Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

IL2RA Gene

protein-coding GIFtS: 71
GCID: GC10M006041

interleukin 2 receptor, alpha

(Previous symbol: IL2R)

Explore 311 diseases affiliated with
IL2RA via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Interleukin 2 Receptor, Alpha¹ ²		P55¹
IL2R¹ ² ⁵		TAC Antigen² ³
CD25¹ ²		IDDM10² ⁵
IL-2-RA² ³		TCGFR²
IL2-RA² ³		Interleukin-2 Receptor Subunit Alpha²
IL-2 Receptor Subunit Alpha² ³		CD25 Antigen³
IL-2R Subunit Alpha² ³

External Ids:	HGNC: 6008¹	Entrez Gene: 3559²	Ensembl: ENSG00000134460⁷	OMIM: 147730⁵	UniProtKB: P01589³

Export aliases for IL2RA gene to outside databases

Previous GC identifers: GC10M005997 GC10M006203 GC10M006058 GC10M006059 GC10M006093

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for IL2RA:

The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG),

constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while

homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble

IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have

been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with

interleukin 2 receptor alpha deficiency.(provided by RefSeq, Nov 2009)

UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589

Function: Receptor for interleukin-2

summary for IL2RA:

Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They

control many different cellular functions including proliferation, differentiation and cell

survival/apoptosis but are also involved in several pathophysiological processes including viral infections

and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the

innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can

be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma,

IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells.

Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells.

Gene Wiki entry for IL2RA

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000010.10 NC_018921.1 NT_008705.16

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the IL2RA gene promoter:
STAT1 p53 STAT6 IRF-7A STAT3 STAT5A NF-kappaB NF-kappaB1 STAT1alpha
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): IL2RA promoter sequence

Search SABiosciences Chromatin IP Primers for IL2RA

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat IL2RA

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 10p15-p14 Ensembl cytogenetic band: 10p15.1 HGNC cytogenetic band: 10p15-p14

IL2RA Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
IL2RA gene location

GeneLoc information about chromosome 10 GeneLoc Exon Structure

GeneLoc location for GC10M006041: view genomic region (about GC identifiers)

Start:	6,052,652 bp from pter	End:	6,104,333 bp from pter
Size:	51,682 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589 (See protein sequence)

Recommended Name: Interleukin-2 receptor subunit alpha precursor

Size: 272 amino acids; 30819 Da

Subunit: Non-covalent dimer of an alpha and a beta subunit. IL2R exists in 3 different forms: a high affinity dimer, an

intermediate affinity monomer (beta subunit), and a low affinity monomer (alpha subunit). The high and intermediate

affinity forms also associate with a gamma subunit

Subcellular location: Membrane; Single-pass type I membrane protein

6/7 PDB 3D structures from and Proteopedia for IL2RA (see all 7):

1ILM (3D)

1ILN (3D)

1Z92 (3D)

2B5I (3D)

2ERJ (3D)

3IU3 (3D)

Secondary accessions: Q5W007

Explore the universe of human proteins at neXtProt for IL2RA: NX_P01589

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_P01589

IL2RA Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins: NP_000408.1

ENSEMBL proteins:

ENSP00000369293 ENSP00000369287 ENSP00000256876 ENSP00000402024

Reactome Protein details: P01589
Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	R&D Systems Recombinant & Natural Proteins for IL2RA (IL-2 R alpha)
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate: IL2RA OriGene Custom Protein Services for IL2RA
	GenScript Custom Purified and Recombinant Proteins Services for IL2RA
	Novus Biologicals IL2RA Proteins
	Sino Biological Recombinant Protein for IL2RA
	ProSpec Recombinant Protein for IL2RA
	Browse Proteins at Uscn

Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005886	plasma membrane	TAS	--
GO:0009897	external side of plasma membrane	IEA	--
GO:0009986	cell surface	--	--
GO:0016021	integral to membrane	IEA	--

IL2RA for ontologies About GeneDecksing

IL2RA Antibody Products:

	EMD Millipore Mono- and Polyclonal Antibodies for the study of IL2RA
	R&D Systems Antibodies for IL2RA (IL-2 R alpha)
	Cell Signaling Technology (CST) Antibodies for IL2RA
	OriGene Antibodies: IL2RA OriGene Custom Antibody Services for IL2RA
	GenScript Custom Superior Antibodies Services for IL2RA
	Novus Biologicals IL2RA Antibodies
	Abcam antibodies for IL2RA
	Browse Antibodies at Uscn
	ThermoFisher Antibody for IL2RA

Assay Products for IL2RA:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	R&D Systems ELISAs for IL2RA (IL-2 R alpha) (see all)
	GenScript Custom Assay Services for IL2RA
	Browse Enzo Life Sciences for kits & assays
	Browse ELISAs and CLIAs at Uscn

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

IL2RA for domains About GeneDecksing

2 InterPro domains/families:

IPR015486 IL-2_recpt_a

IPR000436 Sushi_SCR_CCP

Graphical View of Domain Structure for InterPro Entry P01589

ProtoNet protein and cluster: P01589

1 Blocks protein family: IPB000436 Sushi domain/SCR domain/CCP module

UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589

Similarity: Contains 2 Sushi (CCP/SCR) domains

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: IL2RA_HUMAN, P01589

Function: Receptor for interleukin-2

Genatlas biochemistry entry for IL2RA:

interleukin 2,low affinity receptor,alpha chain 45kDa,expressed in T cell,B lymphoblast lines,peripheral blood monocyte

miRNA Products:		OriGene 3'-UTR Clone: IL2RA Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat IL2RA
		8/11 QIAGEN miScript miRNA Assays for microRNAs that regulate IL2RA (see all 11):
		hsa-miR-30c hsa-miR-875-3p hsa-miR-520f hsa-miR-186* hsa-miR-30d hsa-miR-3667-3p hsa-miR-30a hsa-miR-30b

		SwitchGear 3'UTR luciferase reporter plasmid: IL2RA 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for IL2RA (see all 7) OriGene shRNA RFP: IL2RA OriGene siRNA: IL2RA
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat IL2RA

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for IL2RA

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for IL2RA (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for IL2RA OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: IL2RA (NM_000417)
		Sino Biological Human cDNA Clone for IL2RA
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for IL2RA
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat IL2RA

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for IL2RA
		Search LifeMap BioReagents cell lines for IL2RA

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for IL2RA

Gene Ontology (GO): 5 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004872	receptor activity	--	--
GO:0004911	interleukin-2 receptor activity	IEA	--
GO:0005515	protein binding	--	--
GO:0008144	drug binding	IEA	--
GO:0019976	interleukin-2 binding	IEA	--

IL2RA for ontologies About GeneDecksing

3 GenomeRNAi human phenotypes for IL2RA:

Decreased BPV1 E2 protein expr

Increased HPV18 LCR reporter a

Increased cell death in breast

Animal Models:
Mouse knock-out Il2ra^tm1Dw for IL2RA
6 MGI mutant phenotypes (inferred from 1 allele) (MGI details for Il2ra):

cellular	digestive/alimentary	growth/size	hematopoietic system	immune system
mortality/aging

IL2RA for phenotypes About GeneDecksing

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways - 5/39 super-pathways (see all 39) About this table

