Free for academic non-profit institutions. Other users need a Commercial license

Aliases for IL17RA Gene

Aliases for IL17RA Gene

  • Interleukin 17 Receptor A 2 3 5
  • IL-17 Receptor A 3 4
  • IL-17RA 3 4
  • CDw217 3 4
  • IL17R 3 4
  • Interleukin-17 Receptor A 3
  • Interleukin 17 Receptor 2
  • CD217 Antigen 4
  • HIL-17R 3
  • CANDF5 3
  • CD217 3
  • IMD51 3

External Ids for IL17RA Gene

Previous HGNC Symbols for IL17RA Gene

  • IL17R

Previous GeneCards Identifiers for IL17RA Gene

  • GC22P015947
  • GC22P017565
  • GC22P001385

Summaries for IL17RA Gene

Entrez Gene Summary for IL17RA Gene

  • Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]

GeneCards Summary for IL17RA Gene

IL17RA (Interleukin 17 Receptor A) is a Protein Coding gene. Diseases associated with IL17RA include Immunodeficiency 51 and Chronic Mucocutaneous Candidiasis. Among its related pathways are Cytokine Signaling in Immune system and Akt Signaling. Gene Ontology (GO) annotations related to this gene include interleukin-17 receptor activity. An important paralog of this gene is IL17RD.

UniProtKB/Swiss-Prot for IL17RA Gene

  • Receptor for IL17A (PubMed:17911633, PubMed:9367539). Receptor for IL17F (PubMed:19838198, PubMed:17911633). Binds to IL17A with higher affinity than to IL17F (PubMed:17911633). Binds IL17A and IL17F homodimers as part of a heterodimeric complex with IL17RC (PubMed:16785495). Also binds heterodimers formed by IL17A and IL17F as part of a heterodimeric complex with IL17RC (PubMed:18684971). Receptor for IL17C as part of a heterodimeric complex with IL17RE (PubMed:21993848). Activation of IL17RA leads to induction of expression of inflammatory chemokines and cytokines such as CXCL1, CXCL8/IL8 and IL6 (PubMed:16785495, PubMed:17911633, PubMed:18684971).

Gene Wiki entry for IL17RA Gene

Additional gene information for IL17RA Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for IL17RA Gene

Genomics for IL17RA Gene

GeneHancer (GH) Regulatory Elements for IL17RA Gene

Promoters and enhancers for IL17RA Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH22I017084 Promoter/Enhancer 2.4 EPDnew FANTOM5 Ensembl ENCODE dbSUPER 558.1 +1.3 1333 4.3 HDGF PKNOX1 SIN3A DMAP1 IRF4 POLR2B ZNF143 ZNF263 SP3 REST IL17RA CECR7 ENSG00000273203 ADA2 CECR2 RPL31P62
GH22I017120 Promoter/Enhancer 1.9 EPDnew Ensembl ENCODE 15.7 +36.4 36393 1.5 ZSCAN4 KLF17 ZNF76 SIN3A GLI4 ZNF335 GLIS2 ZNF366 ZNF143 EGR2 LINC01664 TMEM121B IL17RA GC22P017113
GH22I017106 Enhancer 0.9 Ensembl ENCODE dbSUPER 12.6 +21.9 21947 1.8 CTCF POLR2A REST MYC IL17RA TMEM121B GC22P017113 RPL31P62
GH22I017170 Enhancer 1.5 FANTOM5 Ensembl ENCODE 7.5 +87.0 86970 2.3 HDGF ARNT SIN3A ZNF2 YY1 CBX5 E2F8 ZNF207 ZNF143 SP3 IL17RA HDHD5 RPL32P5
GH22I017101 Enhancer 0.6 Ensembl dbSUPER 13.8 +16.5 16498 0.9 ZBTB33 ZIC2 ZBTB17 IL17RA RPL31P62 GC22P017113
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around IL17RA on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the IL17RA gene promoter:

