Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

HERPUD2 Gene

protein-coding   GIFtS: 45
GCID: GC07M035672

HERPUD family member 2

 Explore 1 disease affiliated with
HERPUD2 via our new
 Human Malady Compendium 
Biological research products
for HERPUD2
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
HERPUD Family Member 21 2
FLJ223131
Homocysteine-Inducible, Endoplasmic Reticulum Stress-Inducible, Ubiquitin-Like
Domain Member 22
Homocysteine-Responsive Endoplasmic Reticulum-Resident Ubiquitin-Like Domain
Member 2 Protein2

External Ids:    HGNC: 219151   Entrez Gene: 642242   Ensembl: ENSG000001225577   UniProtKB: Q9BSE43   

Export aliases for HERPUD2 gene to outside databases

Previous GC identifer: GC07M035638


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4
Function: Could be involved in the unfolded protein response (UPR) pathway (By similarity)




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000007.13  NC_018918.1  NT_007819.17  NT_079592.2  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the HERPUD2 gene promoter:
         AML1a   AP-1   LCR-F1   E47   AREB6   POU2F1   NRF-2   FOXJ2 (long isoform)   POU2F1a   Hlf   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 3): HERPUD2 promoter sequence
   Search SABiosciences Chromatin IP Primers for HERPUD2

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat HERPUD2


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 7p14.2   Ensembl cytogenetic band:  7p14.2   HGNC cytogenetic band: 7p14.2

HERPUD2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
HERPUD2 gene location

GeneLoc information about chromosome 7         GeneLoc Exon Structure

GeneLoc location for GC07M035672:  view genomic region     (about GC identifiers)

Start:
35,672,269 bp from pter      End:
35,734,772 bp from pter
Size:
62,504 bases      Orientation:
minus strand

1 alternative location:
Chr7-,CRA_TCAG 35,711,081-35,772,820     

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4 (See protein sequence)
Recommended Name: Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein  
Size: 406 amino acids; 45147 Da
Subcellular location: Membrane; Single-pass membrane protein (Potential)
1 PDB 3D structure from and Proteopedia for HERPUD2:
2KDB (3D)    
Secondary accessions: A4D1Y8 Q9H6F9

Explore the universe of human proteins at neXtProt for HERPUD2: NX_Q9BSE4

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q9BSE4

  • HERPUD2 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_071768.3  
    ENSEMBL proteins: 
     ENSP00000379390   ENSP00000310729   ENSP00000415475   ENSP00000391015   ENSP00000412895  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: HERPUD2
    OriGene Protein Over-expression Lysate: HERPUD2
    OriGene Custom Protein Services for HERPUD2 
    GenScript Custom Purified and Recombinant Proteins Services for HERPUD2
    Novus Biologicals HERPUD2 Protein
    Novus Biologicals HERPUD2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for HERPUD2

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral to membrane IEA--


    HERPUD2 for ontologies           About GeneDecksing



    HERPUD2 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for HERPUD2 
    GenScript Custom Superior Antibodies Services for HERPUD2
    Novus Biologicals HERPUD2 Antibodies
    Search for Antibodies for HERPUD2 at Abcam  
    Uscn Antibodies for HERPUD2
    Search ThermoFisher Antibodies for HERPUD2

    Assay Products for HERPUD2: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for HERPUD2
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for HERPUD2


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    HERPUD2 for domains           About GeneDecksing

    2 InterPro domains/families:
     IPR000626 Ubiquitin
     IPR019955 Ubiquitin_supergroup

    Graphical View of Domain Structure for InterPro Entry Q9BSE4

    ProtoNet protein and cluster: Q9BSE4

    1 Blocks protein family: IPB000626 Ubiquitin domain

    UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4
    Similarity: Contains 1 ubiquitin-like domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4
    Function: Could be involved in the unfolded protein response (UPR) pathway (By similarity)

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: HERPUD2
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat HERPUD2
    8/32 QIAGEN miScript miRNA Assays for microRNAs that regulate HERPUD2 (see all 32):
    hsa-miR-4328 hsa-miR-548k hsa-miR-938 hsa-miR-1258 hsa-miR-25 hsa-miR-1244 hsa-miR-4325 hsa-miR-92b
    SwitchGear 3'UTR luciferase reporter plasmidHERPUD2 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for HERPUD2 (see all 7)
    OriGene shRNA RFP: HERPUD2
    OriGene siRNA: HERPUD2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat HERPUD2

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for HERPUD2

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for HERPUD2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for HERPUD2 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: HERPUD2 (NM_022373)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for HERPUD2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HERPUD2 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for HERPUD2
    Search LifeMap BioReagents cell lines for HERPUD2