See pathways by source

Super-pathway

contained gene-specific pathways

Apoptotic Pathways in Synovial Fibroblasts

8/12 pathways (see all 12)
Apoptotic Pathways in Synovial Fibroblasts	1.00	Cellular Apoptosis Pathway	0.65
p53 Mediated Apoptosis	0.84	ERK5 Signaling	0.61
Mitochondrial Apoptosis	0.73	eIF2 Pathway	0.60
Telomerase Components in Cell Signaling	0.72	Rac1 Pathway	0.58

Interleukin receptor SHC signaling

Interleukin receptor SHC signaling	1.00	SHC1 mediates cytokine-induced phosphorylation of GAB2	0.61
Interleukin-2 signaling	0.67	Interleukin-3, 5 and GM-CSF signaling	0.57
Phosphorylated SHC1 recruits GRB2:GAB2	0.61	Signaling by Interleukins	0.25

PEDF Induced Signaling

STAT3 Pathway	0.47	Glucocorticoid Receptor Signaling	0.27
NFAT Signaling and Lymphocyte Interactions	0.37	Cytokine-cytokine receptor interaction	0.26
PGC1Alpha Pathway	0.33

TGF-Beta Pathway

	TGF-Beta Pathway	1.00			JAK-STAT Pathway	0.57
	MAPK Family Pathway	0.60			JNK Pathway	0.50

Akt Signaling

	Akt Signaling	1.00			Tec Kinases Signaling	0.55
	p38 Signaling	0.60

Pathway sources
See GeneCards unified pathways
Show all pathways

3 EMD Millipore Pathways for IL2RA

	Immune response IL-22 signaling pathway
	Immune response IL-12 signaling pathway
	Immune response IL-2 activation and signaling pathway

3 R&D Systems Pathways for IL2RA

	IL-2 Signaling Pathways
	IL-15 Signaling and its Primary Biological Effects in Different Immune Cell Types
	IL-2 Signaling and its Primary Biological Effects in Different Immune Cell Types

5/38 Downloadable PowerPoint Slides of QIAGEN Pathway Central Maps for IL2RA (see all 38)

	Nuclear Receptor Activation by Vitamin-A
	THC Differentiation Pathway
	Telomerase Components in Cell Signaling
	Mitochondrial Apoptosis
	Molecular Mechanisms of Cancer

2 Cell Signaling Technology (CST) Pathways for IL2RA

	Lymphocyte Signaling
	Tyrosine Kinases / Adaptors

3 Tocris Bioscience Pathways for IL2RA

	Akt Pathway
	Toll-like Receptor Pathway
	MAPK Pathway

3 GeneGo (Thomson Reuters) Pathways for IL2RA

	Immune response IL-12 signaling pathway
	Immune response IL-22 signaling pathway
	Immune response IL-2 activation and signaling pathway

5/12 BioSystems Pathways for IL2RA (see all 12)

	TSLP Signaling Pathway
	IL-2 Signaling Pathway
	Inflammatory Response Pathway
	IL12-mediated signaling events
	Calcium signaling in the CD4+ TCR pathway

5/8 Reactome Pathways for IL2RA (see all 8)

	SHC1 mediates cytokine-induced phosphorylation of GAB2
	Interleukin receptor SHC signaling
	Interleukin-2 signaling
	Phosphorylated SHC1 recruits GRB2:GAB2
	Cytokine Signaling in Immune system

5 Kegg Pathways (Kegg details for IL2RA):

	Cytokine-cytokine receptor interaction
	Endocytosis
	Jak-STAT signaling pathway
	Hematopoietic cell lineage
	Measles

IL2RA for pathways About GeneDecksing

Interactions:

SABiosciences Gene Network Central^TM Interacting Genes and Proteins Network for IL2RA

STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

5/88 Interacting proteins for IL2RA (P01589^{2, 3} ENSP00000369293⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 88)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
PASK	Q96RG2²^,³, ENSP00000234040⁴	MINT-8148865 I2D: score=1 STRING: ENSP00000234040
IL2	P60568³, ENSP00000226730⁴	I2D: score=4 STRING: ENSP00000226730
ICAM1	P05362³, ENSP00000264832⁴	I2D: score=3 STRING: ENSP00000264832
IL2RB	P14784³, ENSP00000216223⁴	I2D: score=3 STRING: ENSP00000216223
NFKB1	P19838³, ENSP00000226574⁴	I2D: score=2 STRING: ENSP00000226574

About this table

Gene Ontology (GO): 5/19 biological process terms (GO ID links to tree view) (see all 19): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0002437	inflammatory response to antigenic stimulus	IEA	--
GO:0006915	apoptotic process	TAS	9096364
GO:0006924	activation-induced cell death of T cells	IEA	--
GO:0006955	immune response	TAS	9096364
GO:0007166	cell surface receptor signaling pathway	TAS	2983318

IL2RA for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

IL2RA for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Compounds for IL2RA available from Tocris Bioscience About this table

Compound	Action	CAS #
Ro 26-4550 trifluoroacetate	Competitive inhibitor of IL-2/ IL-2Ralpha receptor interaction	[193744-04-6]

4 DrugBank Compounds for IL2RA About this table

Compound	Synonyms	CAS #	Type	Actions	PubMed Ids
Daclizumab	Anti-IL-2 (see all 3)	152923-56-3	target	antibody	17564638 19788505 8600944 16304857 11752352 16908318 10607689
Denileukin diftitox	Diphtheria toxin precursor (see all 3)	173146-27-5	target	binder	17139284 2786749 3124610 11752352 17187516 17016423 18684057
Aldesleukin	IL-2 (see all 4)	85898-30-2	target	agonist modulator	16767920 16864089 11752352 17530023 17216565 17584597
Basiliximab	chimeric mouse-human antiCD25 (see all 2)	152923-56-3	target	antibody	10567956 12591363 11752352 16908318 10512062 9695721

10/142 Novoseek chemical compound relationships for IL2RA gene (see all 142) About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
daclizumab	86.2	101	11147695 (5), 15919507 (3), 10607689 (2), 9428817 (2) (see all 60)
basiliximab	85.7	113	12727469 (6), 17440057 (5), 10573065 (4), 15848561 (3) (see all 60)
neopterin	81	151	15756710 (6), 8260527 (6), 1444001 (5), 8258242 (3) (see all 97)
okt3	72	30	1858157 (2), 1969884 (2), 1832993 (1), 15591961 (1) (see all 21)
cyclosporin a	69	97	1864013 (4), 7702403 (3), 1346344 (2), 1812996 (2) (see all 63)
denileukin diftitox	66.8	15	12149223 (2), 15811959 (2), 14506141 (1), 15744237 (1) (see all 9)
ionomycin	62.6	33	8557519 (3), 2017664 (3), 2320954 (3), 2315321 (2) (see all 21)
tacrolimus	62.3	45	8557519 (2), 15162466 (2), 7678231 (1), 9346613 (1) (see all 34)
mycophenolate mofetil	62	29	20405579 (2), 16980068 (2), 10563181 (1), 10578712 (1) (see all 18)
thymidine	56.2	52	2382107 (2), 1974593 (2), 9329587 (2), 11904739 (2) (see all 41)

1 PharmGKB related drug/compound annotation for IL2RA gene

Drug/compound	PharmGKB Annotation
denileukin diftitox	DL

About this table

Search CenterWatch for drugs/clinical trials and news about IL2RA

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for IL2RA gene:

NM_000417.2

Unigene Cluster for IL2RA:

Interleukin 2 receptor, alpha

Hs.231367 [show with all ESTs]

Unigene Representative Sequence: NM_000417

5 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000379959(uc001iiz.2 uc009xih.2) ENST00000488980 ENST00000379954

ENST00000256876(uc001ija.1) ENST00000447847

miRNA Products:		OriGene 3'-UTR Clone: IL2RA Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat IL2RA
		8/11 QIAGEN miScript miRNA Assays for microRNAs that regulate IL2RA (see all 11):
		hsa-miR-30c hsa-miR-875-3p hsa-miR-520f hsa-miR-186* hsa-miR-30d hsa-miR-3667-3p hsa-miR-30a hsa-miR-30b

		SwitchGear 3'UTR luciferase reporter plasmid: IL2RA 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for IL2RA (see all 7) OriGene shRNA RFP: IL2RA OriGene siRNA: IL2RA
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat IL2RA

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for IL2RA (see all 3) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for IL2RA OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector: IL2RA (NM_000417)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for IL2RA
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat IL2RA

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for IL2RA Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat IL2RA
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat IL2RA
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat IL2RA

Additional cDNA sequence:

AF008556.1 AK223313.1 AK313847.1 K03122.1 M14098.1 X01057.1

3 DOTS entries:

DT.451929 DT.40128074 DT.121287686

24/42 AceView cDNA sequences (see all 42):

BP367522 NM_000417 BM922713 BQ574113 T28947 BG232109 AW950881 AA641972

AI418535 AW444951 K03122 AF008556 BQ774288 X01057 AW575058 BG057703

CB529386 AI423610 CD366300 BF439973 AA903496 CD365812 BF907985 BG536515

GeneLoc Exon Structure

5 Alternative Splicing Database (ASD) splice patterns (SP) for IL2RA About this scheme

ExUns:	1a	·	1b	·	1c	·	1d	^	2	^	3	^	4	^	5a	·	5b	^	6	^	7	^	8	^	9a	·	9b	·	9c
SP1:									-
SP2:									-						-		-
SP3:									-						-		-		-
SP4:									-								-
SP5:

ECgene alternative splicing isoforms for IL2RA

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

IL2RA expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: --

About this image

IL2RA expression in embryonic tissues and stem cells

Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine About this table

5 LifeMap In Vivo Development Anatomical Compartments/Cells

Tissue

Anatomical Compartment

Cell

Category (developmental path)

Blood

Blood

B-cell Progenitor Cells

Blood

Blood

Ovary

Expression:

Positive

Negative

Selective marker

Experimental details:

Curated

Microarrays

In-situ hybridization

See IL2RA Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for IL2RA

SOURCE GeneReport for Unigene cluster: Hs.231367

SABiosciences Expression via Pathway-Focused PCR Arrays including IL2RA (see all 14):

Cell Surface Markers in human mouse rat

NFKB Signaling Targets in human mouse rat

Multiple Sclerosis in human mouse rat

T-cell & B-cell Activation in human mouse rat

Notch Signaling Pathway in human mouse rat

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for IL2RA Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse, rat IL2RA
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat IL2RA
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat IL2RA

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for IL2RA

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of chordates.

Orthologs for IL2RA gene from 2/7 species (see all 7) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
mouse (Mus musculus)	Mammalia	Il2ra^{1 , 5}	interleukin 2 receptor, alpha chain^{1, 5}	72.16(n)¹ 61.42(a)¹		2 (8.91 cM)⁵ 16184¹ NM_008367.3¹ NP_032393.3¹ 11642792⁵
chicken (Gallus gallus)	Aves	Q90WJ4_CHICK⁶	IL-2 alpha receptor	25(a)	1 ↔ 1	1(3284864-3301337)

ENSEMBL Gene Tree for IL2RA (if available)
TreeFam Gene Tree for IL2RA (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