Genomic Locations for IL17RA Gene

Genomic Locations for IL17RA Gene
30,741 bases
Plus strand

Genomic View for IL17RA Gene

Genes around IL17RA on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
IL17RA Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for IL17RA Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for IL17RA Gene

Proteins for IL17RA Gene

  • Protein details for IL17RA Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Interleukin-17 receptor A
    Protein Accession:
    Secondary Accessions:
    • O43844
    • Q20WK1

    Protein attributes for IL17RA Gene

    866 amino acids
    Molecular mass:
    96122 Da
    Quaternary structure:
    • Forms heterodimers with IL17RE; the heterodimer binds IL17C (PubMed:21993848). Forms heterodimers with IL17RC; the heterodimer binds IL17A and IL17F homodimers as well as the heterodimer formed by IL17A and IL17F (PubMed:16785495, PubMed:18684971).

    Three dimensional structures from OCA and Proteopedia for IL17RA Gene

    Alternative splice isoforms for IL17RA Gene


neXtProt entry for IL17RA Gene

Post-translational modifications for IL17RA Gene

  • Glycosylated.
  • Glycosylation at posLast=4949, posLast=5454, posLast=6767, posLast=206206, posLast=225225, isoforms=2242, and posLast=265265

Other Protein References for IL17RA Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

  • R&D Systems Antibodies for IL17RA (IL-17 RA/IL-17 R)
  • Cell Signaling Technology (CST) Antibodies for IL17RA (IL17RA)

No data available for DME Specific Peptides for IL17RA Gene

Domains & Families for IL17RA Gene

Gene Families for IL17RA Gene

Human Protein Atlas (HPA):
  • CD markers
  • Disease related genes
  • Predicted membrane proteins
  • Predicted secreted proteins

Protein Domains for IL17RA Gene


Suggested Antigen Peptide Sequences for IL17RA Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with IL17RA: view

No data available for UniProtKB/Swiss-Prot for IL17RA Gene

Function for IL17RA Gene

Molecular function for IL17RA Gene

UniProtKB/Swiss-Prot Function:
Receptor for IL17A (PubMed:17911633, PubMed:9367539). Receptor for IL17F (PubMed:19838198, PubMed:17911633). Binds to IL17A with higher affinity than to IL17F (PubMed:17911633). Binds IL17A and IL17F homodimers as part of a heterodimeric complex with IL17RC (PubMed:16785495). Also binds heterodimers formed by IL17A and IL17F as part of a heterodimeric complex with IL17RC (PubMed:18684971). Receptor for IL17C as part of a heterodimeric complex with IL17RE (PubMed:21993848). Activation of IL17RA leads to induction of expression of inflammatory chemokines and cytokines such as CXCL1, CXCL8/IL8 and IL6 (PubMed:16785495, PubMed:17911633, PubMed:18684971).

Phenotypes From GWAS Catalog for IL17RA Gene

Gene Ontology (GO) - Molecular Function for IL17RA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 receptor binding IEA --
GO:0005515 protein binding IPI 21993848
GO:0030368 interleukin-17 receptor activity NAS 9367539
genes like me logo Genes that share ontologies with IL17RA: view
genes like me logo Genes that share phenotypes with IL17RA: view

Human Phenotype Ontology for IL17RA Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for IL17RA Gene

MGI Knock Outs for IL17RA:

Animal Model Products

Clone Products

  • R&D Systems cDNA Clones for IL17RA (IL-17 RA/IL-17 R)

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for IL17RA Gene

Localization for IL17RA Gene

Subcellular locations from UniProtKB/Swiss-Prot for IL17RA Gene

Isoform 1: Cell membrane; Single-pass type I membrane protein.
Isoform 2: Secreted.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for IL17RA gene
Compartment Confidence
plasma membrane 5
extracellular 5
nucleus 2
cytosol 2
endoplasmic reticulum 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for IL17RA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005886 plasma membrane TAS --
GO:0005887 integral component of plasma membrane NAS,IBA 9367539
GO:0016020 membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with IL17RA: view

Pathways & Interactions for IL17RA Gene

genes like me logo Genes that share pathways with IL17RA: view

SIGNOR curated interactions for IL17RA Gene

Is activated by:

