integrin-mediated cell adhesion and migration

    Selected BioSystems Pathways for ITGA3 (see all 7)
        Focal Adhesion
    Integrin-mediated cell adhesion
    Arrhythmogenic right ventricular cardiomyopathy
    Arf6 trafficking events
    Reelin signaling pathway


    3 Reactome Pathways for ITGA3
        Laminin interactions
    Integrin cell surface interactions
    Basigin interactions


    Selected Kegg Pathways  (Kegg details for ITGA3) (see all 10):
        PI3K-Akt signaling pathway
    Focal adhesion
    ECM-receptor interaction
    Hematopoietic cell lineage
    Regulation of actin cytoskeleton

        Pathway & Disease-focused RT2 Profiler PCR Arrays including ITGA3 (see all 7): 
              Osteogenesis in human mouse rat
              Fibrosis in human mouse rat
              Extracellular Matrix & Adhesion Molecules in human mouse rat
              Cell Surface Markers in human mouse rat
              Wound Healing in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for ITGA3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for ITGA3 (P260062, 3 ENSP000000077224) via UniProtKB, MINT, STRING, and/or I2D (see all 146)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    FHL2Q141922, 3, ENSP000003229094MINT-15432 MINT-15431 I2D: score=5 STRING: ENSP00000322909
    PDIA3P301012, 3MINT-4301442 I2D: score=1 
    ITGB1P055563, ENSP000003640944I2D: score=8 STRING: ENSP00000364094
    CD151P485093, ENSP000003241014I2D: score=3 STRING: ENSP00000324101
    TIMP2P160353, ENSP000002627684I2D: score=3 STRING: ENSP00000262768
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 17):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001764neuron migration IEA--
    GO:0007155cell adhesion ----
    GO:0007160cell-matrix adhesion TAS1655803
    GO:0007229integrin-mediated signaling pathway IEA--
    GO:0007507heart development IEA--

    Find genes that share ontologies with ITGA3           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for ITGA3 (ITA3)

    4 Novoseek inferred chemical compound relationships for ITGA3 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    retinoic acid 16.6 1 7894073 (1)
    retinoid 15.6 1 8915849 (1)
    tyrosine 0 1 1717976 (1)
    serine 0 1 7945369 (1)



    Find genes that share compounds with ITGA3           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for ITGA3 gene (2 alternative transcripts): 
    NM_002204.2  NM_005501.2  

    Unigene Cluster for ITGA3:

    Integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
    Hs.265829  [show with all ESTs]
    Unigene Representative Sequence: NM_002204
    17 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000506401 ENST00000505306(uc010dbl.3 uc010dbm.3) ENST00000320031
    ENST00000007722 ENST00000508100 ENST00000570989 ENST00000512553 ENST00000505552
    ENST00000510809 ENST00000505612 ENST00000506827 ENST00000507771 ENST00000515147
    ENST00000504417 ENST00000506437 ENST00000514834 ENST00000544892
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat ITGA3 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate ITGA3 (see all 43):
    hsa-miR-300 hsa-miR-199a-3p hsa-miR-139-5p hsa-miR-624* hsa-miR-486-3p hsa-miR-223 hsa-miR-124 hsa-miR-1244
    SwitchGear 3'UTR luciferase reporter plasmidITGA3 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for ITGA3
    Predesigned siRNA for gene silencing in human, mouse, rat ITGA3
    Clone
    Products:
         
    OriGene clones in human, mouse for ITGA3 (see all 12)
    OriGene ORF clones in mouse, rat for ITGA3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): ITGA3 (NM_005501)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for ITGA3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ITGA3
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for ITGA3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ITGA3
      QuantiTect SYBR Green Assays in human, mouse, rat ITGA3
      QuantiFast Probe-based Assays in human, mouse, rat ITGA3
    Flow Cytometry
    Products:
       

     
    eBioscience FlowRNA Probe Sets ( VA1-12267) for ITGA3 

    Additional mRNA sequence: 

    AK095140.1 AK289961.1 AK293323.1 AK303384.1 BC015344.1 BC043917.1 BC136636.1 BC144328.1 
    BC150190.1 D01038.1 M59911.1 

    19 DOTS entries:

    DT.100824860  DT.97847933  DT.92459193  DT.100042412  DT.95304537  DT.95329616  DT.91678095  DT.102842887 
    DT.100708481  DT.120949772  DT.120949792  DT.120949798  DT.91844016  DT.95290566  DT.95304474  DT.95304480 
    DT.95304536  DT.97860840  DT.91974466 

    Selected AceView cDNA sequences (see all 578):