SNP ID	Valid	Clinical significance	Chr 10 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs12722609^1,2	C,F,	--	5979477(-)	`CTTGGT/GTTTTA`	1	--	ds500¹		7		NS NA WA CSA	334
rs12722720^1,2	H	--	5979694(-)	`GATTAC/TGACTT`	1	--	ut3¹ ese³		6		NS EA	510
rs12722606^1,2	C,F,H,	--	5979966(-)	`ATTAAC/TGAAAA`	1	--	ut3¹		14		NS EA NA	1244
rs12722605^1,2	C,F,H,	--	5979996(-)	`ATTCTA/TGCTCA`	1	--	ut3¹ ese³		13		NS EA NA	1016
rs12722719^1,2	H	--	5980323(-)	`ACCAGC/AAGTCC`	1	--	ut3¹ ese³		6		NS EA	488
rs12722603^1,2	C,	--	5980480(-)	`ATACGC/TCTGTA`	1	--	ut3¹ ese³		4		NS NA	98
rs55885853^1,2	C,	--	5980605(+)	`GCTGGA/GGTTAT`	1	--	ut3¹		0	--	--	--	--
rs28360484^1,2	C,	--	5980640(-)	`AGAGCG/ACATCA`	1	--	ut3¹ ese³		2		NA	122
rs12722718^1,2	C,F,H,	--	5980642(-)	`AAAGAG/ACGCAT`	1	--	ut3¹		9		NS EA NA WA	516
rs12722717^1,2	C	--	5980713(-)	`AGGAAG/AGAAAG`	1	--	ut3¹ trp³		4		NS NA	94
rs12722716^1,2	C,F,H,	--	5980778(-)	`GCGTAC/TGTTTC`	1	--	ut3¹ ese³		6		NS EA	506
rs41290329^1,2	C,F,	--	5980914(+)	`AACTTT/CGCTAA`	1	--	ut3¹		1		NA	120
rs12722601^1,2	C,	--	5981222(-)	`CACTCT/AACCCT`	1	--	ut3¹ ese³		2		NS	82
rs12722715^1,2	H	--	5981343(-)	`GGAACT/GCTCTC`	1	--	ut3¹ ese³		6		NS EA	492
rs12722714^1,2	C,F,H,	--	5981559(-)	`ACATCC/TGTTGT`	1	--	ut3¹ ese³		8		NS NA WA	896
rs12722600^1,2	C,F,H,	--	5981596(-)	`CAAGTG/AAAATC`	1	--	ut3¹		9		NS EA NA	604
rs12722713^1,2	C,F,H,	--	5981611(-)	`AGAAGT/CCATGA`	1	--	ut3¹ ese³		10		NS NA WA	996
rs12722599^1,2	C,F,	--	5981744(-)	`ACCACA/-TTTTT`	1	--	int¹		2		NS	80
rs12243993^1,2	C,F,	--	5981873(+)	`tgcctC/Tggcct`	1	--	int¹		4		NS CSA NA	214
rs36060461^1,2	C,F,	--	5981907(-)	`CAGTGG/ACTCAC`	1	--	int¹		1		EU	894
rs12722598^1,2	C,F,H,	--	5981981(-)	`TTAGCA/GCAGTT`	1	--	int¹		9		NS EA NA	624
rs12722711^1,2	C,F,H,	--	5982076(-)	`TCGGAC/GAGCAC`	1	--	int¹		6		NS EA	504
rs12722710^1,2	C,F,H,	--	5982111(-)	`TTTCAA/GGCGTT`	1	--	int¹		8		NS EA WA	608
rs12722709^1,2	C,F,H,	--	5982240(-)	`ACTGGG/AAAAAG`	1	--	int¹		7		NS EA WA	500
rs12722708^1,2	C,H,	--	5982290(-)	`ACTCTG/ATGCAA`	1	--	int¹		6		NS EA	502
rs12722707^1,2	C,F,	--	5982360(-)	`CAACCG/ATCATC`	1	--	int¹		4		NS WA	204
rs116476050^1,2	C,F,	--	5983103(+)	`TCTTTC/TGGTAA`	1	--	int¹		1		WA	118
rs12722706^1,2	C,F,H,	--	5983248(-)	`CAAGGT/GCTCCC`	1	--	int¹		7		NS EA NA WA	368
rs35400893^1,2	F,	--	5983581(-)	`CCCCCT/CAGGGT`	1	--	int¹		1		EA	120
rs12722703^1,2	F	--	5983603(-)	`TTACTG/ACAGTG`	1	--	int¹		2		NS	90
rs12722595^1,2	C,F,	--	5984013(-)	`ctactC/Ggggag`	1	--	int¹		2		NS	92
rs12360221^1,2		--	5984034(+)	`aggtgC/Tgcacc`	1	--	int¹		0	--	--	--	--
rs12243549^1,2	F,	--	5984273(+)	`cctgaT/Cagaaa`	1	--	int¹		1		WA	118
rs75367004^1,2		--	5984333(+)	`TGGGAC/GCCAGC`	1	--	int¹		0	--	--	--	--
rs41294681^1,2	C,	--	5984487(+)	`ATCCAT/CCATCT`	1	--	int¹		3		NA	124
rs75153080^1,2	C,F,	--	5984597(+)	`TATGTA/GTTAGA`	1	--	int¹		1		WA	118
rs28360493^1,2	C,	--	5984606(-)	`TCAGAT/GGTATC`	1	--	int¹		3		NA	124
rs78230131^1,2	F,	--	5984709(+)	`AACATA/GGAGTG`	1	--	int¹		1		EA	120
rs28741372^1,2	F,	--	5984977(-)	`TCCTGC/TAATAA`	1	--	int¹		1		NA	120
rs12722701^1,2	C,F,	--	5985148(-)	`ACTTAT/CAAAGA`	1	--	int¹		3		NS WA	204
rs4749894^1,2	C,F,A,	--	5985155(+)	`AAGTTA/GTAAAT`	1	--	int¹		6		NS NA	212
rs12722593^1,2	C,F,	--	5985224(-)	`ttgtgC/Gtactg`	1	--	int¹		5		NS NA	206
rs12240985^1,2	C,F,H,	--	5985252(+)	`ctgaaC/Gtgtac`	1	--	int¹		11		NS EA NA WA	732
rs111639597^1,2		--	5985644(+)	`GATTAC/TAGGCA`	1	--	int¹		1		CSA	2
rs74494237^1,2		--	5985778(+)	`TGAAGA/GTTCCC`	1	--	int¹		2		CSA WA	120
rs76936818^1,2		--	5985806(+)	`TCACAA/GTGGTT`	1	--	int¹		0	--	--	--	--
rs77138789^1,2		--	5986044(+)	`ATTCCT/CGGTCA`	1	--	int¹		1		NA	120
rs12722590^1,2	C,F,H,	--	5986308(-)	`CTATAC/TACCAG`	1	--	int¹		8		NS EA NA	518
rs7918154^1,2	C,F,H	--	5986363(+)	`TGGTCG/CTTTAA`	1	--	int¹		5		NS EA	362
rs112185090^1,2	F	--	5986776(+)	`GGTAGG/CGGGGA`	1	--	int¹		2		CSA	6
rs12722699^1,2	C,H	--	5986847(-)	`AGACAG/ATAAGT`	1	--	spd¹ spl³		6		NS EA	506
rs79040149^1,2	C,F,	--	5987097(+)	`AACAGG/AGCAGG`	1	--	int¹		1		WA	118
rs12722697^1,2	C,F,	--	5987122(-)	`CTCCCT/CCCACC`	1	--	int¹		3		NS WA	210
rs12722589^1,2	C,F,H,	--	5987255(-)	`GTTAAT/GGTGCT`	1	--	int¹		8		NS EA NA	506
rs11256352^1,2	C,F,A,H,	--	5987463(+)	`NNNNCG/AGGGTA`	1	--	int¹		6		NS WA NA	332
rs12722586^1,2	C,F,	--	5987959(-)	`TGGCAG/AGTTGG`	1	--	int¹		4		NS NA	82
rs41294683^1,2		--	5989485(-)	`TGGGCG/TTGGTG`	1	--	int¹		0	--	--	--	--
rs12722584^1,2	C,F,H,	--	5989768(-)	`CGGGAC/TTTACT`	1	--	int¹		7		NS EA NA	388
rs12722696^1,2	C,	--	5990019(-)	`AAGAGA/CAGGAA`	1	--	int¹ trp³		3		NS WA	200
rs11256360^1,2	C,F,H,	--	5990185(+)	`CTCTTG/ATCCAG`	1	--	int¹		8		NS EA WA NA	616
rs12722695^1,2	C,F,	--	5990593(-)	`GCAAGC/GAGTCA`	1	--	int¹		3		NS WA	96
rs12722694^1,2	C,H,	--	5990614(-)	`ATTGGT/CTGAAT`	1	--	int¹		6		NS EA	462
rs12722693^1,2	C	--	5990674(-)	`TCTTCC/G/TTGCCT`	1	--	int¹		2		NS	94
rs79887257^1,2		--	5990724(+)	`AGAAAA/GGCATG`	1	--	int¹		0	--	--	--	--
rs7917588^1,2	C,F,	--	5990864(+)	`GTGGGC/TGGGGC`	1	--	int¹		2		NS	94
rs41294687^1,2		--	5991042(-)	`AGCCCG/ATCCCT`	1	--	int¹		1		NA	120
rs12722582^1,2	C,F,	--	5991392(-)	`AGCTTC/TCTGCT`	1	--	int¹		5		NS NA WA	214
