Set Analyses:
Advanced Search

Advanced Search

Search By
Section (entire)



protein-coding   GIFtS: 48
GCID: GC07M035672

HERPUD Family Member 2

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

HERPUD Family Member 21 2
Endoplasmic Reticulum Stress-Inducible1
Ubiquitin-Like Domain Member 21
Homocysteine-Inducible, Endoplasmic Reticulum Stress-Inducible,
Ubiquitin-Like Domain Member 22
Homocysteine-Responsive Endoplasmic Reticulum-Resident Ubiquitin-Like
Domain Member 2 Protein2

External Ids:    HGNC: 219151   Entrez Gene: 642242   Ensembl: ENSG000001225577   UniProtKB: Q9BSE43   

Export aliases for HERPUD2 gene to outside databases

Previous GC identifier: GC07M035638

(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for HERPUD2 Gene:
HERPUD2 (HERPUD family member 2) is a protein-coding gene. An important paralog of this gene is HERPUD1.

UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4
Function: Could be involved in the unfolded protein response (UPR) pathway (By similarity)

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence at NCBI GenBank:
NC_000007.13  NT_007819.18  NC_018918.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the HERPUD2 gene promoter:
         AML1a   AP-1   LCR-F1   E47   AREB6   POU2F1   NRF-2   FOXJ2 (long isoform)   POU2F1a   Hlf   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 3): HERPUD2 promoter sequence
   Search Chromatin IP Primers for HERPUD2

DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat HERPUD2

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 7p14.2   Ensembl cytogenetic band:  7p14.2   HGNC cytogenetic band: 7p14.2

HERPUD2 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
HERPUD2 gene location

GeneLoc information about chromosome 7         GeneLoc Exon Structure

GeneLoc location for GC07M035672:  view genomic region     (about GC identifiers)

35,672,269 bp from pter      End:
35,735,181 bp from pter
62,913 bases      Orientation:
minus strand

1 alternative location:
Chr7-,CRA_TCAG 35,711,081-35,772,820     

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., eBioscience, antibodies-online, and/or GeneTex,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., eBioscience, and/or antibodies-online, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, Cloud-Clone Corp, antibodies-online, and/or GeneTex.)
About This Section

UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4 (See protein sequence)
Recommended Name: Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein  
Size: 406 amino acids; 45147 Da
1 PDB 3D structure from and Proteopedia for HERPUD2:
2KDB (3D)    
Secondary accessions: A4D1Y8 Q9H6F9

Explore the universe of human proteins at neXtProt for HERPUD2: NX_Q9BSE4

Explore proteomics data for HERPUD2 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See HERPUD2 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_071768.3  
    ENSEMBL proteins: 
     ENSP00000379390   ENSP00000310729   ENSP00000415475   ENSP00000391015   ENSP00000412895  

    HERPUD2 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for HERPUD2
    OriGene Protein Over-expression Lysate for HERPUD2
    OriGene MassSpec for HERPUD2
    OriGene Custom Protein Services for HERPUD2
    GenScript Custom Purified and Recombinant Proteins Services for HERPUD2
    Novus Biologicals HERPUD2 Protein
    Novus Biologicals HERPUD2 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for HERPUD2

    Search eBioscience for Proteins for HERPUD2 

    antibodies-online proteins for HERPUD2 (2 products) 

    antibodies-online peptides for HERPUD2

    Search GeneTex for Proteins for HERPUD2 

    HERPUD2 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for HERPUD2
    Novus Biologicals HERPUD2 Antibodies
    Abcam antibodies for HERPUD2
    Cloud-Clone Corp. Antibodies for HERPUD2
    Search ThermoFisher Antibodies for HERPUD2
    antibodies-online antibodies for HERPUD2 (13 products) 

