Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



IL2RA Gene

protein-coding   GIFtS: 71
GCID: GC10M006041

Interleukin 2 Receptor, Alpha

(Previous name: insulin-dependent diabetes mellitus 10)
(Previous symbols: IL2R, IDDM10)
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Interleukin 2 Receptor, Alpha1 2     IL-2R Subunit Alpha2 3
IDDM101 2 5     p552 3
IL2R1 2 5     TAC Antigen2 3
Insulin-Dependent Diabetes Mellitus 101 2     CD252
IL-2-RA2 3     TCGFR2
IL2-RA2 3     Interleukin-2 Receptor Subunit Alpha2
IL-2 Receptor Subunit Alpha2 3     CD25 Antigen3

External Ids:    HGNC: 60081   Entrez Gene: 35592   Ensembl: ENSG000001344607   OMIM: 1477305   UniProtKB: P015893   

Export aliases for IL2RA gene to outside databases

Previous GC identifers: GC10M005997 GC10M006203 GC10M006058 GC10M006059 GC10M006093


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for IL2RA Gene:
The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain
(IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity
receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane
protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis.
Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations
in this gene are associated with interleukin 2 receptor alpha deficiency.(provided by RefSeq, Nov 2009)

GeneCards Summary for IL2RA Gene:
IL2RA (interleukin 2 receptor, alpha) is a protein-coding gene. Diseases associated with IL2RA include uveitis, and graft versus host disease. GO annotations related to this gene include drug binding and interleukin-2 binding.

UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589
Function: Receptor for interleukin-2

summary for IL2RA Gene:
Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They
control many different cellular functions including proliferation, differentiation and cell
survival/apoptosis but are also involved in several pathophysiological processes including viral infections
and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the
innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can
be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma,
IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells.
Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells.

Gene Wiki entry for IL2RA Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000010.11  NT_008705.17  NC_018921.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the IL2RA gene promoter:
         STAT1   p53   STAT6   IRF-7A   STAT3   STAT5A   NF-kappaB   NF-kappaB1   STAT1alpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): IL2RA promoter sequence
   Search Chromatin IP Primers for IL2RA

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat IL2RA


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10p15-p14   Ensembl cytogenetic band:  10p15.1   HGNC cytogenetic band: 10p15-p14

IL2RA Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
IL2RA gene location

GeneLoc information about chromosome 10         GeneLoc Exon Structure

GeneLoc location for GC10M006041:  view genomic region     (about GC identifiers)

Start:
6,052,652 bp from pter      End:
6,104,333 bp from pter
Size:
51,682 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589 (See protein sequence)
Recommended Name: Interleukin-2 receptor subunit alpha precursor  
Size: 272 amino acids; 30819 Da
Subunit: Non-covalent dimer of an alpha and a beta subunit. IL2R exists in 3 different forms: a high affinity
dimer, an intermediate affinity monomer (beta subunit), and a low affinity monomer (alpha subunit). The high and
intermediate affinity forms also associate with a gamma subunit
Selected PDB 3D structures from and Proteopedia for IL2RA (see all 7):
1ILM (3D)        1ILN (3D)        1Z92 (3D)        2B5I (3D)        2ERJ (3D)        3IU3 (3D)    
Secondary accessions: Q5W007

Explore the universe of human proteins at neXtProt for IL2RA: NX_P01589

Explore proteomics data for IL2RA at MOPED

Post-translational modifications: 

  • Glycosylation2 at Asn70, Asn89, Thr218, Thr224, Thr229, Thr237
  • Modification sites at PhosphoSitePlus

  • See IL2RA Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_000408.1  
    ENSEMBL proteins: 
     ENSP00000369293   ENSP00000369287   ENSP00000256876   ENSP00000402024  
    Reactome Protein details: P01589

    IL2RA Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    R&D Systems Recombinant & Natural Proteins for IL2RA (IL-2 R alpha)
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for IL2RA
    OriGene Custom MassSpec
    OriGene Custom Protein Services for IL2RA
    GenScript Custom Purified and Recombinant Proteins Services for IL2RA
    Novus Biologicals IL2RA Proteins
    Sino Biological Recombinant Protein for IL2RA
    Sino Biological Cell Lysate for IL2RA
    ProSpec Recombinant Protein for IL2RA
    Browse Proteins at Cloud-Clone Corp.

    IL2RA Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of IL2RA
    R&D Systems Antibodies for IL2RA (IL-2 R alpha)
    Cell Signaling Technology (CST) Antibodies for IL2RA 
    OriGene Antibodies for IL2RA
    OriGene Custom Antibody Services for IL2RA
    Novus Biologicals IL2RA Antibodies
    Abcam antibodies for IL2RA
    Browse Antibodies at Cloud-Clone Corp.
    ThermoFisher Antibody for IL2RA
    LSBio Antibodies in human, mouse, rat for IL2RA

    IL2RA Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for IL2RA
    R&D Systems ELISAs for IL2RA (IL-2 R alpha)         (see all)
    GenScript Custom Assay Services for IL2RA
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    HGNC Gene Families:
    CD: CD molecules
    IL: Interleukins and interleukin receptors

    IUPHAR Guide to PHARMACOLOGY protein family classification: Interleukin-2 receptor alpha subunit
    IL-2 receptor family

    2 InterPro protein domains:
     IPR015486 IL-2_rcpt_alpha
     IPR000436 Sushi_SCR_CCP

    Graphical View of Domain Structure for InterPro Entry P01589

    ProtoNet protein and cluster: P01589

    1 Blocks protein domain: IPB000436 Sushi domain/SCR domain/CCP module

    UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589
    Similarity: Contains 2 Sushi (CCP/SCR) domains


    IL2RA for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: IL2RA_HUMAN, P01589
    Function: Receptor for interleukin-2

         Genatlas biochemistry entry for IL2RA:
    interleukin 2,low affinity receptor,alpha chain 45kDa,expressed in T cell,B lymphoblast lines,peripheral blood
    monocyte

         Gene Ontology (GO): 4 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004911interleukin-2 receptor activity IEA--
    GO:0005515protein binding ----
    GO:0008144drug binding IEA--
    GO:0019976interleukin-2 binding IEA--
         
    IL2RA for ontologies           About GeneDecksing


    Phenotypes:
         3 GenomeRNAi human phenotypes for IL2RA:
     Decreased BPV1 E2 protein expr  Increased HPV18 LCR reporter a  Increased cell death in breast 

         5 MGI mutant phenotypes (inferred from 1 allele(MGI details for Il2ra):
     digestive/alimentary  growth/size/body  hematopoietic system  immune system  mortality/aging 

    IL2RA for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Il2ratm1Dw for IL2RA

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for IL2RA
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for IL2RA

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for IL2RA
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for IL2RA

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat IL2RA using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate IL2RA (see all 11):
    hsa-miR-30c hsa-miR-875-3p hsa-miR-520f hsa-miR-186* hsa-miR-30d hsa-miR-3667-3p hsa-miR-30a hsa-miR-30b
    SwitchGear 3'UTR luciferase reporter plasmidIL2RA 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for IL2RA
    Predesigned siRNA for gene silencing in human, mouse, rat IL2RA

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for IL2RA

    Clone
    Products:
         