rs12722580^1,2	C,F	--	5991599(-)	`CTACTTCCCCCATATCACCCTGCACAGTTATTGGAAGGCTTC AAAGAGGCCAATGCTTGTTGTCCTTTCTCGAAGGCT/-GGCTC`	1	--	int¹		2		NS	90
rs201550244^1,2	C	--	5991671(-)	`CTACTG/TCCCCC`	1	--	int¹		0	--	--	--	--
rs77452278^1,2		--	5991723(+)	`AAAGTC/TGGAAG`	1	--	int¹		0	--	--	--	--
rs41294691^1,2	F,	--	5991830(-)	`TACTTA/GTTTTA`	1	--	int¹		1		NA	120
rs12722579^1,2	C,H,	--	5992041(-)	`CTTTGC/TTGATT`	1	--	int¹		6		NS EA	502
rs12722578^1,2	C,F,	--	5992201(-)	`cagtgA/Tgcaga`	1	--	int¹		2		NS	94
rs12722692^1,2	C,F,	--	5992204(-)	`TTGCAG/CTGAGC`	1	--	int¹		2		NS	94
rs73603910^1,2	C,	--	5992537(+)	`ACACAC/TGCATC`	1	--	int¹		1		WA	2
rs12722577^1,2	H	--	5992747(-)	`AAAAGC/TGTCTG`	1	--	int¹		6		NS EA	496
rs111237616^1,2	F	--	5992959(+)	`TTCTTC/TCTTTG`	1	--	int¹		1		CSA	4
rs12722691^1,2	H	--	5992979(-)	`GCAGGC/AAGATG`	1	--	int¹		6		NS EA	502
rs76029930^1,2	C,	--	5993066(+)	`GCTGCA/CTTGGA`	2	R M	mis¹		0	--	--	--	--
rs12722690^1,2	C,F	--	5993194(-)	`TTCTAT/AGAAGC`	1	--	int¹		4		NS CSA	96
rs12722576^1,2	C,F,H,	--	5993247(-)	`NNNNGG/TCCCTG`	1	--	int¹		7		NS EA NA	620
rs12722575^1,2	C,F,	--	5993291(-)	`GTTTCG/ATATTT`	1	--	int¹		5		NS NA	212
rs12722689^1,2	F	--	5993416(-)	`GGCATA/GCACAG`	1	--	int¹		2		NS	86
rs12722573^1,2	C,F	--	5993446(-)	`acatgA/Gcatac`	1	--	int¹		3		NS EU	384
rs35151118^1,2	C,	--	5993608(-)	`GATGGC/TGTCTC`	1	--	int¹		1		EU	276
rs12722572^1,2	C,F,	--	5994017(-)	`ggtgtA/C/Gcacca`	1	--	int¹		3		NS NA	88
rs12722688^1,2	C,F,	--	5994063(-)	`TTCAAG/ATGAAT`	1	--	int¹		3		NS CSA	88
rs12722571^1,2	C,F,	--	5994266(-)	`tcaccA/Gtgttg`	1	--	int¹		2		NS	82
rs56096118^1,2	C,	--	5994955(+)	`AAAGCA/CACTAA`	1	--	int¹		0	--	--	--	--
rs12722686^1,2	C,F,H,	--	5995173(-)	`CCTCAA/GTTAAA`	1	--	int¹		6		NS EA	504
rs11595586^1,2	C,F,H	--	5995188(+)	`AAATAT/CGTCTG`	1	--	int¹		5		NS EA NA	418
rs12722567^1,2	C,F,H,	--	5995252(-)	`AATGGC/TGCACA`	1	--	int¹		9		NS EA NA	514
rs12722566^1,2	H	--	5995296(-)	`TTTGCC/GAGACA`	1	--	int¹		6		NS EA	510
rs12722685^1,2	C,F,	--	5995332(-)	`GAGGTG/AGGCAG`	1	--	int¹		4		NS CSA WA	214
rs12253789^1,2	C,	--	5995340(+)	`CTCTGA/TGTTCA`	1	--	int¹		4		NS NA	98
rs12722683^1,2	H	--	5995497(-)	`GTAGGC/GAATGG`	1	--	int¹		6		NS EA	494
rs114552450^1,2	C,F,	--	5995573(+)	`GAAGTG/AGACGG`	1	--	int¹		1		WA	118
rs12722565^1,2	C,F,	--	5995878(-)	`cttggC/Tctccc`	1	--	int¹		2		NS	94
rs41294695^1,2		--	5996068(-)	`GATCTC/TGGCCC`	1	--	int¹		0	--	--	--	--
rs12722563^1,2	C,F,H,	--	5996391(-)	`TATTAC/TAGCAC`	1	--	int¹		9		NS EA NA	602
rs12722682^1,2	C,F,H,	--	5996727(-)	`GTCTTC/TACTGG`	1	--	int¹		6		NS EA	474
rs12722560^1,2	C,F,H,	--	5996963(-)	`CCActC/Ttgctt`	1	--	int¹		9		NS EA NA	516
rs75578321^1,2		--	5996988(+)	`CATGAC/TTGGGA`	1	--	int¹		1		NA	120
rs12722681^1,2	C,F,H,	--	5997035(-)	`TGGGGC/TGACCT`	1	--	int¹		6		NS EA	510
rs12722558^1,2	C,F,	--	5997106(-)	`TGAGTT/ACTGCC`	1	--	int¹		6		NS NA	218
rs12722557^1,2	C,	--	5997238(-)	`GGGATG/ACCTCT`	1	--	int¹		5		NS NA	216
rs12722680^1,2	C,H,	--	5997275(-)	`TAAGGG/CCAGGT`	1	--	int¹		6		NS EA	478
rs12722556^1,2	C,F,	--	5997369(-)	`CTTATG/TGTCCT`	1	--	int¹		12		NS NA WA	976
rs41294699^1,2		--	5997370(-)	`TCTTAT/CGGTCC`	1	--	int¹		1		NA	120
rs79675038^1,2	F,	--	5997497(+)	`TAGAAA/GCAGAC`	1	--	int¹		1		EA	120
rs113179360^1,2		--	5997511(+)	`TAAAAC/TTGGGT`	1	--	int¹		1		CSA	2
rs113815153^1,2		--	5997852(+)	`AAACAG/CTTGTA`	1	--	int¹		2		CSA WA	120
rs117715035^1,2	C,F,	--	5997855(+)	`NNNNTG/ATAATT`	1	--	int¹		1		NA	120
rs12722678^1,2	C,F,	--	5997982(-)	`ACAAGA/CGCGAA`	1	--	int¹		2		NS	86
rs12722552^1,2	C,F,	--	5998169(-)	`agttcG/Aagacc`	1	--	int¹		3		NS CSA	88
rs12257077^1,2	F,	--	5998367(+)	`aacatC/Tgccag`	1	--	int¹		2		WA NA	238
rs77894868^1,2	F,	--	5998385(+)	`AAAATA/GTTTAC`	1	--	int¹		1		WA	118
rs12722549^1,2	C,F,	--	5998630(-)	`tgcccG/Ataatc`	1	--	int¹		3		NS WA	198
rs12722548^1,2	C,H,	--	5998868(-)	`tctatT/Cgattt`	1	--	int¹		6		NS EA	492
rs12722547^1,2	C,F,	--	5998915(-)	`aggtcC/Gattct`	1	--	int¹		5		NS NA	216
rs12722677^1,2	C,	--	5999129(-)	`GCTACG/AATGTA`	1	--	int¹		2		NS	90
rs41294703^1,2	F,	--	5999302(-)	`GTTGAC/TGGGTT`	1	--	int¹		1		NA	120
rs12722676^1,2	C,	--	5999490(-)	`ATTTAC/TGTGTT`	1	--	int¹		2		NS	90
rs12722543^1,2	C,F,	--	5999582(-)	`agaacC/Acacca`	1	--	int¹		5		NS NA	214
rs116082879^1,2	C,F,	--	5999978(+)	`AACAGC/TAGGGC`	1	--	int¹		1		WA	118
rs12722675^1,2	C,	--	6000147(-)	`ATCTGA/CGAATA`	1	--	int¹		2		NS	92
rs7068397^1,2	C,A,H	--	6000273(+)	`tatatA/Gtatat`	1	--	int¹		0	--	--	--	--
rs12722674^1,2	C,F,	--	6000740(-)	`TACTAC/TGCTGC`	1	--	int¹		4		NS CSA WA	212
rs12722539^1,2	C,F,	--	6000917(-)	`GTGAG-/TTTTTT`	1	--	int¹ trp³		6		NS NA CSA	102
rs12722672^1,2	C,	--	6001263(-)	`GTGTTA/GGCCAG`	1	--	int¹		2		NS	90
rs41294705^1,2		--	6001325(-)	`CAGGCA/GCACAC`	1	--	int¹		0	--	--	--	--
rs78824424^1,2	F,	--	6001848(+)	`TGAAAG/ATATTT`	1	--	int¹		1		WA	118
rs11596299^1,2	H	--	6001895(+)	`ctttaG/Tgaggc`	1	--	int¹		0	--	--	--	--
rs7914699^1,2	C,F,A,	--	6001944(+)	`cagccC/Tggtca`	1	--	int¹		4		NA NS WA	212
rs41294707^1,2		--	6001980(-)	`CTCTGA/CCTCCT`	1	--	int¹		0	--	--	--	--
rs12722534^1,2	C,F,	--	6002007(-)	`agtggC/Tgtgat`	1	--	int¹		2		NS	92
rs12722670^1,2	C,F,	--	6002051(-)	`TGTTTT/CTGAGA`	1	--	int¹		4		NS WA CSA	96
rs12259475^1,2	C,H,	--	6002189(+)	`gggatG/Atgtct`	1	--	int¹		8		NS EA NA	494