    GeneTex Antibodies for HERPUD2:  
                        HERPUD2 Antibodies

    HERPUD2 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for HERPUD2
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for HERPUD2
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for HERPUD2
    Cloud-Clone Corp. CLIAs for HERPUD2
    Search eBioscience for ELISAs for HERPUD2 
    antibodies-online kits for HERPUD2 (8 products) 

    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GenesLikeMe)
    About This Section

    1 InterPro protein domain:
     IPR000626 Ubiquitin_dom

    Graphical View of Domain Structure for InterPro Entry Q9BSE4

    ProtoNet protein and cluster: Q9BSE4

    1 Blocks protein domain: IPB000626 Ubiquitin domain

    UniProtKB/Swiss-Prot: HERP2_HUMAN, Q9BSE4
    Similarity: Contains 1 ubiquitin-like domain

    Find genes that share domains with HERPUD2           About GenesLikeMe

    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, genOway, and/or Taconic Biosciences, CRISPR knockouts from OriGene, transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Clones from OriGene, GenScript, Sino Biological, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: HERP2_HUMAN, Q9BSE4
    Function: Could be involved in the unfolded protein response (UPR) pathway (By similarity)

         Gene Ontology (GO): 1 molecular function term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005515protein binding ----
    Find genes that share ontologies with HERPUD2           About GenesLikeMe

    Animal Models:
       genOway: Develop your customized and physiologically relevant rodent model for HERPUD2

        Taconic Biosicences: Generate A Custom CRISPR Mouse Model For Your Study 

    CRISPR Knockouts: 
       OriGene CRISPR knockouts for HERPUD2

    miRTarBase miRNAs that target HERPUD2:
    hsa-mir-21-5p (MIRT030766)

    Block miRNA regulation of human, mouse, rat HERPUD2 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate HERPUD2 (see all 32):
    hsa-miR-4328 hsa-miR-548k hsa-miR-938 hsa-miR-1258 hsa-miR-25 hsa-miR-1244 hsa-miR-4325 hsa-miR-92b
    SwitchGear 3'UTR luciferase reporter plasmidHERPUD2 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for HERPUD2
    Predesigned siRNA for gene silencing in human, mouse, rat HERPUD2

    OriGene clones in human, mouse for HERPUD2 (see all 7)
    OriGene ORF clones in mouse, rat for HERPUD2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: HERPUD2 (NM_022373)
    Browse Sino Biological Human cDNA Clones
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HERPUD2
    Addgene plasmids for HERPUD2 

    Cell Line
    GenScript Custom overexpressing Cell Line Services for HERPUD2
    Browse ESI BIO Cell Lines and PureStem Progenitors for HERPUD2 
    In Situ Assay

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HERPUD2

    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

    Subcellular locations from UniProtKB/Swiss-Prot
    HERP2_HUMAN, Q9BSE4: Membrane; Single-pass membrane protein (Potential)
    Subcellular locations from COMPARTMENTS: 

    endoplasmic reticulum2

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016021integral component of membrane IEA--

    Find genes that share ontologies with HERPUD2           About GenesLikeMe

    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GenesLikeMe, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene, Sets of similar genes according to GenesLikeMe)
    About This Section

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for HERPUD2

        Search GeneGlobe Interaction Network for HERPUD2

    STRING Interaction Network Preview (showing 4 interactants - click image to see more details)

    4 Interacting proteins for HERPUD2 (ENSP000003107294) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    NCSTNENSP000002947854STRING: ENSP00000294785
    ELAVL1ENSP000003852694STRING: ENSP00000385269
    DERL2ENSP000001587714STRING: ENSP00000158771
    DERL3ENSP000003847444STRING: ENSP00000384744
    About this table

    Gene Ontology (GO): 2 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006986response to unfolded protein IEA--
    GO:0007283spermatogenesis IEA--

    Find genes that share ontologies with HERPUD2           About GenesLikeMe

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, Sets of similar genes according to GenesLikeMe)
    About This Section

    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for HERPUD2 (HERP2)

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    REFSEQ mRNAs for HERPUD2 gene (2 alternative transcripts): 
    NM_022373.4  XM_006715765.1  