    OriGene clones in human, mouse for IL2RA (see all 7)
    OriGene ORF clones in mouse, rat for IL2RA
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: IL2RA (NM_000417)
    Sino Biological Human cDNA Clone for IL2RA
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for IL2RA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat IL2RA

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for IL2RA
    Browse ESI BIO Cell Lines and PureStem Progenitors for IL2RA 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for IL2RA


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    IL2RA_HUMAN, P01589: Membrane; Single-pass type I membrane protein
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    plasma membrane4
    extracellular3
    nucleus2
    cytoskeleton1
    cytosol1
    endoplasmic reticulum1
    endosome1
    mitochondrion1
    peroxisome1

    Gene Ontology (GO): 4 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005886plasma membrane TAS--
    GO:0009897external side of plasma membrane IEA--
    GO:0009986cell surface ----
    GO:0016021integral component of membrane IEA--

    IL2RA for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for IL2RA About   (see all 40)  
    See pathways by source

    SuperPathSelected contained pathways About (see all per SuperPath)
    1PEDF Induced Signaling
    NFAT Signaling and Lymphocyte Interactions0.57
    Glucocorticoid Receptor Signaling0.43
    PGC1Alpha Pathway0.51
    Cytokine-cytokine receptor interaction0.43
    STAT3 Pathway0.47
    2IL2-mediated signaling events
    IL-2 Signaling pathway0.49
    IL2-mediated signaling events0.49
    3Apoptotic Pathways in Synovial Fibroblasts
    Mitochondrial Apoptosis0.85
    PPAR Pathway0.66
    Cellular Apoptosis Pathway0.85
    Rac1 Pathway0.65
    Apoptotic Pathways in Synovial Fibroblasts0.84
    Actin-Based Motility by Rho Family GTPases0.62
    p53 Mediated Apoptosis0.84
    ERK5 Signaling0.61
    4TGF-Beta Pathway
    TGF-Beta Pathway0.60
    JAK-STAT Pathway0.57
    MAPK Family Pathway0.60
    JNK Pathway0.51
    5Signaling by Interleukins
    Interleukin receptor SHC signaling0.67
    Interleukin-3, 5 and GM-CSF signaling0.59
    Interleukin-2 signaling0.67
    Signaling by Interleukins0.42

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    3 R&D Systems Pathways for IL2RA
        IL-2 Signaling Pathways
    IL-15 Signaling and its Primary Biological Effects in Different Immune Cell Types
    IL-2 Signaling and its Primary Biological Effects in Different Immune Cell Types

    Selected Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for IL2RA (see all 38)
        Nuclear Receptor Activation by Vitamin-A
    THC Differentiation Pathway
    Telomerase Components in Cell Signaling
    Mitochondrial Apoptosis
    Molecular Mechanisms of Cancer

    2 Cell Signaling Technology (CST) Pathways for IL2RA
        Lymphocyte Signaling
    Tyrosine Kinases / Adaptors

    3 Tocris Bioscience Pathways for IL2RA
        Akt Pathway
    Toll-like Receptor Pathway
    MAPK Pathway

    3 GeneGo (Thomson Reuters) Pathways for IL2RA
        Immune response IL-12 signaling pathway
    Immune response IL-22 signaling pathway
    Immune response IL-2 activation and signaling pathway

    Selected BioSystems Pathways for IL2RA (see all 12)
        IL-2 Signaling pathway
    TSLP Signaling Pathway
    Calcium signaling in the CD4+ TCR pathway
    IL2 signaling events mediated by PI3K
    IL2-mediated signaling events


    2 Reactome Pathways for IL2RA
        Interleukin receptor SHC signaling
    Interleukin-2 signaling


    Selected Kegg Pathways  (Kegg details for IL2RA) (see all 7):
        Cytokine-cytokine receptor interaction
    Endocytosis
    PI3K-Akt signaling pathway
    Jak-STAT signaling pathway
    Hematopoietic cell lineage


    IL2RA for pathways           About GeneDecksing

        Pathway & Disease-focused RT2 Profiler PCR Arrays including IL2RA (see all 14): 
              Cell Surface Markers in human mouse rat
              NFKB Signaling Targets in human mouse rat
              Multiple Sclerosis in human mouse rat
              T-cell & B-cell Activation in human mouse rat
              Notch Signaling Pathway in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for IL2RA

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for IL2RA (P015892, 3 ENSP000003692934) via UniProtKB, MINT, STRING, and/or I2D (see all 88)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    PASKQ96RG22, 3, ENSP000002340404MINT-8148865 I2D: score=1 STRING: ENSP00000234040
    IL2P605683, ENSP000002267304I2D: score=4 STRING: ENSP00000226730
    ICAM1P053623, ENSP000002648324I2D: score=3 STRING: ENSP00000264832
    IL2RBP147843, ENSP000002162234I2D: score=3 STRING: ENSP00000216223
    NFKB1P198383, ENSP000002265744I2D: score=2 STRING: ENSP00000226574
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 19):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0002437inflammatory response to antigenic stimulus IEA--
    GO:0006915apoptotic process TAS9096364
    GO:0006924activation-induced cell death of T cells IEA--
    GO:0006955immune response TAS9096364
    GO:0007166cell surface receptor signaling pathway TAS2983318

    IL2RA for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Compounds for IL2RA available from Tocris Bioscience    About this table
    CompoundAction CAS #
    AS 101 Immunomodulator; inhibits IL-10 synthesis and potentiates IL-1alpha, IL-2 and TNF-alpha release [106566-58-9]
    PirfenidoneAntifibrotic agent; regulates cytokine levels in vivo[53179-13-8]
    GIT 27Immunomodulator; reduces production of pro-inflammatory cytokines[6501-72-0]
    4-IPPInhibitor of macrophage migration inhibitory factor (MIF); suicide substrate[41270-96-6]
    ThalidomideTNF-alpha synthesis inhibitor[50-35-1]

    4 DrugBank Compounds for IL2RA    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    AldesleukinIL-2 (see all 4)85898-30-2targetagonist modulator16767920 16864089 11752352 17530023 17216565 17584597 10207608
    DaclizumabAnti-IL-2 (see all 3)152923-56-3targetantibody17564638 19788505 8600944 16304857 11752352 16908318 10607689
    Denileukin diftitoxDiphtheria toxin precursor (see all 3)173146-27-5targetbinder17139284 2786749 3124610 11752352 17187516 17016423 18684057
    Basiliximabchimeric mouse-human antiCD25 (see all 2)152923-56-3targetantibody10567956 12591363 11752352 16908318 10512062 9695721