rs12722668^1,2	C,F,	--	6002292(-)	`ATTATT/GGAGTT`	1	--	int¹		3		NS WA	212
rs12722667^1,2	C,F,	--	6002728(-)	`CAATCC/TTGGTT`	1	--	int¹		4		NS CSA WA	214
rs76060004^1,2		--	6002794(+)	`ACACAC/TCAATT`	1	--	int¹		0	--	--	--	--
rs12722531^1,2	C,F,H,	--	6002872(-)	`NNNNAC/TGCACT`	1	--	int¹		9		NS EA NA CSA WA	602
rs12722530^1,2	C,F	--	6003202(-)	`AAAAA-/ATCCCA`	1	--	int¹ trp³		3		NS CSA	94
rs12722666^1,2	C,H,	--	6003377(-)	`CTTAAA/GAAATA`	1	--	int¹		6		NS EA WA	484
rs74326473^1,2		--	6004084(+)	`CCTGCC/TTTCAT`	1	--	int¹		0	--	--	--	--
rs80305283^1,2	F,	--	6004238(+)	`CTCTCC/ACTTTG`	1	--	int¹		1		WA	118
rs12722664^1,2	C,F,	--	6004347(-)	`AGCCCC/TGATTT`	1	--	int¹		3		NS WA	210
rs79716686^1,2		--	6004541(+)	`TGAGCA/GTGTTT`	1	--	int¹		0	--	--	--	--
rs12722663^1,2	C,F,	--	6004556(-)	`CCAACG/AGAAGA`	1	--	int¹		7		NS NA WA CSA	220
rs12722526^1,2	C,F,	--	6004557(-)	`TCCAAC/TGGAAG`	1	--	int¹		5		NS NA EA	218
rs12722525^1,2	C,F,	--	6004616(-)	`AAGGAC/TGAGGA`	1	--	int¹		5		NS NA WA	334
rs12722662^1,2	C,F,	--	6004630(-)	`GAGGTG/AAGGTG`	1	--	int¹		3		NS WA	212
rs12722524^1,2	C,	--	6004666(-)	`ATACAC/ACCATG`	1	--	int¹		4		NS NA	98
rs6602391^1,2	C,F,A,H,	--	6004828(+)	`TCTGGG/AAGAAC`	1	--	int¹		23		NS EA NA CSA WA	2630
rs12722661^1,2	C,	--	6005133(-)	`TAGAAG/CCTGCA`	1	--	int¹		5		NS NA WA	214
rs6602393^1,2	C,F,A,H,	--	6005200(+)	`TTCCGC/TGTCAC`	1	--	int¹		13		NS EA NA CSA WA	1296
rs12722660^1,2	F	--	6005270(-)	`TGTTTGTTT/- TGTTT`	1	--	int¹		2		NS	92
rs6602394^1,2	C,F,A,	--	6005337(+)	`AGCGGC/TTCTTC`	1	--	int¹		4		NS CSA WA	212
rs12722522^1,2	C,F,	--	6005349(-)	`TTCCAC/TGTCAG`	1	--	int¹		4		NS NA WA	212
rs12722658^1,2	C,	--	6005560(-)	`TGTCCG/ACTCTC`	1	--	int¹		3		NS WA	204
rs12722521^1,2	C,F,H,	--	6005592(-)	`CCAACC/TGGGAT`	1	--	int¹		8		NS NA WA	532
rs12722520^1,2	C,F,	--	6005948(-)	`AATGAC/TGTTTC`	1	--	int¹		12		NS NA WA	986
rs41294711^1,2		--	6006279(-)	`CGTGCA/GTTATT`	1	--	int¹		0	--	--	--	--
rs12722656^1,2	C,H,	--	6006291(-)	`TTTCCT/GGTGCT`	1	--	int¹		6		NS EA	498
rs80082229^1,2		--	6006371(+)	`TAAAGA/TGGGAT`	1	--	int¹		0	--	--	--	--
rs12722519^1,2	C,F,H,	--	6006445(-)	`AGATTC/TGGGTC`	1	--	int¹		9		NS EA NA	606
rs74401337^1,2		--	6006769(+)	`AAAGGA/GATGTA`	1	--	int¹		0	--	--	--	--
rs112366598^1,2		--	6006844(+)	`CCAACC/TTCTAC`	1	--	int¹		1		CSA	2
rs28360481^1,2		--	6006989(-)	`AAGCAC/TGCTCC`	1	--	int¹		0	--	--	--	--
rs77798566^1,2	F,	--	6007292(+)	`ATTAAG/ATAAGT`	1	--	int¹		1		WA	118
rs12722518^1,2	C,F,H,	--	6007433(-)	`CTTTGT/GGCGCA`	1	--	int¹		18		NS EA NA WA CSA	1406
rs12722655^1,2	C,F,H,	--	6007483(-)	`TTGCCT/CCCACA`	1	--	int¹		7		NS EA WA	618
rs12722516^1,2	C,F,H,	--	6008013(-)	`ACACAT/CATAGC`	1	--	int¹		9		NS EA NA	600
rs111937155^1,2		--	6008510(+)	`TAACAT/CGAAAT`	1	--	int¹		1		CSA	1
rs12722654^1,2	C,H,	--	6008837(-)	`ATACCC/TTCACG`	1	--	int¹		6		NS EA	468
rs12722653^1,2	C,F,H,	--	6008886(-)	`TTCAAT/CGTCAC`	1	--	int¹		7		NS EA CSA WA	510
rs7475086^1,2	A,H	--	6009071(+)	`AATTCA/GTATTC`	1	--	int¹		4		NS EA	418
rs12722652^1,2	C,F,H,	--	6009225(-)	`TGACTG/AGAAAT`	1	--	int¹		12		NS EA WA	1142
rs12722651^1,2	C,	--	6009308(-)	`TAAATT/AATATA`	1	--	int¹		2		NS	92
rs11256464^1,2	C,F,	--	6009354(+)	`ATTTGC/TGATAC`	1	--	int¹		12		NS NA	876
rs202052241^1,2	C	--	6009875(+)	`TAATTC/TTTTTT`	1	--	int¹		0	--	--	--	--
rs12722650^1,2	C,	--	6010078(-)	`GCTAAC/TACAGT`	1	--	int¹		2		NS	86
rs79967681^1,2	F	--	6010606(+)	`TTTTCC/ACAGAT`	1	--	int¹		1		NA	4
rs12355383^1,2	H	--	6010709(+)	`TAGCTA/CCAATA`	1	--	int¹		4		NS EA	418
rs79059692^1,2	F	--	6010764(+)	`TTATTC/TTGGAA`	1	--	int¹		1		NA	4
rs12722649^1,2	C,F,,	--	6010819(-)	`CACCTT/CATCAA`	1	--	int¹		4		NS NA	96
rs12355397^1,2	F,H	--	6010883(+)	`TTTGCA/CCCTGA`	1	--	int¹		5		NS EA NA	398
rs11256476^1,2	H	--	6010993(+)	`CGTTAG/AAAAAT`	1	--	int¹		4		NS EA	412
rs11256477^1,2	H	--	6011037(+)	`AGGAAG/AAAAAC`	1	--	int¹ trp³		4		NS EA	410
rs11256478^1,2	H	--	6011071(+)	`AAGAAG/AAGCAT`	1	--	int¹		4		NS EA	400
rs12722647^1,2	H	--	6011321(-)	`TTATTC/TCTCTA`	1	--	int¹		6		NS EA	500
rs12243643^1,2	C,F,H,	--	6011420(+)	`gtatcC/Tgtaat`	1	--	int¹		19		NS EA NA CSA WA	1904
rs74458978^1,2	F,	--	6011934(+)	`AACTCT/CGTATT`	1	--	int¹		1		EA	120
rs41294719^1,2	C,	--	6012039(-)	`TACTGT/CTTCTA`	1	--	int¹		3		WA NA	240
rs12722512^1,2	C,F,	--	6012452(-)	`gtagaT/Acacct`	1	--	int¹		2		NS	90
rs12722511^1,2	C	--	6012965(-)	`ggctcG/Acttgt`	1	--	int¹		4		NS NA	98
rs12722646^1,2	C,F,	--	6012977(-)	`GCCCCA/CCCTCG`	1	--	int¹		3		NS WA	212
rs12722510^1,2	C,F,H,	--	6013023(-)	`cccctG/Aaattc`	1	--	int¹		8		NS EA NA	626
rs7896551^1,2	C,F,H,	--	6013145(+)	`agagaG/Ctagta`	1	--	int¹		13		NS EA NA CSA WA	1304
rs12722645^1,2	C,F,H,	--	6013698(-)	`GTTTGC/TTTGAA`	1	--	int¹		17		NS EA NA WA	1732
rs75759207^1,2		--	6013897(+)	`TCTCCA/GAGCAC`	1	--	int¹		0	--	--	--	--
rs80037754^1,2		--	6014042(+)	`TAAGAC/TCCTTT`	1	--	int¹		1		NA	120
rs12722644^1,2	C,	--	6014178(-)	`CTTGTA/GGGGGT`	1	--	int¹		3		NS WA	212
rs12722643^1,2	H	--	6014214(-)	`CTGAGG/ATCCCA`	1	--	int¹		6		NS EA	514
rs11256493^1,2	H	--	6014281(+)	`TCGGTC/TGACAA`	1	--	int¹		4		NS EA	418
rs12722642^1,2	H	--	6014437(-)	`TGGTTT/CTAAAG`	1	--	int¹		6		NS EA	496