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HERPUD2


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for HERPUD2

    STRING Interaction Network Preview (showing 1 interactants - click image to see more details)

    1 Interacting protein for HERPUD2 (ENSP000003107294) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ELAVL1ENSP000003852694STRING: ENSP00000385269
    About this table

    Gene Ontology (GO): 2 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006986response to unfolded protein IEA--
    GO:0007283spermatogenesis IEA--


    HERPUD2 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for HERPUD2
    Search CenterWatch for drugs/clinical trials and news about HERPUD2 / HERP2 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for HERPUD2 gene: 
    NM_022373.4  

    Unigene Cluster for HERPUD2:

    HERPUD family member 2
    Hs.744217  [show with all ESTs]
    Unigene Representative Sequence: NM_022373
    6 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000396081(uc003tet.3 uc003tes.4) ENST00000311350 ENST00000426180
    ENST00000438224 ENST00000413517 ENST00000427455

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: HERPUD2
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat HERPUD2
    8/32 QIAGEN miScript miRNA Assays for microRNAs that regulate HERPUD2 (see all 32):
    hsa-miR-4328 hsa-miR-548k hsa-miR-938 hsa-miR-1258 hsa-miR-25 hsa-miR-1244 hsa-miR-4325 hsa-miR-92b
    SwitchGear 3'UTR luciferase reporter plasmidHERPUD2 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for HERPUD2 (see all 7)
    OriGene shRNA RFP: HERPUD2
    OriGene siRNA: HERPUD2
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat HERPUD2
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for HERPUD2 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for HERPUD2 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: HERPUD2 (NM_022373)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for HERPUD2
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HERPUD2 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for HERPUD2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat HERPUD2
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat HERPUD2
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat HERPUD2

    Additional cDNA sequence: 

    AK025966.1 AK055708.1 AK315685.1 BC005091.1 BC020264.1 

    12 DOTS entries:

    DT.97795183  DT.100782307  DT.40281526  DT.100782305  DT.100798914  DT.95137486  DT.121068515  DT.95137504 
    DT.121068518  DT.121068539  DT.95137487  DT.300314 

    24/125 AceView cDNA sequences (see all 125):

    AI149048 AI038755 AI188449 BU186670 CA947069 BM046033 BQ647923 AW083690 
    CA947209 AI825051 AI968127 BQ887204 AW404965 AK025966 AI925032 BU159381 
    CA946984 AI055917 AI082596 BQ645273 BM352007 CD519249 AI303023 BC020264 

    GeneLoc Exon Structure

    5/8 Alternative Splicing Database (ASD) splice patterns (SP) for HERPUD2 (see all 8)    About this scheme

    ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b · 2c ^ 3 ^ 4 ^ 5a · 5b · 5c ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b · 9c
    SP1:                                                                                                                              
    SP2:                                -                                                                                             
    SP3:                                                                                                                              
    SP4:                                                        -     -                                                               
    SP5:                                                        -                                                                     


    ECgene alternative splicing isoforms for HERPUD2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    HERPUD2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TATCCCATCA

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See HERPUD2 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for HERPUD2

    SOURCE GeneReport for Unigene cluster: Hs.744217
        SABiosciences Custom PCR Arrays for HERPUD2
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for HERPUD2
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat HERPUD2
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat HERPUD2
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat HERPUD2
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HERPUD2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for HERPUD2 gene from 6/20 species (see all 20)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves HERPUD21 HERPUD family member 2 76.05(n)
    76.05(a)
      420742  XM_418840.3  XP_418840.1 
    lizard
    (Anolis carolinensis)
    Reptilia HERPUD26
    --
    74(a)
    1 ↔ 1
    6(46569993-46592516)
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC527152 hypothetical protein MGC52715 77.23(n)    BC044318.1 
    zebrafish
    (Danio rerio)
    Actinopterygii zgc560202 hypothetical protein MGC56020 77.88(n)   393157  BC045865.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Herp1 Homocysteine-induced endoplasmic reticulum protein 46.76(n)
    36.99(a)
      34065  NM_164772.1  NP_723316.1 
    worm
    (Caenorhabditis elegans)
    Secernentea tag-3536
    Temporarily Assigned Gene name family member (tag-...
    22(a)
    1 → many
    I(10401058-10402765)


    ENSEMBL Gene Tree for HERPUD2 (if available)
    TreeFam Gene Tree for HERPUD2 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for HERPUD2 gene
    HERPUD12  
    1 SIMAP similar gene for HERPUD2 using alignment to 4 protein entries:     HERP2_HUMAN (see all proteins):
    HERPUD1