    Selected Novoseek inferred chemical compound relationships for IL2RA gene (see all 142)    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    daclizumab 86.2 101 11147695 (5), 15919507 (3), 10607689 (2), 9428817 (2) (see all 60)
    basiliximab 85.7 113 12727469 (6), 17440057 (5), 10573065 (4), 15848561 (3) (see all 60)
    neopterin 81 151 15756710 (6), 8260527 (6), 1444001 (5), 8258242 (3) (see all 97)
    okt3 72 30 1858157 (2), 1969884 (2), 1832993 (1), 15591961 (1) (see all 21)
    cyclosporin a 69 97 1864013 (4), 7702403 (3), 1346344 (2), 1812996 (2) (see all 63)
    denileukin diftitox 66.8 15 12149223 (2), 15811959 (2), 14506141 (1), 15744237 (1) (see all 9)
    ionomycin 62.6 33 8557519 (3), 2017664 (3), 2320954 (3), 2315321 (2) (see all 21)
    tacrolimus 62.3 45 8557519 (2), 15162466 (2), 7678231 (1), 9346613 (1) (see all 34)
    mycophenolate mofetil 62 29 20405579 (2), 16980068 (2), 10563181 (1), 10578712 (1) (see all 18)
    thymidine 56.2 52 2382107 (2), 1974593 (2), 9329587 (2), 11904739 (2) (see all 41)

    1 PharmGKB related drug/compound annotation for IL2RA gene    About this table
    Drug/compound PharmGKB Annotation
    denileukin diftitox



    IL2RA for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for IL2RA gene: 
    NM_000417.2  

    Unigene Cluster for IL2RA:

    Interleukin 2 receptor, alpha
    Hs.231367  [show with all ESTs]
    Unigene Representative Sequence: NM_000417
    4 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000379959(uc001iiz.2 uc009xih.2) ENST00000379954 ENST00000256876(uc001ija.1)
    ENST00000447847
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat IL2RA using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate IL2RA (see all 11):
    hsa-miR-30c hsa-miR-875-3p hsa-miR-520f hsa-miR-186* hsa-miR-30d hsa-miR-3667-3p hsa-miR-30a hsa-miR-30b
    SwitchGear 3'UTR luciferase reporter plasmidIL2RA 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for IL2RA
    Predesigned siRNA for gene silencing in human, mouse, rat IL2RA
    Clone
    Products:
         
    OriGene clones in human, mouse for IL2RA (see all 7)
    OriGene ORF clones in mouse, rat for IL2RA
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: IL2RA (NM_000417)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for IL2RA
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat IL2RA
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for IL2RA
    OriGene qSTAR qPCR primer pairs in human, mouse for IL2RA
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat IL2RA
      QuantiTect SYBR Green Assays in human, mouse, rat IL2RA
      QuantiFast Probe-based Assays in human, mouse, rat IL2RA

    Additional mRNA sequence: 

    AF008556.1 AK223313.1 AK313847.1 K03122.1 M14098.1 X01057.1 

    3 DOTS entries:

    DT.451929  DT.40128074  DT.121287686 

    Selected AceView cDNA sequences (see all 42):

    BM922713 AA641972 BP367522 BQ574113 AW950881 T28947 AI418535 BG232109 
    NM_000417 AF008556 BG057703 CD365812 AW444951 BG536515 CD701954 M14098 
    CB529386 BQ774288 AA903496 BF907985 K03122 BF439973 X01057 CD366300 

    GeneLoc Exon Structure

    5 Alternative Splicing Database (ASD) splice patterns (SP) for IL2RA    About this scheme

    ExUns: 1a · 1b · 1c · 1d ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6 ^ 7 ^ 8 ^ 9a · 9b · 9c
    SP1:                          -                                                               
    SP2:                          -                 -     -                                       
    SP3:                          -                 -     -     -                                 
    SP4:                          -                       -                                       
    SP5:                                                                                          


    ECgene alternative splicing isoforms for IL2RA

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    IL2RA expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: --
    IL2RA Expression
    About this image


    IL2RA expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 5) fully expand
     
     Blood (Hematopoietic System)    fully expand to see all 14 entries
             T-Regulatory Cells Peripheral Blood
             Regulatory T cells
             cd4+ cells   
     
     Thymus (Hematopoietic System)    fully expand to see all 5 entries
             Double Negative 3 Thymocytes Thymus
     
     Endothelium (Cardiovascular System)
             cd31+ cells   
     
     Ovary (Reproductive System)
             Cumulus Cells Antral Follicle
     
     Prostate (Endocrine System)
    IL2RA Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    IL2RA Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.231367
        Pathway & Disease-focused RT2 Profiler PCR Arrays including IL2RA (see all 14): 
              Cell Surface Markers in human mouse rat
              NFKB Signaling Targets in human mouse rat
              Multiple Sclerosis in human mouse rat
              T-cell & B-cell Activation in human mouse rat
              Notch Signaling Pathway in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for IL2RA
    OriGene qSTAR qPCR primer pairs in human, mouse for IL2RA
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat IL2RA
    QuantiTect SYBR Green Assays in human, mouse, rat IL2RA
    QuantiFast Probe-based Assays in human, mouse, rat IL2RA
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for IL2RA

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of human and mouse.

    Orthologs for IL2RA gene from Selected species (see all 6)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Il2ra1 , 5 interleukin 2 receptor, alpha chain1, 5 72.16(n)1
    61.42(a)1
      2 (8.91 cM)5
    161841  NM_008367.31  NP_032393.31 
     116427925 


    ENSEMBL Gene Tree for IL2RA (if available)
    TreeFam Gene Tree for IL2RA (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for IL2RA gene
    1 SIMAP similar gene for IL2RA using alignment to 4 protein entries:     IL2RA_HUMAN (see all proteins):
    IL2R

