Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

INCENP Gene

protein-coding GIFtS: 59
GCID: GC11P061891

inner centromere protein antigens 135/155kDa

(Previous names: inner centromere protein antigens (135kD, 155kD) )

Explore 6 diseases affiliated with
INCENP via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Inner Centromere Protein Antigens 135/155kDa¹ ²		Chromosomal Passenger Protein²
FLJ31633¹		Inner Centromere Protein²
Inner Centromere Protein Antigens (135kD, 155kD)¹		Inner Centromere Protein INCENP²
Binds And Activates Aurora-B And -C In Vivo And In Vitro²

External Ids:	HGNC: 6058¹	Entrez Gene: 3619²	Ensembl: ENSG00000149503⁷	OMIM: 604411⁵	UniProtKB: Q9NQS7³

Export aliases for INCENP gene to outside databases

Previous GC identifers: GC11U990069 GC11P063467 GC11P062142 GC11P061666 GC11P061648 GC11P058219

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for INCENP:

In mammalian cells, 2 broad groups of centromere-interacting proteins have been described: constitutively binding

centromere proteins and 'passenger,' or transiently interacting, proteins (reviewed by Choo, 1997). The constitutive

proteins include CENPA (centromere protein A; MIM 117139), CENPB (MIM 117140), CENPC1 (MIM 117141), and CENPD (MIM

117142). The term 'passenger proteins' encompasses a broad collection of proteins that localize to the centromere

during specific stages of the cell cycle (Earnshaw and Mackay, 1994 (PubMed 8088460)). These include CENPE (MIM

117143); MCAK (MIM 604538); KID (MIM 603213); cytoplasmic dynein (e.g., MIM 600112); CliPs (e.g., MIM 179838); and

CENPF/mitosin (MIM 600236). The inner centromere proteins (INCENPs) (Earnshaw and Cooke, 1991 (PubMed 1860899)), the

initial members of the passenger protein group, display a broad localization along chromosomes in the early stages of

mitosis but gradually become concentrated at centromeres as the cell cycle progresses into mid-metaphase. During

telophase, the proteins are located within the midbody in the intercellular bridge, where they are discarded after

cytokinesis (Cutts et al., 1999 (PubMed 10369859)).(supplied by OMIM, Mar 2008)

UniProtKB/Swiss-Prot: INCE_HUMAN, Q9NQS7

Function: Component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The

CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is

required for chromatin-induced microtubule stabilization and spindle assembly. Probably acts through association with

AURKB or AURKC. Seems to bind directly to microtubules. Controls the kinetochore localization of BUB1

Gene Wiki entry for INCENP

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000011.9 NC_018922.1 NT_167190.1

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the INCENP gene promoter:
STAT1 RFX1 Pbx1a STAT1beta C/EBPalpha STAT1alpha E47 FAC1 Hand1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): INCENP promoter sequence

Search SABiosciences Chromatin IP Primers for INCENP

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat INCENP

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 11q12.3 Ensembl cytogenetic band: 11q12.3 HGNC cytogenetic band: 11q12.3

INCENP Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
INCENP gene location

GeneLoc information about chromosome 11 GeneLoc Exon Structure

GeneLoc location for GC11P061891: view genomic region (about GC identifiers)

Start:	61,891,445 bp from pter	End:	61,920,635 bp from pter
Size:	29,191 bases	Orientation:	plus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: INCE_HUMAN, Q9NQS7 (See protein sequence)

Recommended Name: Inner centromere protein

Size: 918 amino acids; 105429 Da

Subunit: Homodimer or heterodimer. Interacts with H2AFZ (By similarity). Interacts with CBX3. Interacts with tubulin

beta chain. Interacts with AURKB and AURKC. Component of the chromosomal passenger complex (CPC) composed of at least

BIRC5/survivin, CDCA8/borealin, INCENP, AURKB and AURKC. Interacts with EVI5. Interacts with CDCA8 and BIRC5;

interaction is direct. Interacts with CBX5; POGZ and INCENP compete for interaction with CBX5. Interacts with POGZ.

Interacts with JTB

Subcellular location: Chromosome, centromere. Cytoplasm, cytoskeleton, spindle. Nucleus. Chromosome, centromere,

kinetochore. Note=Localizes to inner kinetochore. Localizes on chromosome arms and inner centromeres from prophase

through metaphase and then transferring to the spindle midzone and midbody from anaphase through cytokinesis.