    Unigene Cluster for HERPUD2:

    HERPUD family member 2
    Hs.643051  [show with all ESTs]
    Unigene Representative Sequence: NM_022373
    7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000396081(uc003tet.3 uc003tes.4) ENST00000311350 ENST00000426180
    ENST00000438224 ENST00000413517 ENST00000427455 ENST00000603731
    Block miRNA regulation of human, mouse, rat HERPUD2 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate HERPUD2 (see all 32):
    hsa-miR-4328 hsa-miR-548k hsa-miR-938 hsa-miR-1258 hsa-miR-25 hsa-miR-1244 hsa-miR-4325 hsa-miR-92b
    SwitchGear 3'UTR luciferase reporter plasmidHERPUD2 3' UTR sequence
    Inhib. RNA
    OriGene RNAi products in human, mouse, rat for HERPUD2
    Predesigned siRNA for gene silencing in human, mouse, rat HERPUD2
    OriGene clones in human, mouse for HERPUD2 (see all 7)
    OriGene ORF clones in mouse, rat for HERPUD2
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: HERPUD2 (NM_022373)
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HERPUD2
    Addgene plasmids for HERPUD2 
    OriGene qPCR primer pairs and template standards for HERPUD2
    OriGene qSTAR qPCR primer pairs in human, mouse for HERPUD2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HERPUD2
      QuantiTect SYBR Green Assays in human, mouse, rat HERPUD2
      QuantiFast Probe-based Assays in human, mouse, rat HERPUD2

    Additional mRNA sequence: 

    AK025966.1 AK055708.1 AK315685.1 BC005091.1 BC020264.1 

    12 DOTS entries:

    DT.97795183  DT.100782307  DT.40281526  DT.100782305  DT.100798914  DT.95137486  DT.121068515  DT.95137504 
    DT.121068518  DT.121068539  DT.95137487  DT.300314 

    Selected AceView cDNA sequences (see all 125):

    AI038755 AI149048 CD519249 BM046033 AI055917 AW083690 CA947069 AK025966 
    AI968127 AW404965 BU159381 AI925032 BQ887204 BQ647923 BQ645273 AI825051 
    AI188449 AI303023 CA947209 AI082596 BM352007 CA946984 BU186670 AI301475 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for HERPUD2 (see all 8)    About this scheme

    ExUns: 1a · 1b · 1c · 1d · 1e · 1f ^ 2a · 2b · 2c ^ 3 ^ 4 ^ 5a · 5b · 5c ^ 6 ^ 7a · 7b ^ 8 ^ 9a · 9b · 9c
    SP2:                                -                                                                                             
    SP4:                                                        -     -                                                               
    SP5:                                                        -                                                                     

    ECgene alternative splicing isoforms for HERPUD2

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GenesLikeMe, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    HERPUD2 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    HERPUD2 Expression
    About this image

    HERPUD2 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    HERPUD2 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.643051
        Custom PCR Arrays for HERPUD2
    OriGene qPCR primer pairs and template standards for HERPUD2
    OriGene qSTAR qPCR primer pairs in human, mouse for HERPUD2
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HERPUD2
    QuantiTect SYBR Green Assays in human, mouse, rat HERPUD2
    QuantiFast Probe-based Assays in human, mouse, rat HERPUD2
    In Situ
    Assay Products:

    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HERPUD2

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for HERPUD2 gene from Selected species (see all 14)    About this table
    Organism Taxonomic
    Gene Description Human
    (Mus musculus)
    Mammalia Herpud21 , 5 HERPUD family member 21, 5 89.85(n)1
      9 (10.25 cM)5
    805171  NM_020586.21  NP_065611.11 
    (Gallus gallus)
    Aves HERPUD21 HERPUD family member 2 76.05(n)
      420742  XM_418840.4  XP_418840.1 
    (Anolis carolinensis)
    Reptilia HERPUD26
    HERPUD family member 2
    1 ↔ 1
    African clawed frog
    (Xenopus laevis)
    Amphibia MGC527152 hypothetical protein MGC52715 77.23(n)    BC044318.1 
    (Danio rerio)
    Actinopterygii zgc560202 hypothetical protein MGC56020 77.88(n)   393157  BC045865.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta Herp1 Homocysteine-induced endoplasmic reticulum protein 47.46(n)
      34065  NM_164772.1  NP_723316.1 