    IL2RA for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for IL2RA (see all 1360)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 10 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1166734671,2
    F--5978993(+) TGATTC/TGCATT 1 -- ds50011Minor allele frequency- T:0.01WA 118
    rs127226101,2
    C,F--5979005(-) GGTCAT/CTTCAG 1 -- ds50014Minor allele frequency- C:0.09NS NA 204
    rs1930336901,2
    --5979149(+) TGGGTA/GGATCA 1 -- ds50010--------
    rs1459463251,2
    C--5979158(+) CACTTA/GAGGTG 1 -- ds50010--------
    rs1857272031,2
    --5979236(+) GGACTG/TGGTGG 1 -- ds50010--------
    rs1898024011,2
    C--5979270(+) TTGGGA/TGGCTG 1 -- ds50010--------
    rs1461629891,2
    C--5979387(+) AAAAA-/CAAAAA 1 -- ds50010--------
    rs1173549301,2
    F--5979406(+) AAAAGC/TACCAA 1 -- ds50011Minor allele frequency- T:0.01NA 120
    rs127226091,2
    C,F--5979477(-) CTTGGT/GTTTTA 1 -- ds50017Minor allele frequency- G:0.17NS NA WA CSA 334
    rs748952461,2
    C,F--5979560(+) ATGACA/CTCATC 1 -- ut311Minor allele frequency- C:0.04EA 120
    rs1921451321,2
    --5979666(+) TTGATC/GTTATA 1 -- ut310--------
    rs127226081,2
    C,F,H--5979674(-) GAGGGG/TTCTAT 1 -- ut31 ese39Minor allele frequency- T:0.03NS EA NA WA 730
    rs127227201,2
    H--5979694(-) GATTAC/TGACTT 1 -- ut31 ese36Minor allele frequency- T:0.00NS EA 510
    rs127226071,2
    C,F,H--5979788(-) CTCCCC/GCTTCA 1 -- ut31 trp37Minor allele frequency- G:0.03NS NA EA 458
    rs749739371,2
    C--5979896(+) CGTGAG/TTTCTC 1 -- ut310--------
    rs127226061,2
    C,F,H--5979966(-) ATTAAC/TGAAAA 1 -- ut3114Minor allele frequency- T:0.08NS EA NA 1244
    rs127226051,2
    C,F,H--5979996(-) ATTCTA/TGCTCA 1 -- ut31 ese313Minor allele frequency- T:0.06NS EA NA 1016
    rs1846865211,2
    --5980019(+) GATTCA/GTGAGG 1 -- ut310--------
    rs127226041,2
    C,F,H--5980119(-) CTCTGC/TACGCC 1 -- ut31 ese310Minor allele frequency- T:0.13NS EA NA 726
    rs122443801,2
    C,F,A,H--5980205(+) AAAACA/GTTTGG 1 -- ut3133Minor allele frequency- G:0.31NS EA NA WA CSA 3500
    rs1434961231,2
    --5980238(+) AGAGAC/TTCTGA 1 -- ut310--------
    rs127227191,2
    C,H--5980323(-) ACCAGC/AAGTCC 1 -- ut31 ese36Minor allele frequency- A:0.00NS EA 488
    rs1511836211,2
    --5980342(+) CTTGTA/CTTTTT 1 -- ut310--------
    rs15705381,2
    C,F,A,H--5980399(+) TGGTGC/TCATCA 1 -- ut31 ese319Minor allele frequency- T:0.23EA NA NS WA 1024
    rs1152472771,2
    F--5980405(+) CATCAT/AGACTG 1 -- ut311Minor allele frequency- A:0.02WA 118
    rs1497965191,2
    --5980597(+) CCTAGA/GGAGCT 1 -- ut310--------
    rs558858531,2
    C--5980605(+) GCTGGA/GGTTAT 1 -- ut310--------
    rs1415247461,2
    C--5980625(+) CCACCA/GTGCCA 1 -- ut310--------
    rs283604841,2
    C,F--5980640(-) AGAGCG/ACATCA 1 -- ut31 ese32Minor allele frequency- A:0.03NA 122
    rs127227181,2
    C,F,H--5980642(-) AAAGAG/ACGCAT 1 -- ut319Minor allele frequency- A:0.01NS EA NA WA 516
    rs341641721,2
    C,F--5980658(-) AGAACG/ATAACC 1 -- ut311Minor allele frequency- A:0.04EA 120
    rs127226021,2
    C,F,H--5980697(-) AGGAAG/ATGAAG 1 -- ut31 trp319Minor allele frequency- A:0.08NS EU EA NA WA 2600
    rs127227171,2
    C--5980713(-) AGGAAG/AGAAAG 1 -- ut31 trp34Minor allele frequency- A:0.01NS NA 94
    rs1476691161,2
    --5980777(+) GGAAAC/TGTACG 1 -- ut310--------
    rs127227161,2
    C,F,H--5980778(-) GCGTAC/TGTTTC 1 -- ut31 ese36Minor allele frequency- T:0.01NS EA 506
    rs1434165421,2
    --5980899(+) GTAACA/GCACAG 1 -- ut310--------
    rs412903291,2
    C,F--5980914(+) AACTTT/CGCTAA 1 -- ut311Minor allele frequency- C:0.02NA 120
    rs762424061,2
    C--5980957(+) TTCTGG/TTCCTG 1 -- ut310--------
    rs757797931,2
    C--5980959(+) CTGTTC/GCTGAC 1 -- ut310--------
    rs764718901,2
    C--5980960(+) TGTTCA/CTGACA 1 -- ut310--------
    rs127199191,2
    C,F,H--5980989(-) AAAACG/AGGGCA 1 -- ut3110Minor allele frequency- A:0.02NS EA NA WA 612
    rs1886130921,2
    --5981188(+) AGAAAC/GGAACC 1 -- ut310--------
    rs1813579941,2
    --5981205(+) ACAATC/GTCCAG 1 -- ut310--------
    rs127226011,2
    C,F--5981222(-) CACTCT/AACCCT 1 -- ut31 ese32Minor allele frequency- A:0.01NS 82
    rs127227151,2
    H--5981343(-) GGAACT/GCTCTC 1 -- ut31 ese36Minor allele frequency- G:0.00NS EA 492
    rs1858295901,2
    --5981392(+) TAAGAC/TGGAGA 1 -- ut310--------
    rs127227141,2
    C,F,H--5981559(-) ACATCC/TGTTGT 1 -- ut31 ese38Minor allele frequency- T:0.03NS NA WA 896
    rs127226001,2
    C,F,H--5981596(-) CAAGTG/AAAATC 1 -- ut319Minor allele frequency- A:0.01NS EA NA 604
    rs127227131,2
    C,F,H--5981611(-) AGAAGT/CCATGA 1 -- ut31 ese310Minor allele frequency- C:0.03NS NA WA 996
    rs127227121,2,,4
    C,F,H--5981670(-) AACAAT/CCTAGA 2 /T /I mis111Minor allele frequency- C:0.00NS EA NA 5198
    rs741621011,2
    C--5981713(-) TGACCA/GTGACT 1 -- int10--------
    rs127225991,2
    C,F--5981744(-) ACCACA/-TTTTT 1 -- int12Minor allele frequency- -:0.05NS 80