Colocalizes with AURKB at mitotic chromosomes

Caution: PubMed:11139336 experiments have been carried out partly in chicken and partly in human

2 PDB 3D structures from and Proteopedia for INCENP:

2QFA (3D)

4AF3 (3D)

Secondary accessions: A8MQD2 Q5Y192

Alternative splicing: 2 isoforms: Q9NQS7-1 Q9NQS7-2

Explore the universe of human proteins at neXtProt for INCENP: NX_Q9NQS7

Post-translational modifications:

Phosphorylation by AURKB at its C-terminal part is important for AURKB activation by INCENP¹

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_Q9NQS7

INCENP Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (2 alternative transcripts):

NP_001035784.1 NP_064623.2

ENSEMBL proteins:

ENSP00000378295 ENSP00000433100 ENSP00000278849

Reactome Protein details: Q9NQS7
Human Recombinant Protein Products for INCENP:

	EMD Millipore Purified and/or Recombinant INCENP Protein
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate: INCENP OriGene Custom Protein Services for INCENP
	GenScript Custom Purified and Recombinant Proteins Services for INCENP
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for INCENP

Gene Ontology (GO): 5/13 cellular component terms (GO ID links to tree view) (see all 13): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0000775	chromosome, centromeric region	IDA	11084331
GO:0000776	kinetochore	IDA	16760428
GO:0000777	condensed chromosome kinetochore	IEA	--
GO:0000795	synaptonemal complex	--	--
GO:0000800	lateral element	IEA	--

INCENP for ontologies About GeneDecksing

INCENP Antibody Products:

	EMD Millipore Mono- and Polyclonal Antibodies for the study of INCENP
	Browse R&D Systems for Antibodies
	Cell Signaling Technology (CST) Antibodies for INCENP
	OriGene Antibodies: INCENP OriGene Custom Antibody Services for INCENP
	GenScript Custom Superior Antibodies Services for INCENP
	Novus Biologicals INCENP Antibodies
	Abcam antibodies for INCENP
	Uscn Antibodies for INCENP
	ThermoFisher Antibody for INCENP

Assay Products for INCENP:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for INCENP
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for INCENP

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

INCENP for domains About GeneDecksing

2 InterPro domains/families:

IPR005635 Inner_centromere_prot_ARK-bd

IPR022006 INCENP_N

Graphical View of Domain Structure for InterPro Entry Q9NQS7

ProtoNet protein and cluster: Q9NQS7

1 Blocks protein family: IPB005635 Inner centromere protein

UniProtKB/Swiss-Prot: INCE_HUMAN, Q9NQS7

Similarity: Belongs to the INCENP family

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: INCE_HUMAN, Q9NQS7

Function: Component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The

CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is

required for chromatin-induced microtubule stabilization and spindle assembly. Probably acts through association with

AURKB or AURKC. Seems to bind directly to microtubules. Controls the kinetochore localization of BUB1

Gene Ontology (GO): 1 molecular function term (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005515	protein binding	IPI	--

INCENP for ontologies About GeneDecksing

Phenotypes:
6 GenomeRNAi human phenotypes for INCENP:

Cell division defect	Decreased cell number, increas	Decreased viability of wild-ty	Increased cell number in G2M,
Increased cilium length after	Increased gamma-H2AX phosphory

2 MGI mutant phenotypes (inferred from 1 allele) (MGI details for Incenp):

embryogenesis

mortality/aging

INCENP for phenotypes About GeneDecksing

Animal Models:
Mouse knock-out Incenp^tm1Khac for INCENP

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for INCENP

miRNA Products:		OriGene 3'-UTR Clone (see all 2): INCENP Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat INCENP
		6 QIAGEN miScript miRNA Assays for microRNAs that regulate INCENP:
		hsa-miR-214 hsa-miR-185* hsa-miR-2355-3p hsa-miR-1252 hsa-miR-1324 hsa-miR-761
		SwitchGear 3'UTR luciferase reporter plasmid: INCENP 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for INCENP (see all 7) OriGene shRNA RFP: INCENP OriGene siRNA: INCENP
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat INCENP
		Sirion Biotech Custom design and validation of potent shRNA sequences against INCENP

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for INCENP
			Sirion Biotech Customized adenovirus for overexpression of INCENP Sirion Biotech Customized adenovirus for potent knockdown of INCENP

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for INCENP (see all 4) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for INCENP (see all 2) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): INCENP (NM_020238)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for INCENP
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat INCENP