Gene Ontology (GO) - Biological Process for IL17RA Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007166 cell surface receptor signaling pathway NAS 9367539
GO:0019221 cytokine-mediated signaling pathway IEA --
GO:0032747 positive regulation of interleukin-23 production IDA 21145111
GO:0050729 positive regulation of inflammatory response IEA --
GO:0050832 defense response to fungus IEA --
genes like me logo Genes that share ontologies with IL17RA: view

Drugs & Compounds for IL17RA Gene

(1) Drugs for IL17RA Gene - From: PharmGKB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Tumor necrosis factor alpha (TNF-alpha) inhibitors Pharma 0

(1) Additional Compounds for IL17RA Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with IL17RA: view

Transcripts for IL17RA Gene

Unigene Clusters for IL17RA Gene

Interleukin 17 receptor A:
Representative Sequences:

Clone Products

  • R&D Systems cDNA Clones for IL17RA (IL-17 RA/IL-17 R)

Alternative Splicing Database (ASD) splice patterns (SP) for IL17RA Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13
SP1: -
SP2: - - -
SP3: - -

Relevant External Links for IL17RA Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for IL17RA Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for IL17RA Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for IL17RA Gene

This gene is overexpressed in Whole Blood (x17.9).

Protein differential expression in normal tissues from HIPED for IL17RA Gene

This gene is overexpressed in Peripheral blood mononuclear cells (33.0), Testis (27.4), and Monocytes (7.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for IL17RA Gene

Protein tissue co-expression partners for IL17RA Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of IL17RA Gene:


SOURCE GeneReport for Unigene cluster for IL17RA Gene:


mRNA Expression by UniProt/SwissProt for IL17RA Gene:

Tissue specificity: Widely expressed.

Evidence on tissue expression from TISSUES for IL17RA Gene

  • Blood(4.5)
  • Intestine(2.1)
  • Lung(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for IL17RA Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
  • cardiovascular
  • digestive
  • endocrine
  • immune
  • integumentary
  • lymphatic
  • reproductive
  • respiratory
  • skeleton
Head and neck:
  • eye
  • eyelid
  • face
  • head
  • jaw
  • larynx
  • lip
  • mandible
  • maxilla
  • mouth
  • neck
  • pharynx
  • skull
  • tongue
  • tooth
  • esophagus
  • thymus
  • liver
  • spleen
  • vagina
  • digit
  • finger
  • foot
  • hand
  • lower limb
  • nail
  • toe
  • upper limb
  • blood
  • blood vessel
  • bone marrow
  • coagulation system
  • hair
  • red blood cell
  • skin
  • white blood cell
genes like me logo Genes that share expression patterns with IL17RA: view

Orthologs for IL17RA Gene

This gene was present in the common ancestor of chordates.

Orthologs for IL17RA Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia IL17RA 33 34
  • 99.34 (n)
(Canis familiaris)
Mammalia IL17RA 33 34
  • 79.28 (n)
(Bos Taurus)
Mammalia IL17RA 33 34
  • 77.17 (n)
(Mus musculus)
Mammalia Il17ra 33 16 34
  • 76.51 (n)
(Rattus norvegicus)
Mammalia Il17ra 33
  • 75.68 (n)
(Monodelphis domestica)
Mammalia IL17RA 34
  • 57 (a)
(Ornithorhynchus anatinus)
Mammalia IL17RA 34
  • 47 (a)
(Gallus gallus)
Aves IL17RA 33 34
  • 57.65 (n)
(Anolis carolinensis)
Reptilia IL17RA 34
  • 43 (a)
(Danio rerio)
Actinopterygii LOC561494 33
  • 46.21 (n)
BX942819.1 34
  • 35 (a)
IL17RA (1 of 4) 34
  • 31 (a)
il17ra2 34
  • 31 (a)
IL17RA (3 of 4) 34
  • 30 (a)
Species where no ortholog for IL17RA was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for IL17RA Gene