    rs1415399131,2
    C--5981773(+) CACACG/TCCACC 1 -- int10--------
    rs70761031,2
    C,F,A--5981782(+) ccatgC/Tctggc 1 -- int17Minor allele frequency- T:0.12NA NS CSA WA 336
    rs122439931,2
    C,F--5981873(+) tgcctC/Tggcct 1 -- int14Minor allele frequency- T:0.08NS CSA NA 214
    rs360604611,2
    C,F--5981907(-) CAGTGG/ACTCAC 1 -- int11Minor allele frequency- A:0.02EU 894
    rs105083001,2
    C,F,H--5981955(+) TGGAAC/GAGGAA 1 -- int199Minor allele frequency- G:0.10NS EA PA EU CA WA NA 5320
    rs127225981,2
    C,F,H--5981981(-) TTAGCA/GCAGTT 1 -- int19Minor allele frequency- G:0.01NS EA NA 624
    rs112563351,2
    C,F--5982053(+) GATGAT/AGGAAA 1 -- int17Minor allele frequency- A:0.22NA NS 212
    rs127227111,2
    C,F,H--5982076(-) TCGGAC/GAGCAC 1 -- int16Minor allele frequency- G:0.01NS EA 504
    rs127227101,2
    C,F,H--5982111(-) TTTCAA/GGCGTT 1 -- int18Minor allele frequency- G:0.06NS EA WA 608
    rs127225971,2
    C,F--5982120(-) CTAGCC/TACATT 1 -- int17Minor allele frequency- T:0.05NS NA WA 212
    rs1895114051,2
    --5982199(+) AGGTGG/TCTAGT 1 -- int10--------
    rs127227091,2
    C,F,H--5982240(-) ACTGGG/AAAAAG 1 -- int17Minor allele frequency- A:0.01NS EA WA 500
    rs1459270651,2
    --5982284(+) CCTACG/TTTGCA 1 -- int10--------
    rs127227081,2
    C,F,H--5982290(-) ACTCTG/ATGCAA 1 -- int16Minor allele frequency- A:0.00NS EA 502
    rs127227071,2
    C,F--5982360(-) CAACCG/ATCATC 1 -- int14Minor allele frequency- A:0.03NS WA 204
    rs1398153201,2
    --5982361(+) ATGACA/GGTTGC 1 -- int10--------
    rs96634211,2
    C,F,A,H--5982435(+) GATCAC/TGCGGT 1 -- int131Minor allele frequency- T:0.15NS EA NA WA 3490
    rs1873817611,2
    --5982456(+) TGCGCA/GGTAGC 1 -- int10--------
    rs1418483271,2
    C--5982653(+) ACAGCA/GTCTCA 1 -- int10--------
    rs1446478791,2
    --5982736(+) ATTCTC/GCCACC 1 -- int10--------
    rs1150163651,2
    F--5982764(+) TGGGAC/ATACAG 1 -- int11Minor allele frequency- A:0.02WA 118
    rs1143243901,2
    F--5982851(+) TCAAGC/GGAGCC 1 -- int11Minor allele frequency- G:0.03WA 118
    rs1164760501,2
    C,F--5983103(+) TCTTTC/TGGTAA 1 -- int11Minor allele frequency- T:0.03WA 118
    rs127225961,2
    C,F,H--5983126(-) GCAACA/GGAAAT 1 -- int124Minor allele frequency- G:0.05NS EA NA 1906
    rs1484517811,2
    --5983161(+) ATCAGA/CTTCTA 1 -- int10--------
    rs127227061,2
    C,F,H--5983248(-) CAAGGT/GCTCCC 1 -- int17Minor allele frequency- G:0.03NS EA NA WA 368
    rs1426329821,2
    --5983304(+) ACACTC/GAACCA 1 -- int10--------
    rs1505689201,2
    --5983310(+) AACCAC/TTCCTA 1 -- int10--------
    rs1910609361,2
    --5983372(+) ACAAAC/TGAAAA 1 -- int10--------
    rs2020986011,2
    C--5983373(+) AAATG-/AAAAAA 1 -- int10--------
    rs354008931,2
    C,F--5983581(-) CCCCCT/CAGGGT 1 -- int11Minor allele frequency- C:0.03EA 120
    rs127227031,2
    F--5983603(-) TTACTG/ACAGTG 1 -- int12Minor allele frequency- A:0.03NS 90
    rs1828428131,2
    --5983611(+) TAATTC/TATACT 1 -- int10--------
    rs343841511,2
    C--5983799(-) CCCTGC/TCAGCA 1 -- int13Minor allele frequency- T:0.08NA EA 124
    rs1859778111,2
    --5983819(+) GCCCTA/GGATAA 1 -- int10--------
    rs127225951,2
    C,F--5984013(-) ctactC/Ggggag 1 -- int12Minor allele frequency- G:0.03NS 92
    rs123602211,2
    F--5984034(+) aggtgC/Tgcacc 1 -- int10--------
    rs112563421,2
    C,F--5984063(+) TTGTAT/GTTTTA 1 -- int17Minor allele frequency- G:0.29NS NA WA 102
    rs1899978591,2
    --5984130(+) TAATCC/TGCCTG 1 -- int10--------
    rs1833377611,2
    --5984215(+) AGTGCA/GGTGAT 1 -- int10--------
    rs1147311881,2
    C--5984249(+) GGCAGC/TGTCAG 1 -- int10--------
    rs122435491,2
    F--5984273(+) cctgaT/Cagaaa 1 -- int11Minor allele frequency- C:0.07WA 118
    rs753670041,2
    --5984333(+) TGGGAC/GCCAGC 1 -- int10--------
    rs1498472081,2
    C--5984354(+) TTAACA/GAGGCC 1 -- int10--------
    rs412946811,2
    C,F--5984487(+) ATCCAT/CCATCT 1 -- int13Minor allele frequency- C:0.11NA 124
    rs1458801531,2
    --5984504(+) TTTATC/TGTTTC 1 -- int10--------
    rs1490125851,2
    --5984505(+) TTATCA/GTTTCT 1 -- int10--------
    rs23868411,2
    C,F,A,H--5984564(-) ACACCC/AGGCCA 1 -- int125Minor allele frequency- A:0.25NS EA NA WA CSA 2768
    rs751530801,2
    C,F--5984597(+) TATGTA/GTTAGA 1 -- int11Minor allele frequency- G:0.03WA 118
    rs283604931,2
    C,F--5984606(-) TCAGAT/GGTATC 1 -- int13Minor allele frequency- G:0.13NA 124
    rs782301311,2
    F--5984709(+) AACATA/GGAGTG 1 -- int11Minor allele frequency- G:0.02EA 120
    rs1478148941,2
    C--5984716(+) GTGGT-/GGGTTT 1 -- int10--------
    rs1437456001,2
    --5984864(+) CCCCAC/GAGCTC 1 -- int10--------
    rs125728591,2
    C,F,H--5984872(+) ctcagG/Ctgttg 1 -- int16Minor allele frequency- C:0.08NS EA NA 528
    rs1384226591,2
    --5984935(+) ATCAGA/GTCGCG 1 -- int10--------
    rs127227021,2
    C,F--5984938(-) AGAGCCCTCGC/-
            