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for INCENP
		Search LifeMap BioReagents cell lines for INCENP
		Sirion Biotech Customized stable knockdown cell line services for INCENP Sirion Biotech Customized inducible knockdown cell line services for INCENP Sirion Biotech Customized stable overexpressing cell line services for INCENP Sirion Biotech Customized inducible overexpressing cell line services for INCENP

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for INCENP

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways - 5/9 super-pathways (see all 9) About this table

See pathways by source

Super-pathway

contained gene-specific pathways

M Phase

M Phase	1.00	Mitotic Anaphase	0.85
Mitotic M-M/G1 phases	0.88	Separation of Sister Chromatids	0.80
Mitotic Metaphase and Anaphase	0.85

Resolution of Sister Chromatid Cohesion

	Resolution of Sister Chromatid Cohesion	1.00			Mitotic Prometaphase	0.93
	Kinetochore assembly	0.96

Cell cycle Chromosome condensation in prometaphase

Cell cycle Chromosome condensation in prometaphase

1.00

Cell cycle_Chromosome condensation in prometaphase

1.00

Cell Cycle

Cell Cycle

1.00

Cell Cycle, Mitotic

0.84

Cell Cycle / Checkpoint Control

Cell Cycle / Checkpoint Control

1.00

Pathway sources
See GeneCards unified pathways
Show all pathways

1 EMD Millipore Pathway for INCENP

Cell cycle Chromosome condensation in prometaphase

1 Cell Signaling Technology (CST) Pathway for INCENP

Cell Cycle / Checkpoint Control

1 GeneGo (Thomson Reuters) Pathway for INCENP

Cell cycle Chromosome condensation in prometaphase

4 BioSystems Pathways for INCENP

	Aurora C signaling
	Aurora B signaling
	PLK1 signaling events
	Regulation of Wnt-mediated beta catenin signaling and target gene transcription

5/10 Reactome Pathways for INCENP (see all 10)

	Mitotic Metaphase and Anaphase
	Mitotic Prometaphase
	Resolution of Sister Chromatid Cohesion
	Mitotic Anaphase
	Cell Cycle

INCENP for pathways About GeneDecksing

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for INCENP

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

5/88 Interacting proteins for INCENP (Q9NQS7^{1, 2, 3} ENSP00000378295⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 88)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
AURKB	Q96GD4¹^,²^,³, ENSP00000313950⁴	EBI-307907,EBI-624291 MINT-77928 I2D: score=4 STRING: ENSP00000313950
CDCA8	Q53HL2¹^,³, ENSP00000316121⁴	EBI-307907,EBI-2557781 I2D: score=3 STRING: ENSP00000316121
BIRC5	O15392²^,³, ENSP00000301633⁴	MINT-4509563 MINT-4509570 MINT-77929 I2D: score=4 STRING: ENSP00000301633
CBX5	P45973¹^,³, ENSP00000209875⁴	EBI-307907,EBI-78219 I2D: score=3 STRING: ENSP00000209875
H2AFZ	P0C0S5³, ENSP00000296417⁴	I2D: score=2 STRING: ENSP00000296417

About this table

Gene Ontology (GO): 5 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0000087	M phase of mitotic cell cycle	TAS	--
GO:0000236	mitotic prometaphase	TAS	--
GO:0000278	mitotic cell cycle	TAS	--
GO:0000910	cytokinesis	IMP	16239925
GO:0007059	chromosome segregation	IMP	16239925

INCENP for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

INCENP for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for INCENP

1 DrugBank Compound for INCENP About this table

Compound	Synonyms	CAS #	Type	Actions	PubMed Ids
N~6~-cyclohexyl-N~2~-(4-morpholin-4-ylphenyl)-9H-purine-2,6-diamine	--	--	target	--	10592235

3 Novoseek chemical compound relationships for INCENP gene About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
paclitaxel	23.6	3	19951914 (2), 17699588 (1)
threonine	21.2	1	16571674 (1)
serine	12.4	1	16571674 (1)

Search CenterWatch for drugs/clinical trials and news about INCENP / INCE

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for INCENP gene (2 alternative transcripts):

NM_001040694.1 NM_020238.2

Unigene Cluster for INCENP:

Inner centromere protein antigens 135/155kDa

Hs.142179 [show with all ESTs]

Unigene Representative Sequence: NM_001040694

6 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000394818(uc009ynw.1 uc001nsw.1 uc001nsx.1) ENST00000533896