rs7921824^1,2	C,F,H,	--	6014641(+)	`CTTGAC/GAAGAG`	1	--	int¹		7		NS EA WA	616
rs75103865^1,2		--	6014886(+)	`ATCTCG/ACAGGG`	1	--	int¹		1		WA	118
rs78196520^1,2		--	6015143(+)	`GTTCAA/GTAGAG`	1	--	int¹		0	--	--	--	--
rs12722641^1,2	C,F,H,	--	6015545(-)	`CTATCA/GGAGAT`	1	--	int¹		15		NS EA NA WA CSA	1402
rs12722508^1,2	C,F,	--	6015555(-)	`CCCACT/AGAAAC`	1	--	int¹		4		NS NA	206
rs12722507^1,2	C,	--	6016002(-)	`GGGGTT/AGTTCC`	1	--	int¹		4		NS NA	98
rs12722640^1,2	C,F,H,	--	6016104(-)	`TTCATC/TCCGCG`	1	--	int¹		23		NS EA NA CSA WA	2370
rs12722506^1,2	C,	--	6016207(-)	`AAGAGC/TTTTGG`	1	--	int¹		4		NS NA	98
rs12722505^1,2	C,F,	--	6016208(-)	`GAAGAG/TCTTTG`	1	--	int¹		5		NS NA	218
rs7909519^1,2	C,F,	--	6016653(+)	`AAAATT/GATTAC`	1	--	int¹		6		NS NA	218
rs12722638^1,2	H	--	6016822(-)	`TGTGCG/ATAAGA`	1	--	int¹		6		NS EA	502
rs12722637^1,2	H	--	6016923(-)	`GCATGA/GCGGGC`	1	--	int¹		6		NS EA	504
rs7089386^1,2	C,F,H,	--	6017056(+)	`GTGCAT/CGGAGG`	1	--	int¹		12		NS EA NA WA CSA	633
rs7089855^1,2	C,F,A,H,	--	6017952(+)	`GGAGCA/GGAGGG`	1	--	int¹		7		EA NS NA	512
rs7907895^1,2	C,	--	6018387(+)	`GCCTCC/TGGGAC`	1	--	int¹		3		NS WA	208
rs12722636^1,2	C,F,	--	6018457(-)	`GAGTGC/GCGTGT`	1	--	int¹		4		NS WA	214
rs41294907^1,2	C,F,	--	6018695(-)	`GAACAC/ACNNNN`	1	--	int¹		1		NA	120
rs2246031^1,2	C,F,H,	--	6019022(+)	`TGTGTC/TGGCCT`	1	--	int¹		26		NS EA NA WA	3080
rs112720474^1,2		--	6019288(+)	`ATGGGG/ACATGC`	1	--	int¹		2		CSA WA	120
rs5782869^1,2	C,F	--	6019832(+)	`CCAACT/-TTTTT`	1	--	int¹ trp³		2		NA	4
rs12722502^1,2	C,F,	--	6019950(-)	`CTTCCG/AGTCCT`	1	--	int¹		10		NS NA	878
rs7916686^1,2	C	--	6020294(+)	`tttttC/Tttttt`	1	--	int¹ trp³		0	--	--	--	--
rs112378888^1,2		--	6020501(+)	`CAGCTA/GTTCTC`	1	--	int¹		1		CSA	1
rs12722634^1,2	C,F,	--	6021005(-)	`AGAGCG/ATTGTT`	1	--	int¹		3		NS WA	212
rs78633484^1,2	F,	--	6021088(+)	`CAGGGG/ATAATG`	1	--	int¹		3		CSA WA	122
rs12722501^1,2	C,F,	--	6021432(-)	`GGGGGG/-CGCGT`	1	--	int¹		4		NS NA CSA	86
rs113857728^1,2		--	6021433(+)	`CGCGCC/TCCCCC`	1	--	int¹		0	--	--	--	--
rs79496268^1,2	C,F,	--	6021506(+)	`GCAGCG/AGNNNN`	1	--	int¹		1		NA	120
rs61839660^1,2	C,	--	6021524(+)	`NNNNTC/TTATTT`	1	--	int¹		2		NA	122
rs12722500^1,2	C,F,	--	6021680(-)	`TGGGG-/GCATCT`	1	--	int¹		4		NS NA CSA	86
rs41294913^1,2	C,F,	--	6021785(-)	`NNNNCG/AGCCTC`	1	--	int¹		1		NA	120
rs112865138^1,2		--	6021817(+)	`CACGCA/GGCTCT`	1	--	int¹		0	--	--	--	--
rs41294915^1,2		--	6022239(-)	`AGCTTG/TGTTCC`	1	--	int¹		1		CSA	2
rs12722499^1,2	C	--	6022260(-)	`CTTTCG/ATTCTT`	1	--	int¹		4		NS NA	90
rs11595600^1,2	C,F,A,H,	--	6022285(+)	`AGTATC/TGGAGT`	1	--	int¹		4		NS NA	90
rs41294917^1,2	C,	--	6022317(-)	`AACATG/CACTGG`	1	--	int¹		2		NA	122
rs12722631^1,2	C,	--	6022740(-)	`ATGAGC/GTCGCT`	1	--	int¹		2		NS	92
rs12722497^1,2	C,F,H,	--	6022755(-)	`GGAAGG/TTGTGG`	1	--	int¹		11		NS EA NA	634
rs77351522^1,2		--	6023103(+)	`TGTGGA/CGGTAG`	1	--	int¹		0	--	--	--	--
rs111934333^1,2		--	6023434(+)	`TCCATG/TTACAC`	1	--	int¹		2		CSA WA	120
rs78184073^1,2		--	6023453(+)	`CAGCAC/TCACTA`	1	--	int¹		0	--	--	--	--
rs12722496^1,2	C,F,	--	6023494(-)	`GGTTCT/CGAATA`	1	--	int¹		10		NS NA	878
rs12722630^1,2	C,F,	--	6023620(-)	`AATATT/CGATCA`	1	--	int¹		3		NS WA	212
rs12722629^1,2	C,F,	--	6023636(-)	`AATCTG/AGGAAA`	1	--	int¹		2		NS	94
rs12722628^1,2	C,F,	--	6023674(-)	`CTCTGC/TCTCTT`	1	--	int¹		2		NS	94
rs79196724^1,2	F,	--	6023967(+)	`TGCTCC/TGTGAC`	1	--	int¹		1		WA	118
rs12722495^1,2	C,F,	--	6024110(-)	`TCCAAA/GTCGCA`	1	--	int¹		4		NS NA	216
rs60265533^1,2	C,	--	6024975(+)	`CAGGAG/CCTGAA`	1	--	int¹		1		WA	2
rs12722493^1,2	C,	--	6025121(-)	`GTTTTA/GCATGA`	1	--	int¹		4		NS NA	212
rs12722625^1,2	C,F,	--	6025400(-)	`AGGCAT/CAGATA`	1	--	int¹		3		NS WA	212
rs12722624^1,2	C,F,	--	6025453(-)	`TGAGCG/AACATA`	1	--	int¹		9		NS WA	836
rs41294921^1,2		--	6025493(-)	`TCTCTC/GATGCC`	1	--	int¹		0	--	--	--	--
rs41294923^1,2		--	6025637(-)	`AGCCTC/GATGTC`	1	--	int¹		0	--	--	--	--
rs12722623^1,2	C,F,	--	6026215(-)	`GTCTCA/C/GAACTC`	1	--	int¹		3		NS WA	94
rs12722622^1,2	C,F,H,	--	6026468(-)	`TAAAGC/TCTTGG`	1	--	int¹		15		NS EA NA WA	1658
rs12722621^1,2	C,F,H,	--	6027502(-)	`GTCATG/TAGGCT`	1	--	int¹		15		NS EA NA WA	1170
rs12722620^1,2	H	--	6027739(-)	`TTCTAT/CGTGCC`	1	--	int¹		6		NS EA	492
rs12722491^1,2	C,	--	6027759(-)	`ACTACC/AATTTA`	1	--	int¹		4		NS NA	204
rs76665316^1,2		--	6027853(+)	`CCAGGG/ACCCAG`	1	--	int¹		1		NA	120
rs41294925^1,2		--	6027882(-)	`GGCATT/CAGGCA`	1	--	int¹		1		NA	120
rs12722490^1,2	C,F,	--	6028120(-)	`TCTACG/AGNNNN`	1	--	int¹		8		NS NA	354
rs11597542^1,2	C,H	--	6028273(+)	`ATAGAC/TGTTGA`	1	--	int¹		0	--	--	--	--
rs11596703^1,2	C,F,H	--	6029010(+)	`cgccaC/Atgcac`	1	--	int¹		1		NA	6
rs11596705^1,2	H	--	6029022(+)	`ccagcA/Ctgggc`	1	--	int¹		0	--	--	--	--
rs73605917^1,2	C,	--	6029122(+)	`CATCTG/TGGCCA`	1	--	int¹		1		WA	2
rs11817447^1,2	C,H,	--	6029496(+)	`ggcaaC/Tatggc`	1	--	int¹		0	--	--	--	--
rs2209106^1,2		--	6029515(+)	`catctC/G/Ttacaa`	1	--	int¹		0	--	--	--	--
rs41294931^1,2	F,	--	6029594(-)	`CTTAGC/TGATCC`	1	--	int¹		1		EA	120
rs12722487^1,2	C,F,	--	6029830(-)	`CTTTAC/TAGAAA`	1	--	int¹		5		NS NA	218
rs12722618^1,2	C,F,H,	--	6029963(-)	`TTGCTG/AGAGAC`	1	--	int¹		6		NS EA	504
rs12722486^1,2	C,F,H,	--	6030091(-)