    GACCT
    1 -- int12Minor allele frequency- -:0.02NS 88
    rs287413721,2
    C,F--5984977(-) TCCTGC/TAATAA 1 -- int11Minor allele frequency- T:0.02NA 120
    rs1408564591,2
    --5984986(+) GAGTGA/GGTTTG 1 -- int10--------
    rs1874661331,2
    --5985050(+) GCCTTA/CTGCCA 1 -- int10--------
    rs127227011,2
    C,F--5985148(-) ACTTAT/CAAAGA 1 -- int13Minor allele frequency- C:0.08NS WA 204
    rs47498941,2
    C,F,A--5985155(+) AAGTTA/GTAAAT 1 -- int16Minor allele frequency- G:0.24NS NA 212
    rs1927178511,2
    --5985160(+) ATAAAA/TCTCTG 1 -- int10--------
    rs1827536251,2
    --5985161(+) TAAATA/CTCTGT 1 -- int10--------
    rs1447225241,2
    --5985214(+) CATTCC/TGTTAC 1 -- int10--------
    rs127225931,2
    C,F--5985224(-) ttgtgC/Gtactg 1 -- int15Minor allele frequency- G:0.03NS NA 206
    rs127225921,2
    C,F--5985248(-) AGTTCA/GGTGGT 1 -- int19Minor allele frequency- G:0.10NS NA WA CSA EA 448
    rs122409851,2
    C,F,H--5985252(+) ctgaaC/Gtgtac 1 -- int111Minor allele frequency- G:0.06NS EA NA WA 732
    rs1878566731,2
    --5985263(+) ATTTTA/GTGATG 1 -- int10--------
    rs127225911,2
    C,F--5985321(-) TGGGG-/G/TTGAGC 1 -- int13NS CSA 82
    rs790476411,2
    C--5985454(+) ACCTCC/TGCCTC 1 -- int10--------
    rs47478371,2
    C,F,H--5985568(+) tttcaC/Gcatgt 1 -- int19Minor allele frequency- G:0.10NS NA WA CSA 106
    rs1926220241,2
    --5985585(+) GCCTGA/GTCCTG 1 -- int10--------
    rs1116395971,2
    F--5985644(+) GATTAC/TAGGCA 1 -- int11Minor allele frequency- T:0.50CSA 2
    rs744942371,2
    F--5985778(+) TGAAGA/GTTCCC 1 -- int12Minor allele frequency- G:0.05CSA WA 120
    rs769368181,2
    --5985806(+) TCACAA/GTGGTT 1 -- int10--------
    rs771387891,2
    C,F--5986044(+) ATTCCT/CGGTCA 1 -- int11Minor allele frequency- C:0.01NA 120
    rs127225901,2
    C,F,H--5986308(-) CTATAC/TACCAG 1 -- int18Minor allele frequency- T:0.01NS EA NA 518
    rs79181541,2
    C,F,H--5986363(+) TGGTCG/CTTTAA 1 -- int15Minor allele frequency- C:0.01NS EA 362
    rs1891464811,2
    --5986408(+) CTCTGA/TCACCC 1 -- int10--------
    rs37937131,2
    C,F,H--5986536(+) CAACTA/GATTTT 1 -- int111Minor allele frequency- G:0.39NS NA WA CSA 113
    rs78995381,2
    C,F,H--5986730(+) CTTTGC/ACACTC 1 -- int127Minor allele frequency- A:0.12NS EA NA WA 3074
    rs1121850901,2
    C,F--5986776(+) GGTAGC/G/TGGGGA 1 -- int12CSA 6
    rs127226991,2
    C,H--5986847(-) AGACAG/ATAAGT 1 -- spd1 spl36Minor allele frequency- A:0.00NS EA 506
    rs1435507661,2
    C,F--5986885(+) GAGGAC/TGCTGA 2 I V mis11Minor allele frequency- T:0.00NA 4540
    rs127226981,2
    C,F,H--5986889(-) CTGATC/TAGCGT 2 I syn1 ese319Minor allele frequency- T:0.03NS NA WA CSA 6296
    rs2019558771,2
    --5986922(+) GTCAAC/TAGAGA 1 -- int10--------
    rs790401491,2
    C,F--5987097(+) AACAGG/AGCAGG 1 -- int11Minor allele frequency- A:0.03WA 118
    rs127226971,2
    C,F--5987122(-) CTCCCT/CCCACC 1 -- int13Minor allele frequency- C:0.03NS WA 210
    rs2020609401,2
    C--5987204(+) GACACA/C/GGAGAG 1 -- int10--------
    rs127225891,2
    C,F,H--5987255(-) GTTAAT/GGTGCT 1 -- int18Minor allele frequency- G:0.01NS EA NA 506
    rs127225881,2
    C,F,H--5987265(-) TTCAGG/AAGATG 1 -- int125Minor allele frequency- A:0.19NS EA NA WA CSA 2748
    rs127225871,2
    C,F--5987462(-) ACCCCG/AGGCCT 1 -- int19Minor allele frequency- A:0.19NS NA WA CSA EA 456
    rs112563521,2
    C,F,A,H--5987463(+) GGCCCG/AGGGTA 1 -- int16Minor allele frequency- A:0.15NS WA NA 332
    rs1849139671,2
    --5987722(+) ACCAAC/TCAACT 1 -- int10--------
    rs727760711,2
    C,F--5987798(+) ACCACC/ACTAAC 1 -- int13Minor allele frequency- A:0.04WA NA EA 358
    rs1170530211,2
    C,F--5987812(+) CAACCT/AACCAA 1 -- int11Minor allele frequency- A:0.01EA 120
    rs2005153891,2
    C--5987921(+) TGCCA-/ACC   
       AACCT
    ACCAA
    1 -- int10--------
    rs127225861,2
    C,F--5987959(-) TGGCAG/AGTTGG 1 -- int14Minor allele frequency- A:0.07NS NA 82
    rs1173803381,2
    C,F--5988065(+) TACGAA/GCCAAC 1 -- int11Minor allele frequency- G:0.01EA 120
    rs70699761,2
    C,F,H--5988109(+) TACCAA/GTCAAC 1 -- int120Minor allele frequency- G:0.04NS EA NA WA CSA 852
    rs112563541,2
    C,H--5988239(+) TACTCT/CGTTGT 2 /T syn1 ese34Minor allele frequency- C:0.00NS EA 418
    rs2015222661,2
    --5988253(+) TATGGA/GCGTCT 2 P S mis10--------
    rs1500604151,2
    F--5988259(+) CGTCTC/GCATGG 2 Q E mis11Minor allele frequency- G:0.00NA 4550
    rs1143991551,2
    C--5988298(+) ATCTGC/TGAAAA 1 -- int10--------
    rs741620971,2
    C--5988308(-) CTTTAT/ACTCTT 1 -- int11Minor allele frequency- A:0.00EU 1265
    rs1996598661,2
    --5988309(+) AGAGAC/TAAAGA 1 -- int10--------
    rs283604901,2
    C,F--5988311(-) TCTCTT/GTATCT 1 -- int16Minor allele frequency- G:0.11EU NA WA 1769
    rs283604891,2
    C--5988331(-) GTCACG/AGTAGC 1 -- int15Minor allele frequency- A:0.09EU NA WA 522
    rs1897890071,2
    --5988474(+) CCTGGC/GTTCCC 1 -- int10--------
    rs1808625341,2
    --5988501(+) TTTGGG/TGCCTG 1 -- int10--------
    rs2011474011,2
    C--5988519(+) TGAGG-/CCCCTG 1 -- int10--------
    rs283604861,2
    C,F--5988563(-) TAGGGG/-AGAAG 1 -- int1 trp31Minor allele frequency- -:0.07EU 288
    rs107521751,2
    C,F,H--5988613(+) TCACCC/TCTGCC 1 -- int121Minor allele frequency- T:0.18NS NA WA CSA EA 1098
    rs2016759471,2
    C--5988742(+) CTGGGG/AGAGAG 1 -- int11Minor allele frequency- A:0.00EU 1323
    rs22740361,2
    C,F,H--5988845(+) GGCAGG/AAATCC 1 -- int114Minor allele frequency- A:0.11EA NA NS 2604
    rs98042841,2
    C,F,H--5988883(+) ACCCCA/TCATGG 1 -- int116Minor allele frequency- T:0.02NS EA WA NA CSA 616
    rs22740371,2
    C,F,H--5988940(+) CAGACG/AAGGCT 1 -- int123Minor allele frequency- A:0.06EA NS NA WA 4056
    rs1861021041,2
    --5989058(+) TAATAC/TGAATG 1 -- int10--------
    rs1892492261,2
    --5989388(+) GCAGTA/GGTGTG 1 -- int10--------
    rs1500626121,2
    C--5989517(+) AGAGAC/TGGGGT 1 -- int10--------
    rs1819526511,2
    --5989527(+) TTTCAC/TCATGT 1 -- int10--------
    rs79003851,2
    C,F--5989581(+) GCCTTG/AGCCTC 1 -- int12Minor allele frequency- A:0.50NA 8
    rs412946851,2
    C,F--5989677(-) TCTTCC/ATTCTG 1 -- int12Minor allele frequency- A:0.04WA NA 238
    rs1857302501,2
    --5989696(+) GACCTC/TGACAT 1 -- int10--------
    rs127225851,2
    C,F--5989761(-) ACTTACTCA/-  
            