ENST00000278849 ENST00000528037(uc009ynv.3) ENST00000528375 ENST00000531099

miRNA Products:		OriGene 3'-UTR Clone (see all 2): INCENP Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat INCENP
		6 QIAGEN miScript miRNA Assays for microRNAs that regulate INCENP:
		hsa-miR-214 hsa-miR-185* hsa-miR-2355-3p hsa-miR-1252 hsa-miR-1324 hsa-miR-761
		SwitchGear 3'UTR luciferase reporter plasmid: INCENP 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for INCENP (see all 7) OriGene shRNA RFP: INCENP OriGene siRNA: INCENP
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat INCENP
		Sirion Biotech Custom design and validation of potent shRNA sequences against INCENP

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for INCENP (see all 4) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for INCENP (see all 2) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): INCENP (NM_020238)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for INCENP
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat INCENP

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for INCENP Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat INCENP
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat INCENP
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat INCENP

Additional cDNA sequence:

AF282265.1 AK056195.1 AK307633.1 AK310714.1 AY714053.1 BC032678.1 BC098576.1 BC111732.1

3 DOTS entries:

DT.206959 DT.91940121 DT.95263802

24/54 AceView cDNA sequences (see all 54):

AI280357 AA252884 CR599315 AI924134 AA253422 AA789124 BP359042 BP355762

BM853659 N46208 AF282265 BM550428 BQ277988 BM922517 BC032678 AA313562

BQ894573 AA306759 AI222734 CO246074 CK000972 AI290465 AI382702 BX415450

GeneLoc Exon Structure

4 Alternative Splicing Database (ASD) splice patterns (SP) for INCENP About this scheme

ExUns:	1a	·	1b	^	2	^	3	^	4	^	5	^	6	^	7	^	8	^	9	^	10a	·	10b	^	11	^	12	^	13	^	14	^	15a	·	15b	^	16a	·	16b
SP1:																											-								-
SP2:
SP3:																											-
SP4:			-

ECgene alternative splicing isoforms for INCENP

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

INCENP expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: --

About this image

INCENP expression in embryonic tissues and stem cells
Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

1 LifeMap In Vivo Development Anatomical Compartment/Cell

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Neural Tube

Mesencephalic Ventricular Zone

Neural Tube

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See INCENP Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for INCENP

SOURCE GeneReport for Unigene cluster: Hs.142179

SABiosciences Custom PCR Arrays for INCENP

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for INCENP Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat INCENP
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat INCENP
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat INCENP

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for INCENP

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for INCENP gene from 6/21 species (see all 21) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	INCENP¹	inner centromere protein antigens 135/155kDa	57.73(n) 54.76(a)		396270 NM_205330.1 NP_990661.1
lizard (Anolis carolinensis)	Reptilia	-- -- (see all 6)	--	8(a) 41(a) (see all 6)	possible ortholog 1 ↔ many (see all 6)	GL343208.1(3871650-3876851) 3(73727883-73732099)
African clawed frog (Xenopus laevis)	Amphibia	U95094.2²	--	77.35(n)		U95094.2
zebrafish (Danio rerio)	Actinopterygii	LOC572121¹	similar to XL-INCENP	49.93(n) 40.65(a)		572121 XM_002666588.3 XP_002666634.2
fruit fly (Drosophila melanogaster)	Insecta	Incenp⁶	Inner centromere protein	7(a)	1 ↔ 1	2R(3165972-3169066)
worm (Caenorhabditis elegans)	Secernentea	icp-1¹	Protein ICP-1	44.58(n) 30.67(a)		171788 NM_058555.7 NP_490956.1

ENSEMBL Gene Tree for INCENP (if available)
TreeFam Gene Tree for INCENP (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for INCENP gene

MAP7D2² MAP7D3² MAP7D1² MAP7²

INCENP for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 11 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs3862389^1,2	C,F,A,H	--	61889542(-)	`TGTTCC/TCAGGT`	2	--	us2k¹		24		NS EA NA WA	2488
rs3862390^1,2	C,F,A	--	61889595(-)	`AATCTT/CGAAGA`	2	--	us2k¹		9		NA WA EA	370
rs138431199^1,2		--	61889681(+)	`CAGCAG/TCAATT`	2	--	us2k¹		0	--	--	--	--
rs142905657^1,2		--	61889682(+)	`AGCAGC/TAATTC`	2	--	us2k¹		0	--	--	--	--
rs191505386^1,2		--	61889735(+)	`TATGCA/GCTAGA`	2	--	us2k¹		0	--	--	--	--
rs150747062^1,2		--	61889781(+)	`AATACC/GACTAA`	2	--	us2k¹		0	--	--	--	--
rs183653190^1,2		--	61889837(+)	`GGGGCA/GGAGGT`	2	--	us2k¹		0	--	--	--	--
rs12273561^1,2	C,F,H	--	61889960(+)	`CACACT/CCCGTT`	2	--	us2k¹		11		NS EA NA WA	1210
rs201912722^1,2		--	61890174(+)	`GCTAA-/TTTTTTT`	2	--	us2k¹		0	--	--	--	--
rs59889916^1,2	C	--	61890322(+)	`TCTTT-/TTTTTTTTTTTTTTTTTTTTTGAGACGGAGTCTCGCTCTGTCGC CCAGGCTGGAGTGCAGTGGCGGGATCTCGCCGGCCAGAGATTCTTTATAGG`	2	--	us2k¹		1		NA	2