    ENSEMBL Gene Tree for HERPUD2 (if available)
    TreeFam Gene Tree for HERPUD2 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to Build 68,Sets of similar genes according to GenesLikeMe)
    About This Section

    Paralogs for HERPUD2 gene
    1 SIMAP similar gene for HERPUD2 using alignment to 5 protein entries:     HERP2_HUMAN (see all proteins):

    Find genes that share paralogs with HERPUD2           About GenesLikeMe

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, and 4UniProtKB, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    Selected SNPs for HERPUD2 (see all 1279)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    Chr 7 posSequence#AA
    H--35552658(+) atataA/Ttatat 1 -- ds50010--------
    H--35552665(+) atataA/Tttata 1 -- ds50010--------
    C--35573996(+) TAGAG-/AAACACT 1 -- int11Minor allele frequency- AA:0.00NA 2
    --35671893(+) CATATA/TTATAT 1 -- ds50010--------
    C--35671926(+) TAATC-/ATATATA 1 -- ds50010--------
    1 -- ds50011Minor allele frequency- AATCATATATATAATCATATATATATAATCATATATA:0.00NA 2
    C,F,H--35672030(+) ATTTGT/CTTTAT 1 -- ds500112Minor allele frequency- C:0.04NA EA NS 1404
    C,F--35672152(+) GGAATG/AGAAAG 1 -- ds50011Minor allele frequency- A:0.20EA 120
    --35672189(+) GCAACC/GCTTCC 1 -- ds50010--------
    --35672654(+) AGCTAC/TAGACA 1 -- ut310--------

    HapMap Linkage Disequilibrium report for HERPUD2 (35672269 - 35735181 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 7 variations for HERPUD2:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv1619444CNV Deletion17803354
    esv2659669CNV Deletion23128226
    nsv5699CNV Insertion18451855
    nsv5697CNV Loss18451855
    nsv527371CNV Gain19592680
    dgv419n21CNV Gain19592680
    nsv471638CNV Gain15918152

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing HERPUD2

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB, Sets of similar genes according to GenesLikeMe)
    About This Section

    Find genes that share disorders with HERPUD2           About GenesLikeMe

    Genetic Association Database (GAD): HERPUD2
    Human Genome Epidemiology (HuGE) Navigator: HERPUD2 (1 document)

    Export disorders for HERPUD2 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for HERPUD2 gene, integrated from 10 sources (see all 11):
    (articles sorted by number of sources associating them with HERPUD2)

    1. Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. (PubMed id 19240061)1, 4 Trynka G....Wijmenga C. (Gut 2009)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    4. Solubility-based genetic screen identifies RING finger protein 126 as an E3 ligase for activation-induced cytidine deaminase. (PubMed id 23277564)1 Delker R.K....Papavasiliou F.N. (Proc. Natl. Acad. Sci. U.S.A. 2013)
    5. Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (PubMed id 23251661)1 Comuzzie A.G....Butte N.F. (PLoS ONE 2012)
    6. Ubiquitin-mediated proteolysis of HuR by heat shock. (PubMed id 19322201)1 Abdelmohsen K....Gorospe M. (EMBO J. 2009)
    7. hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. (PubMed id 17207965)1 Lamesch P.... Vidal M. (Genomics 2007)
    8. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PubMed id 16344560)1 Kimura K.... Sugano S. (Genome Res. 2006)
    9. Human chromosome 7: DNA sequence and biology. (PubMed id 12690205)2 Scherer S.W.... Tsui L.-C. (Science 2003)
    10. The DNA sequence of human chromosome 7. (PubMed id 12853948)2 Hillier L.W.... Wilson R.K. (Nature 2003)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
    Free Text  