    GTGCA
    1 -- int12Minor allele frequency- -:0.18NS 86
    rs127225841,2
    C,F,H--5989768(-) CGGGAC/TTTACT 1 -- int17Minor allele frequency- T:0.03NS EA NA 388
    rs1144375151,2
    --5989823(+) TGGCAA/CAAGGG 1 -- int10--------
    rs1905422091,2
    --5989846(+) TGACCC/GTGGAG 1 -- int10--------
    rs9421981,2
    C,F,H--5989847(+) GACCGC/TGGAGG 1 -- int128Minor allele frequency- T:0.06EA NA NS WA CSA 1957
    rs127226961,2
    C,F--5990019(-) AAGAGA/CAGGAA 1 -- int1 trp33Minor allele frequency- C:0.01NS WA 200
    rs1827904201,2
    --5990051(+) ACTCAC/GGGCAC 1 -- int10--------
    rs1865302591,2
    --5990067(+) GACCTA/TCATTG 1 -- int10--------
    rs20768461,2
    C,F,A,H--5990084(+) CCCTTA/GGAGTC 1 -- int120Minor allele frequency- N:0.01NS EA NA WA CSA 1068
    rs1413717131,2
    --5990098(+) CTGATC/TTGGTC 1 -- int10--------
    rs2003503291,2
    C--5990099(+) TGATC-/TGGTCT 1 -- int10--------
    rs359806771,2
    C--5990123(+) TTTTT-/T/TT  
            