HapMap Linkage Disequilibrium report for INCENP (61891445 - 61920635 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV): 4 variations for INCENP
     2 CNVs: 2929 8691
     1 Indel: 101235
     1 Inversion: 37126

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing INCENP

DNA2.0 Custom Variant and Variant Library Synthesis for INCENP

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

INCENP for disorders           About GeneDecksing

OMIM gene information: 604411    OMIM disorders: --

6 diseases for INCENP:    About MalaCards

b-cell lymphomas roberts syndrome hepatocellular carcinoma colorectal cancer

carcinoma leukemia

1 disease from the University of Copenhagen DISEASES database for INCENP:

Roberts syndrome

2 Novoseek disease relationships for INCENP gene About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
carcinoma	0	4	16402339 (2), 19221486 (1)
cancer	0	3	19221486 (1), 18752045 (1)

Export disorders for INCENP gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for INCENP gene, integrated from 9 sources (see all 135):
(articles sorted by number of sources associating them with INCENP)

Utopia: connect your pdf to the dynamic
world of online information

Human INCENP colocalizes with the Aurora-B/AIRK2 kinase on chromosomes and is overexpressed in tumour cells. (PubMed id 11453556)^{1, 2, 3, 9} Adams R.R....Earnshaw W.C. (2001)
Aurora-B phosphorylation in vitro identifies a residue of survivin that is essential for its localization and binding to inner centromere protein (INCENP) in vivo. (PubMed id 14610074)^{1, 2, 9} Wheatley S.P.... Earnshaw W.C. (2004)
Direct association with inner centromere protein (INCENP) activates the novel chromosomal passenger protein, Aurora-C. (PubMed id 15316025)^{1, 2, 9} Li X.... Urano T. (2004)
Exploring the functional interactions between Aurora B, INCENP, and survivin in mitosis. (PubMed id 12925766)^{1, 2, 9} Honda R....Nigg E.A. (2003)
Borealin: a novel chromosomal passenger required for stability of the bipolar mitotic spindle. (PubMed id 15249581)^{1, 2, 9} Gassmann R.... Earnshaw W.C. (2004)
Structure of a Survivin-Borealin-INCENP core complex reveals how chromosomal passengers travel together. (PubMed id 17956729)^{1, 2, 9} Jeyaprakash A.A....Conti E. (2007)
EVI5 protein associates with the INCENP-aurora B kinase-survivin chromosomal passenger complex and is involved in the completion of cytokinesis. (PubMed id 16764853)^{1, 2, 9} Faitar S.L.... Cowell J.K. (2006)
Analysis of the distribution of the INCENPs throughout mitosis reveals the existence of a pathway of structural changes in the chromosomes during metaphase and early events in cleavage furrow formation. (PubMed id 1860899)^{1, 3, 9} Earnshaw W.C. and Cooke C.A. (1991)
Human POGZ modulates dissociation of HP1alpha from mi totic chromosome arms through Aurora B activation. (PubMed id 20562864)^{1, 2} Nozawa R.S....Obuse C. (2010)
Phosphorylation- and polo-box-dependent binding of Plk1 to Bub1 is required for the kinetochore localization of Plk1. (PubMed id 16760428)^{1, 2} Qi W....Yu H. (2006)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 3619	HGNC: 6058	AceView: INCENP	Ensembl:ENSG00000149503	euGenes: HUgn3619
ECgene: INCENP	H-InvDB: INCENP

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for INCENP	Pharmacogenomics, SNPs, Pathways

Intellectual Property for INCENP gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for INCENP gene:
Search GeneIP for patents involving INCENP