    CA453892 BG752716 BI063590 T29886 CA489607 BG678389 CA487327 BU526839 
    BI836691 CB131111 AW090243 R55537 AW247291 CN482350 CA488434 BQ918770 
    AK091950 BQ935536 CB126605 CA487756 CA488457 BC043917 CB150198 CB306966 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for ITGA3 (see all 10)    About this scheme

    ExUns: 1a · 1b · 1c · 1d ^ 2a · 2b ^ 3a · 3b ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12a · 12b ^ 13 ^ 14a · 14b · 14c ^ 15 ^ 16a ·
    SP1:                                            -                       -                       -                                               -               
    SP2:                                            -                       -                       -                                                               
    SP3:                                                                                                                                            -               
    SP4:                                                                                                                                                            
    SP5:                                                                                                                                                            

    ExUns: 16b ^ 17a · 17b ^ 18 ^ 19a · 19b ^ 20 ^ 21a · 21b ^ 22 ^ 23a · 23b ^ 24 ^ 25
    SP1:        -                       -                                                   
    SP2:        -                       -                                                   
    SP3:        -                       -     -     -     -     -     -     -     -         
    SP4:                                                                                    
    SP5:                                -                                                   


    ECgene alternative splicing isoforms for ITGA3

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    ITGA3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GTACTGTAGC
    ITGA3 Expression
    About this image


    ITGA3 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 18) fully expand
     
     Skeletal Muscle (Muscoskeletal System)    fully expand to see all 20 entries
             Mononuclear Myocytes Cervical Primary Hypaxial Myotome
     
     Somite (Muscoskeletal System)    fully expand to see all 16 entries
             Mononuclear Myocytes Cervical Primary Hypaxial Myotome
     
     Limb (Muscoskeletal System)    fully expand to see all 7 entries
             Mesenchymal Condensate Cells Zeugopod
     
     Epithelial Cells
             Adult Corneal Basal Epithelial Cells Corneal Epithelium
     
     Neural Tube (Nervous System)    fully expand to see all 4 entries
             Telencephalon
    ITGA3 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    ITGA3 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.265829

    UniProtKB/Swiss-Prot: ITA3_HUMAN, P26006
    Tissue specificity: Isoform 1 is widely expressed. Isoform 2 is expressed in brain and heart. In brain, both
    isoforms are exclusively expressed on vascular smooth muscle cells, whereas in heart isoform 1 is strongly
    expressed on vascular smooth muscle cells, isoform 2 is detected only on endothelial vein cells

        Pathway & Disease-focused RT2 Profiler PCR Arrays including ITGA3 (see all 7): 
              Osteogenesis in human mouse rat
              Fibrosis in human mouse rat
              Extracellular Matrix & Adhesion Molecules in human mouse rat
              Cell Surface Markers in human mouse rat
              Wound Healing in human mouse rat

    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for ITGA3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ITGA3
    QuantiTect SYBR Green Assays in human, mouse, rat ITGA3
    QuantiFast Probe-based Assays in human, mouse, rat ITGA3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ITGA3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals.

    Orthologs for ITGA3 gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Itga31 , 5 integrin alpha 31, 5 85.14(n)1
    86.26(a)1
      11 (59.01 cM)5
    164001  NM_013565.21  NP_038593.11 
     950444745 
    chicken
    (Gallus gallus)
    Aves ITGA31 integrin, alpha 3 (antigen CD49C, alpha 3 subunit of more 67.85(n)
    63.93(a)
      373946  NM_204146.1  NP_989477.1 
    lizard
    (Anolis carolinensis)
    Reptilia ITGA36
    integrin, alpha 3 (antigen CD49C, alpha 3 subunit ...
    60(a)
    1 ↔ 1
    6(77195620-77265779)
    African clawed frog
    (Xenopus laevis)
    Amphibia itga3-A2 integrin alpha 3 subunit 74.13(n)    L43057.1 
    zebrafish
    (Danio rerio)
    Actinopterygii itga3b6
    itga3a6
    integrin, alpha 3a
    46(a)
    40(a)
    1 ↔ many
    1 ↔ many
    12(6123093-6198935) ENSDARG00000012824
    3(34931497-35002337) ENSDARG00000037917
    fruit fly
    (Drosophila melanogaster)
    Insecta mew3 wing morphogenesis cell adhesion
    receptor
    29(a)
    (best of 2)
        --
    worm
    (Caenorhabditis elegans)
    Secernentea ina-13 Integrin alpha chain 27(a)   III(9240086-9244462)   --


    ENSEMBL Gene Tree for ITGA3 (if available)
    TreeFam Gene Tree for ITGA3 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for ITGA3 gene
    ITGA12  ITGA62  ITGA72  ITGA82  ITGAM2  ITGA112  ITGA22  ITGA52  
    ITGAE2  ITGAD2  ITGA2B2  ITGAV2  ITGAX2  ITGAL2  ITGA92  ITGA42  
    ITGA102  
    7 SIMAP similar genes for ITGA3 using alignment to 7 protein entries:     ITA3_HUMAN (see all proteins):
    ITGA2B    ITGA9    ITGA4    ITGA10    ITGA7    ITGA7 variant protein
    ITGA6