Advanced Search

Export list of displayed genes

IL2RA Gene

interleukin 2 receptor, alpha

Aliases
for IL2RA gene

Summaries
for IL2RA gene

Genomic Views
for IL2RA gene

Proteins
for IL2RA gene

Protein Domains /
Families
for IL2RA gene

Function
for IL2RA gene

Pathways & Interactions
for IL2RA gene

Drugs & Compounds
for IL2RA gene

Transcripts
for IL2RA gene

Expression
for IL2RA gene

Orthologs
for IL2RA gene

Paralogs
for IL2RA gene

Genomic Variants
for IL2RA gene

Advanced Search

Export list of displayed genes

IL2RA Gene

interleukin 2 receptor, alpha

Aliasesfor IL2RA gene

Summariesfor IL2RA gene

Genomic Viewsfor IL2RA gene

Proteinsfor IL2RA gene

Protein Domains /Familiesfor IL2RA gene

Functionfor IL2RA gene

Pathways & Interactionsfor IL2RA gene

Drugs & Compoundsfor IL2RA gene

Transcriptsfor IL2RA gene

Expression for IL2RA gene

Orthologsfor IL2RA gene

Paralogsfor IL2RA gene

Genomic Variantsfor IL2RA gene

Aliases
for IL2RA gene

Summaries
for IL2RA gene

Genomic Views
for IL2RA gene

Proteins
for IL2RA gene

Protein Domains /
Families
for IL2RA gene

Function
for IL2RA gene

Pathways & Interactions
for IL2RA gene

Drugs & Compounds
for IL2RA gene

Transcripts
for IL2RA gene

Expression
for IL2RA gene

Orthologs
for IL2RA gene

Paralogs
for IL2RA gene

Genomic Variants
for IL2RA gene