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
About This Section

	Browse Kits and Assays available from EMD Millipore
	EMD Millipore Mono- and Polyclonal Antibodies for the study of INCENP
	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse Small Molecules at EMD Millipore
	EMD Millipore Purified and/or Recombinant INCENP Protein
	Browse for Gene Knock-down Tools from EMD Millipore

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	OriGene Antibodies for INCENP		OriGene shRNA RFP for INCENP
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for INCENP		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for INCENP
	OriGene Protein Over-expression Lysate for INCENP		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for INCENP		OriGene 3'-UTR Clone for INCENP
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for INCENP		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for INCENP
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for INCENP		OriGene Custom Protein Services for INCENP
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat INCENP
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing INCENP
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat INCENP
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat INCENP
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat INCENP
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat INCENP

	GenScript Custom Purified and Recombinant Proteins Services for INCENP		GenScript cDNA clones with any tag delivered in your preferred vector for INCENP
	GenScript Custom Assay Services for INCENP		GenScript Custom Superior Antibodies Services for INCENP
	GenScript Custom overexpressing Cell Line Services for INCENP		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Antibodies & Assays for INCENP

	Regulatory tfbs in INCENP promoter
	Search Chromatin IP Primers for INCENP
	RT² qPCR Primer Assay in human, mouse, rat INCENP
	GNC Network for INCENP
	SABiosciences Custom PCR Arrays for INCENP

Search Tocris compounds for INCENP

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	INCENP antibodies

	Antibodies for INCENP
	See all of Abcam's Antibodies, Kits and Proteins for INCENP
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

INCENP Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for INCENP

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for INCENP

	SwitchGear 3'UTR luciferase reporter plasmids for INCENP
	SwitchGear Promoter luciferase reporter plasmids for INCENP

ThermoFisher Antibody for INCENP

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat INCENP

inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for INCENP

Sirion Biotech Customized:

	stable knockdown cell line services for INCENP
	inducible knockdown cell line services for INCENP
	design and validation of potent shRNA sequences against INCENP
	adenovirus for potent knockdown of INCENP
	adenovirus for overexpression of INCENP
	stable overexpressing cell line services for INCENP
	inducible overexpressing cell line services for INCENP

GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 14 May 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes INCENP gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

INCENP Gene

inner centromere protein antigens 135/155kDa

Aliases
for INCENP gene

Summaries
for INCENP gene

Genomic Views
for INCENP gene

Proteins
for INCENP gene

Protein Domains /
Families
for INCENP gene

Function
for INCENP gene

Pathways & Interactions
for INCENP gene

Drugs & Compounds
for INCENP gene

Transcripts
for INCENP gene

Expression
for INCENP gene

Orthologs
for INCENP gene

Paralogs
for INCENP gene

Genomic Variants
for INCENP gene

Disorders / Diseases
for INCENP gene

Publications
for INCENP gene

External Searches for INCENP gene

Genome Databases showing INCENP gene

Other Databases showing INCENP gene

Specialized Databases showing INCENP gene

Intellectual Property
for INCENP gene

Products
for INCENP gene

View Random Gene

Advanced Search

Export list of displayed genes

INCENP Gene

inner centromere protein antigens 135/155kDa

Aliasesfor INCENP gene

Summariesfor INCENP gene

Genomic Viewsfor INCENP gene

Proteinsfor INCENP gene

Protein Domains /Familiesfor INCENP gene

Functionfor INCENP gene

Pathways & Interactionsfor INCENP gene

Drugs & Compoundsfor INCENP gene

Transcriptsfor INCENP gene

Expression for INCENP gene

Orthologsfor INCENP gene

Paralogsfor INCENP gene

Genomic Variantsfor INCENP gene

Disorders / Diseasesfor INCENP gene

Publicationsfor INCENP gene

External Searches for INCENP gene

Genome Databases showing INCENP gene

Other Databases showing INCENP gene

Specialized Databases showing INCENP gene

Intellectual Propertyfor INCENP gene

Productsfor INCENP gene

View Random Gene

Aliases
for INCENP gene

Summaries
for INCENP gene

Genomic Views
for INCENP gene

Proteins
for INCENP gene

Protein Domains /
Families
for INCENP gene

Function
for INCENP gene

Pathways & Interactions
for INCENP gene

Drugs & Compounds
for INCENP gene

Transcripts
for INCENP gene

Expression
for INCENP gene

Orthologs
for INCENP gene

Paralogs
for INCENP gene

Genomic Variants
for INCENP gene

Disorders / Diseases
for INCENP gene

Publications
for INCENP gene

Intellectual Property
for INCENP gene

Products
for INCENP gene