    CTCAG
    1 -- int11NA 2
    rs70930691,2
    C,F,A,H--5990149(+) AAGCCC/TAGGGA 1 -- int117Minor allele frequency- T:0.18NS NA WA CSA EA 1214
    rs112563601,2
    C,F,H--5990185(+) CTCTTG/ATCCAG 1 -- int18Minor allele frequency- A:0.07NS EA WA NA 616
    rs9421991,2
    C,F,H--5990213(+) TCCACC/TCTGGT 1 -- int129Minor allele frequency- A:0.00EA NA NS WA CSA 1936
    rs22281491,2
    C,F--5990338(-) ACCCAC/TGGGAA 2 H syn1 ese313Minor allele frequency- T:0.04MN NS NA WA EU 6477
    rs2011881141,2
    C--5990397(+) CTGGAC/TCACTG 2 I V mis11Minor allele frequency- T:0.00EU 1323
    rs1913401721,2
    C--5990502(+) GAAGGA/GATGCT 1 -- int10--------
    rs9422001,2
    C,F,H--5990504(+) AGGAAC/TGCTCT 1 -- int139Minor allele frequency- T:0.15NS NA EA WA CSA 3332
    rs1827681721,2
    C--5990532(+) AGCACC/TGCGAG 1 -- int10--------
    rs127226951,2
    C,F--5990593(-) GCAAGC/GAGTCA 1 -- int13Minor allele frequency- G:0.02NS WA 96
    rs127226941,2
    C,F,H--5990614(-) ATTGGT/CTGAAT 1 -- int16Minor allele frequency- C:0.00NS EA 462
    rs360860431,2
    F--5990660(+) TAGGCC/TCTGTA 1 -- int11Minor allele frequency- T:0.02EA 120
    rs127226931,2
    C--5990674(-) TCTTCC/G/TTGCCT 1 -- int12NS 94
    rs798872571,2
    --5990724(+) AGAAAA/GGCATG 1 -- int10--------
    rs79175881,2
    C,F--5990864(+) GTGGGC/TGGGGC 1 -- int12Minor allele frequency- T:0.02NS 94
    rs79206741,2
    C,F,A,H--5990979(+) GGCAGC/TGGCTG 1 -- int111Minor allele frequency- T:0.19NS NA WA CSA EA 464
    rs1869006961,2
    --5990980(+) GCAGCA/GGCTGG 1 -- int10--------
    rs115963551,2
    C,F,H--5991011(+) AAGGAT/CTGGGG 1 -- int118Minor allele frequency- C:0.05NS EA NA 2012
    rs412946871,2
    F--5991042(-) AGCCCG/ATCCCT 1 -- int11Minor allele frequency- A:0.01NA 120
    rs1479816071,2
    --5991179(+) CCCAGA/GCCTGA 1 -- int10--------
    rs1417841091,2
    --5991180(+) CCAGGA/CCTGAC 1 -- int10--------
    rs127225821,2
    C,F--5991392(-) AGCTTC/TCTGCT 1 -- int15Minor allele frequency- T:0.02NS NA WA 214
    rs127225811,2
    C,F--5991446(-) AGTCG-/TTGATG 1 -- int13Minor allele frequency- T:0.30NS CSA 94
    rs1472290481,2
    --5991477(+) AGGATA/GAAAGG 1 -- int10--------
    rs3763990361,2
    C--5991490(+) TTTGA-/CCCAGCC 1 -- int10--------
    rs127225801,2
    C,F--5991599(-) CTACTTCCCCCATATCACCCTGCACAGTTATTGGAAGGCTTC
    AAAGAGGCCAATGCTTGTTGTCCTTTCTCGAAGGCT
    /-
    GGCTC
    1 -- int12Minor allele frequency- -:0.24NS 90
    rs1388109451,2
    --5991605(+) GCCTTC/TGAGAA 1 -- int10--------
    rs2015502441,2
    C--5991671(-) CTACTG/TCCCCC 1 -- int10--------
    rs774522781,2
    F--5991723(+) AAAGTC/TGGAAG 1 -- int10--------
    rs1428181581,2
    --5991744(+) AAGAGA/CATCAT 1 -- int10--------
    rs1474106201,2
    --5991826(+) CTTTTA/CAAATA 1 -- int10--------
    rs412946911,2
    F--5991830(-) TACTTA/GTTTTA 1 -- int11Minor allele frequency- G:0.02NA 120
    rs1141155361,2
    F--5991846(+) CAGAAA/TGTTTC 1 -- int11Minor allele frequency- T:0.02WA 118
    rs127225791,2
    C,F,H--5992041(-) CTTTGC/TTGATT 1 -- int16Minor allele frequency- T:0.00NS EA 502
    rs1493798081,2
    C--5992060(+) AGTCTA/CCTAAG 1 -- int10--------
    rs1834142781,2
    --5992093(+) CAATTC/TTTCCT 1 -- int10--------
    rs1446532301,2
    --5992129(+) TTTTTC/GTTTTG 1 -- int10--------
    rs127225781,2
    C,F--5992201(-) cagtgA/Tgcaga 1 -- int12Minor allele frequency- T:0.02NS 94
    rs127226921,2
    C,F--5992204(-) TTGCAG/CTGAGC 1 -- int12Minor allele frequency- C:0.02NS 94
    rs1873787331,2
    --5992269(+) GACTAC/GAGGCA 1 -- int10--------
    rs79007441,2
    C,F,H--5992441(+) TTGACA/GCCATA 1 -- int121Minor allele frequency- G:0.30NS EA NA WA CSA 2096
    rs801524561,2
    C,F--5992446(+) ACCATA/GACTGA 1 -- int11Minor allele frequency- G:0.16EA 120
    rs1179303791,2
    C,F--5992464(+) TTCAGT/CCGTGG 1 -- int11Minor allele frequency- C:0.12EA 120
    rs79134761,2
    C,F,H--5992466(+) CAGTCA/GTGGGA 1 -- int125Minor allele frequency- G:0.05NS EA NA WA CSA 1521
    rs1466463891,2
    --5992481(+) AGAGGA/GCAGAC 1 -- int10--------
    rs1931554771,2
    --5992506(+) GTGCCC/TACTCA 1 -- int10--------
    rs736039101,2
    C--5992537(+) ACACAC/TGCATC 1 -- int11Minor allele frequency- T:0.50WA 2
    rs353995121,2
    C--5992628(-) GCACCA/GCAAAA 1 -- int10--------
    rs1882118121,2
    --5992657(+) GGAAGA/GCGCAG 1 -- int10--------
    rs1142086041,2
    F--5992659(+) AAGACG/ACAGAG 1 -- int11Minor allele frequency- A:0.01WA 118
    rs1401190791,2
    --5992686(+) GGGATC/GGTTGT 1 -- int10--------
    rs1437738931,2
    --5992687(+) GGATCA/GTTGTC 1 -- int10--------
    rs127225771,2
    H--5992747(-) AAAAGC/TGTCTG 1 -- int16Minor allele frequency- T:0.00NS EA 496
    rs1401441321,2
    --5992915(+) AGGACA/GGAGCC 1 -- int10--------
    rs1112376161,2
    F--5992959(+) TTCTTC/TCTTTG 1 -- int11Minor allele frequency- T:0.50CSA 4
    rs127226911,2
    H--5992979(-) GCAGGC/AAGATG 1 -- int16Minor allele frequency- A:0.00NS EA 502
    rs2016053771,2
    --5993017(+) GCTGGA/GGGACA 1 -- int10--------
    rs123589611,2
    C,F,A--5993025(+) ACAGAT/ATCATC 1 -- int111Minor allele frequency- A:0.30NS NA WA CSA EA 458
    rs112563691,2
    C,F--5993030(+) TTCATC/GTCTCA 1 -- int116Minor allele frequency- G:0.17NS NA WA EA 1096
    rs760299301,2
    C--5993066(+) GCTGCA/CTTGGA 2 R M mis10--------
    rs560544761,2
    C--5993072(+) TTGGAC/TTTTGC 2 N S mis11Minor allele frequency- T:0.00NA 4550
    rs2008384851,2
    --5993104(+) TTCTGC/TTCTTC 2 E syn10--------
    rs2011055991,2
    C--5993107(+) TGTTCA/TTCAGG 2 E D mis10--------
    rs726506661,2
    C,F--5993132(-) CACAAC/TGAAAC 2 T M mis12Minor allele frequency- T:0.00NA EU 5661
    rs1393402591,2
    F--5993141(+) TGTTCC/GGAGTG 2 P R mis11Minor allele frequency- G:0.00NA 4550
    rs2000481481,2
    --5993162(+) ATAGAC/TGGAAT 1 -- int10--------
    rs127226901,2
    C,F--5993194(-) TTCTAT/AGAAGC 1 -- int14Minor allele frequency- A:0.05NS CSA 96
    rs1882180841,2
    --5993210(+) TGTTCA/GTGTAT 1 -- int10--------
    rs127225761,2
    C,F,H--5993247(-) CGTGGG/TCCCTG 1 -- int17Minor allele frequency- T:0.01NS EA NA 620
    rs1503352191,2
    --5993254(+) CACGAC/TGTGTC 1 -- int10--------
    rs1448873781,2
    --5993267(+) GTGGTA/GTCTGG 1 -- int10--------
    rs127225751,2
    C,F--5993291(-) GTTTCG/ATATTT 1 -- int15Minor allele frequency- A:0.04NS NA 212
    rs127225741,2
    C,F,H--5993292(-) GGTTTC/TGTATT 1 -- int122Minor allele frequency- T:0.28NS EA WA NA CSA 1524
    rs1490415151,2
    --5993346(+) TATGGC/TAATGC 1 -- int10--------
    rs1817571381,2
    --5993380(+) GTATAC/TGTGTC 1 -- int10--------
    rs1461106771,2
    --5993381(+) TATACA/GTGTCT 1 -- int10--------
    rs20312291,2
    C,F,H--5993398(+) GTCATG/ATATGT 1 -- int124Minor allele frequency- A:0.17NS NA EA WA 2572
    rs127226891,2
    F--5993416(-) GGCATA/GCACAG 1 -- int12Minor allele frequency- G:0.02NS 86
    rs1428893551,2
    --5993421(+) TATGC-/CATGTATGTTAC
    GTGTCTGTGTATGT
    CATGT
    1 -- int10--------
    rs127225731,2
    C,F--5993446(-) acatgA/Gcatac 1 -- int13Minor allele frequency- G:0.03NS EU 384
    rs351511181,2
    C,F--5993608(-) GATGGC/TGTCTC 1 -- int11Minor allele frequency- T:0.01EU 276
    rs1429090011,2
    --5993890(+) AGGCAG/TGGTGG 1 -- int10--------
    rs127225721,2
    C,F--5994017(-) ggtgtA/C/Gcacca 1 -- int13NS NA 88
    rs1414669551,2
    --5994108(+) TACCAC/TCGCAC 1 -- int10--------
    rs109056341,2
    C,F,A,H--5994133(+) cagagC/Agagac 1 -- int18Minor allele frequency- A:0.23NA NS CSA 96
    rs1847253081,2
    --5994278(+) ACCCCA/GTCTCT 1 -- int10--------
    rs1905691201,2
    --5994321(+) GAGGGC/TGCCTG 1 -- int10--------
    rs1817893651,2
    --5994424(+) CCAGCC/TTAGGC 1 -- int10--------
    rs20253451,2
    C,F,A,H--5994518(+) TGTAGA/GCTGGA 1 -- int135Minor allele frequency- G:0.31NS EA NA WA CSA 3398
    rs564082081,2
    C--5994592(+) CAGTTC/TTTTTG 1 -- int10--------
    rs2016174751,2
    --5994702(+) TGACCC/TGCTTT 2 R G mis10--------
    rs741620931,2
    C--5994703(-) AAAAGC/TGGGTC 2 S syn10--------
    rs1420165451,2
    C--5994758(+) CTTCCT/CTGTAG 2 /K /R mis11Minor allele frequency- C:0.00NA 4550
    rs1463456521,2
    C--5994766(+) TAGGCC/TATGGC 2 I M mis11Minor allele frequency- T:0.00NA 4550
    rs22281501,2
    C,F,H--5994799(-) GACCCA/GCCAGA 2 P syn1 ese324Minor allele frequency- T:0.00MN NS NA EA WA EU 7533
    rs558682531,2
    C,F--5994807(+) GTCATC/GGTCAC 2 H D mis12Minor allele frequency- G:0.00NA EU 5873
    rs201995749