    Find genes that share paralogs with ITGA3           About GenesLikeMe


    1 Pseudogenes.org Pseudogene for ITGA3
    PGOHUM00000248171


    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for ITGA3 (see all 1015)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 17 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0688084
    Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital (ILNEB)4--see VAR_0688082 R P mis40--------
    rs2010604991,2
    Cuntested149168734(+) ACAAGA/C/GGACCT 4 R syn10--------
    rs1821013921,2
    --43498537(+) GGCAGA/GTAACC 2 -- us2k10--------
    rs1507332551,2
    --43498557(+) TCTGTC/TTTCTC 2 -- us2k10--------
    rs1135694381,2
    C,F--48150968(+) CACACG/ACACAC 2 -- int12Minor allele frequency- A:0.50CSA 4
    rs32168951,2
    C--48153906(-) CACCA-/CCCCCCCC 2 -- int10--------
    rs20181341,2
    C,F,A--48157869(-) AAATCA/TCACAC 2 -- int19Minor allele frequency- T:0.12NA PA CSA WA EA 616
    rs1130890191,2
    C--48159836(+) GTGCCC/TGGCCT 2 -- int11Minor allele frequency- T:0.50CSA 2
    rs358331651,2
    C--48160223(+) CTTCC-/CACCCA 2 -- int10--------
    rs711469621,2
    C--48163574(+) GTATA-/AT/TATATATTAGATTA
    TATATATTATACATGTATAA
    ATATA
    2 -- int11NA 2

    HapMap Linkage Disequilibrium report for ITGA3 (48133332 - 48167849 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 8 variations for ITGA3:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv509660CNV Insertion20534489
    esv993321CNV Insertion20482838
    esv1740779CNV Insertion17803354
    nsv833474CNV Loss17160897
    dgv3226n71CNV Loss21882294
    nsv908588CNV Loss21882294
    dgv3225n71CNV Loss21882294
    nsv908590CNV Loss21882294

    Human Gene Mutation Database (HGMD): ITGA3
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing ITGA3
    DNA2.0 Custom Variant and Variant Library Synthesis for ITGA3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 605025   
    OMIM disorders: 614748  
    UniProtKB/Swiss-Prot: ITA3_HUMAN, P26006
  • Interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital (ILNEB)
    [MIM:614748]: A multiorgan disorder characterized by congenital nephrotic syndrome, interstitial lung disease,
    and epidermolysis bullosa. The respiratory and renal features predominate, and lung involvement accounts for the
    lethal course of the disease. Note=The disease is caused by mutations affecting the gene represented in this
    entry

  • 5 diseases for ITGA3:    
    About MalaCards
    interstitial lung disease, nephrotic syndrome, and epidermolysis bullosa, congenital    interstitial lung disease    hydrocele    cheilitis
    nephrotic syndrome


    Find genes that share disorders with ITGA3           About GenesLikeMe

    Selected Novoseek inferred disease relationships for ITGA3 gene (see all 14)    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    carcinoma squamous cell 25.8 1 19674850 (1)
    tumors 21.7 10 11115543 (2), 8178927 (1), 8548871 (1), 7518760 (1) (see all 6)
    metastasis 21.2 1 11115543 (1)
    melanoma 20.9 2 10487289 (1), 7628538 (1)
    carcinoma 19.6 1 9713359 (1)
    fibrosarcoma 16.3 2 8125150 (1), 7518760 (1)
    carcinoma basal cell 14.4 2 2033490 (1), 9598011 (1)
    adenocarcinoma 7.65 3 16489176 (1), 12680208 (1), 19674850 (1)
    colon cancer 0 2 11115543 (2)
    cancer lung 0 2 19674850 (1)

    Genetic Association Database (GAD): ITGA3
    Human Genome Epidemiology (HuGE) Navigator: ITGA3 (13 documents)