Gene Tree for IL17RA (if available)
Gene Tree for IL17RA (if available)

Paralogs for IL17RA Gene

Paralogs for IL17RA Gene

genes like me logo Genes that share paralogs with IL17RA: view

Variants for IL17RA Gene

Sequence variations from dbSNP and Humsavar for IL17RA Gene

SNP ID Clin Chr 22 pos Variation AA Info Type
rs1003943 likely-benign, Familial Candidiasis, Recessive 17,115,090(+) C/T 3_prime_UTR_variant
rs1003944 likely-benign, Familial Candidiasis, Recessive 17,115,076(+) C/T 3_prime_UTR_variant
rs1003945 likely-benign, Familial Candidiasis, Recessive 17,114,856(+) C/T 3_prime_UTR_variant
rs1047929 benign, Familial Candidiasis, Recessive 17,115,339(+) T/C 3_prime_UTR_variant
rs1057518744 pathogenic, Immunodeficiency 51 17,108,517(+) AGCAGGAGATGGTGGAGAGCA/AGCAGGAGATGGTGGAGAGCAGGAGATGGTGGAGAGCA coding_sequence_variant, frameshift

Structural Variations from Database of Genomic Variants (DGV) for IL17RA Gene

Variant ID Type Subtype PubMed ID
dgv4460n100 CNV gain 25217958
dgv729e201 CNV deletion 23290073
esv2723938 CNV deletion 23290073
esv2723939 CNV deletion 23290073
esv3361550 CNV duplication 20981092
esv3647204 CNV gain 21293372
esv3647208 CNV gain 21293372
nsv1062859 CNV loss 25217958
nsv1064641 CNV gain 25217958
nsv1067241 CNV loss 25217958
nsv509805 CNV insertion 20534489
nsv518600 CNV loss 19592680
nsv519563 CNV loss 19592680
nsv521478 CNV loss 19592680
nsv828923 CNV gain 20364138

Variation tolerance for IL17RA Gene

Residual Variation Intolerance Score: 92.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.97; 92.00% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for IL17RA Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for IL17RA Gene

Disorders for IL17RA Gene

MalaCards: The human disease database

(10) MalaCards diseases for IL17RA Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
immunodeficiency 51
  • imd51
chronic mucocutaneous candidiasis
  • cmc
adenosine deaminase 2 deficiency
  • sneddon syndrome
  • chronic nasopharyngitis
nasopharyngeal disease
  • nasopharyngeal diseases
- elite association - COSMIC cancer census association via MalaCards


  • Immunodeficiency 51 (IMD51) [MIM:613953]: A primary immunodeficiency disorder with altered immune responses and impaired clearance of fungal infections, selective against Candida. It is characterized by persistent and/or recurrent infections of the skin, nails and mucous membranes caused by organisms of the genus Candida, mainly Candida albicans. {ECO:0000269 PubMed:21350122}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for IL17RA

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with IL17RA: view

No data available for Genatlas for IL17RA Gene

Publications for IL17RA Gene

  1. Cutting edge: interleukin 17 signals through a heteromeric receptor complex. (PMID: 16785495) Toy D … Peschon J (Journal of immunology (Baltimore, Md. : 1950) 2006) 3 4 22 58
  2. Molecular characterization of the human interleukin (IL)-17 receptor. (PMID: 9367539) Yao Z … Armitage RJ (Cytokine 1997) 2 3 4 58
  3. Identification of a soluble isoform of human IL-17RA generated by alternative splicing. (PMID: 24084331) Sohda M … Oda K (Cytokine 2013) 3 4 58
  4. Chronic mucocutaneous candidiasis in humans with inborn errors of interleukin-17 immunity. (PMID: 21350122) Puel A … Casanova JL (Science (New York, N.Y.) 2011) 3 4 58
  5. IL-17C regulates the innate immune function of epithelial cells in an autocrine manner. (PMID: 21993848) Ramirez-Carrozzi V … Pappu R (Nature immunology 2011) 3 4 58

Products for IL17RA Gene

Sources for IL17RA Gene

Loading form....