    HERPUD2 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/1046 NCBI SNPs in HERPUD2 are shown (see all 1046    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 7 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs119770381,2
    H--35552658(+) atataA/Ttatat 1 -- ds50010--------
    rs119770391,2
    H--35552665(+) atataA/Tttata 1 -- ds50010--------
    rs1840054591,2
    --35671893(+) CATATA/TTATAT 1 -- ds50010--------
    rs2016617701,2
    --35671926(+) TAATC-/ATATATA 1 -- ds50010--------
    rs617180751,2
    C--35671946(+) ATATA-/AATCATATATATAATCA
    TATATATATAATCATATATA
    TATAT
    1 -- ds50011Minor allele frequency- AATCATATATATAATCATATATATATAATCATATATA:0.00NA 2
    rs14761941,2
    C,F,H,--35672030(+) ATTTGT/CTTTAT 1 -- ds500112Minor allele frequency- C:0.04NA EA NS 1404
    rs747309461,2
    F,--35672152(+) GGAATG/AGAAAG 1 -- ds50011Minor allele frequency- A:0.20EA 120
    rs1890829191,2
    --35672189(+) GCAACC/GCTTCC 1 -- ds50010--------
    rs1923382811,2
    --35672654(+) AGCTAC/TAGACA 1 -- ut310--------
    rs799854101,2
    --35672660(+) AGACAC/TTTATA 1 -- ut310--------

    HapMap Linkage Disequilibrium report for HERPUD2 (35672269 - 35734772 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for HERPUD2
         1 CNV: 0719

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing HERPUD2
    DNA2.0 Custom Variant and Variant Library Synthesis for HERPUD2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    HERPUD2 for disorders           About GeneDecksing

    1 disease for HERPUD2:    About MalaCards
    homocysteine

    Human Genome Epidemiology (HuGE) Navigator: HERPUD2 (1 document)

    Export disorders for HERPUD2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for HERPUD2 gene integrated from 9 sources:
    (articles sorted by number of sources associating them with HERPUD2)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    2. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    3. Coeliac disease associated risk variants in TNFAIP3 and REL implicate altered NF-{kappa}B signalling. (PubMed id 19240061)1 Trynka G....Wijmenga C. (2009)
    4. Ubiquitin-mediated proteolysis of HuR by heat shock. (PubMed id 19322201)1 Abdelmohsen K....Gorospe M. (2009)
    5. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (2007)
    6. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)1 Kimura K.... Sugano S. (2006)
    7. Human chromosome 7: DNA sequence and biology. (PubMed id 12690205)2 Scherer S.W.... Tsui L.-C. (2003)
    8. The DNA sequence of human chromosome 7. (PubMed id 12853948)2 Hillier L.W.... Wilson R.K. (2003)
    9. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 64224 HGNC: 21915 AceView: FLJ22313 Ensembl:ENSG00000122557 euGenes: HUgn64224
    ECgene: HERPUD2 H-InvDB: HERPUD2

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for HERPUD2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for HERPUD2 gene:
    Search GeneIP for patents involving HERPUD2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for HERPUD2  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for HERPUD2   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for HERPUD2  
     OriGene Protein Over-expression Lysate for HERPUD2   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for HERPUD2   OriGene 3'-UTR Clone for HERPUD2  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for HERPUD2   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for HERPUD2  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for HERPUD2   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for HERPUD2   OriGene Custom Protein Services for HERPUD2  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat HERPUD2
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing HERPUD2
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat HERPUD2
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat HERPUD2
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat HERPUD2
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat HERPUD2
     GenScript Custom Purified and Recombinant Proteins Services for HERPUD2 GenScript cDNA clones with any tag delivered in your preferred vector for HERPUD2
     GenScript Custom Assay Services for HERPUD2 GenScript Custom Superior Antibodies Services for HERPUD2
     GenScript Custom overexpressing Cell Line Services for HERPUD2 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in HERPUD2 promoter
     Search Chromatin IP Primers for HERPUD2
     RT2 qPCR Primer Assay in human, mouse, rat HERPUD2
     Search GNC Networks for HERPUD2
     SABiosciences Custom PCR Arrays for HERPUD2
     Search Tocris compounds for HERPUD2
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     HERPUD2 antibodies
     HERPUD2 proteins
     HERPUD2 lysates
     Search for Antibodies for HERPUD2 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for HERPUD2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     HERPUD2 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for HERPUD2
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HERPUD2
     SwitchGear 3'UTR luciferase reporter plasmids for HERPUD2
     SwitchGear Promoter luciferase reporter plasmids for HERPUD2
     Search ThermoFisher Antibodies for HERPUD2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HERPUD2
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      HERPUD2 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4