    Export disorders for ITGA3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for ITGA3 gene, integrated from 10 sources (see all 270):
    (articles sorted by number of sources associating them with ITGA3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Molecular cloning and expression of the cDNA for alpha 3 subunit of human alpha 3 beta 1 (VLA-3), an integrin receptor for fibronectin, laminin, and collagen. (PubMed id 1655803)1, 2, 3, 9 Takada Y.... Hemler M.E. (J. Cell Biol. 1991)
    2. Identification of human galactoprotein b3, an oncogenic transformation-induced membrane glycoprotein, as VLA-3 alpha subunit: the primary structure of human integrin alpha 3. (PubMed id 1714443)1, 2, 9 Tsuji T.... Osawa T. (J. Biochem. 1991)
    3. The A and B variants of the alpha 3 integrin subunit: tissue distribution and functional characterization. (PubMed id 9111516)1, 2, 9 de Melker A.A.... Sonnenberg A. (Lab. Invest. 1997)
    4. Integrin alpha3 mutations with kidney, lung, and skin disease. (PubMed id 22512483)1, 2 Has C....Laube G.F. (N. Engl. J. Med. 2012)
    5. Genetic associations of 115 polymorphisms with cancers of the upper aerodigestive tract across 10 European countries: the ARCAGE project. (PubMed id 19339270)1, 4 Canova C....Brennan P. (Cancer Res. 2009)
    6. The variant rs1867277 in FOXE1 gene confers thyroid cancer susceptibility through the recruitment of USF1/USF2 transcription factors. (PubMed id 19730683)1, 4 Landa I....Robledo M. (PLoS Genet. 2009)
    7. Association analysis of schizophrenia on 18 genes involved in neuronal migration: MDGA1 as a new susceptibility gene. (PubMed id 18384059)1, 4 KAohler A.K....Andreassen O.A. (Am. J. Med. Genet. B Neuropsychiatr. Genet. 2008)
    8. Polymorphisms in predicted microRNA-binding sites in integrin genes and breast cancer: ITGB4 as prognostic marker. (PubMed id 18550570)1, 4 Brendle A....FAPrsti A. (Carcinogenesis 2008)
    9. Genetic variants in apoptosis and immunoregulation-related genes are associated with risk of chronic lymphocytic leukemia. (PubMed id 19074885)1, 4 Enjuanes A....Campo E. (Cancer Res. 2008)
    10. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 3675 HGNC: 6139 AceView: ITGA3 Ensembl:ENSG00000005884 euGenes: HUgn3675
    ECgene: ITGA3 Kegg: 3675 H-InvDB: ITGA3

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for ITGA3 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for ITGA3 Genetics and Cytogenetics in Oncology and Haematology

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for ITGA3 gene:
    Search GeneIP for patents involving ITGA3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     EMD Millipore Purified and/or Recombinant ITGA3 Protein
     EMD Millipore Mono- and Polyclonal Antibodies for the study of ITGA3
     
     EMD Millipore genomic analysis products

      
     Antibodies for ITGA3 (Integrin alpha 3/CD49c)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Recombinant/Natural Proteins for ITGA3 (Integrin alpha 3 beta 1/VLA-3)   Browse Stem Cell Products  
     cDNA Clones for ITGA3 (Integrin alpha 3/CD49c)   Proteome Profiler Antibody Arrays for ITGA3 (Integrin alpha 3/CD49c)  
     OriGene Antibodies for ITGA3   OriGene RNAi products in human, mouse, rat for ITGA3  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for ITGA3  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for ITGA3  
     OriGene qSTAR qPCR primer pairs in human, mouse for ITGA3   OriGene Purified Protein for ITGA3  
     OriGene ORF clones in mouse, rat for ITGA3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for ITGA3   OriGene Custom Protein Services for ITGA3  

     
     
     Block miRNA regulation of human, mouse, rat ITGA3 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing ITGA3
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat ITGA3 Predesigned siRNA for gene silencing in human, mouse, rat ITGA3
     QuantiFast Probe-based Assays in human, mouse, rat ITGA3 QuantiTect SYBR Green Assays in human, mouse, rat ITGA3
     PCR Arrays including human, mouse, rat ITGA3 Search Chromatin IP Primers for ITGA3
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat ITGA3  GeneGlobe Interaction Network for ITGA3
     Regulatory tfbs in ITGA3 promoter
     GenScript Custom Purified and Recombinant Proteins Services for ITGA3 GenScript cDNA clones with any tag delivered in your preferred vector for ITGA3
     GenScript Custom Assay Services for ITGA3 GenScript Custom overexpressing Cell Line Services for ITGA3
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for ITGA3 (ITA3)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for ITGA3
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     ITGA3 antibodies
     ITGA3 lysates
     Antibodies for ITGA3
     See all of Abcam's Antibodies, Kits and Proteins for ITGA3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for ITGA3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for ITGA3
     SwitchGear 3'UTR luciferase reporter plasmids for ITGA3
     SwitchGear Promoter luciferase reporter plasmids for ITGA3
     ThermoFisher Antibodies for ITGA3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat ITGA3
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for ITGA3
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for ITGA3
     LSBio Antibodies in human, mouse, rat for ITGA3
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for ITGA3
      Search eBioscience for proteins for ITGA3
      Search eBioscience for elisas for ITGA3
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      ITGA3 gene at Home site.
    Version: 3.12.224 13 Oct 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4