      Query String
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 64224 HGNC: 21915 AceView: FLJ22313 Ensembl:ENSG00000122557 euGenes: HUgn64224
    ECgene: HERPUD2 H-InvDB: HERPUD2

    (According to HUGE)
    About This Section

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section
    PharmGKB entry for HERPUD2 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for HERPUD2 gene:
    Search GeneIP for patents involving HERPUD2

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search

    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, eBioscience, antibodies-online, GeneTex, and/or others, Clones from OriGene, GenScript, Sino Biological, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from genOway and/or Taconic Biosciences,
    CRISPR knockouts from OriGene)
    About This Section

     EMD Millipore genomic analysis products

     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for HERPUD2  
     OriGene qPCR primer pairs and template standards for HERPUD2   OriGene Protein Over-expression Lysate for HERPUD2  
     OriGene MassSpec for HERPUD2   OriGene clones in human, mouse for HERPUD2  
     OriGene qSTAR qPCR primer pairs in human, mouse for HERPUD2   OriGene Purified Protein for HERPUD2  
     OriGene ORF clones in mouse, rat for HERPUD2   OriGene CRISPR knockouts for HERPUD2
     OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling   OriGene Custom Antibody Services for HERPUD2  
     OriGene Custom Protein Services for HERPUD2  

     Block miRNA regulation of human, mouse, rat HERPUD2 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing HERPUD2
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat HERPUD2 Predesigned siRNA for gene silencing in human, mouse, rat HERPUD2
     QuantiFast Probe-based Assays in human, mouse, rat HERPUD2 QuantiTect SYBR Green Assays in human, mouse, rat HERPUD2
     Custom PCR Arrays for HERPUD2 Search Chromatin IP Primers for HERPUD2
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HERPUD2  Search GeneGlobe Interaction Network for HERPUD2
     Regulatory tfbs in HERPUD2 promoter
     GenScript Custom Purified and Recombinant Proteins Services for HERPUD2 GenScript cDNA clones with any tag delivered in your preferred vector for HERPUD2
     GenScript Custom Assay Services for HERPUD2 GenScript Custom overexpressing Cell Line Services for HERPUD2
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for HERPUD2 (HERP2)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     HERPUD2 antibodies
     HERPUD2 proteins
     HERPUD2 lysates
     Antibodies for HERPUD2
     See all of Abcam's Antibodies, Kits and Proteins for HERPUD2
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for HERPUD2
     Antibodies for HERPUD2
     ELISAs for HERPUD2
     CLIAs for HERPUD2

     Browse ESI BIO Cell Lines and PureStem Progenitors for HERPUD2
      Taconic Biosicences: Generate A Custom CRISPR Mouse Model For Your Study
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HERPUD2
     SwitchGear 3'UTR luciferase reporter plasmids for HERPUD2
     SwitchGear Promoter luciferase reporter plasmids for HERPUD2
     Search ThermoFisher Antibodies for HERPUD2
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HERPUD2
     Browse compounds at ApexBio
     Addgene plasmids for HERPUD2
      Search eBioscience for proteins for HERPUD2
      Search eBioscience for elisas for HERPUD2
      eBioscience FlowRNA Probe Sets
     genOway: Develop your customized and physiologically relevant rodent model for HERPUD2
     antibodies-online antibodies for HERPUD2 (13 products)
     antibodies-online kits for HERPUD2 (8 products)
     antibodies-online peptides for HERPUD2
     antibodies-online proteins for HERPUD2 (2 products)
      GeneTex Antibodies for HERPUD2: HERPUD2 Antibodies
      Search GeneTex for Proteins for HERPUD2
    GeneCards Home - Full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014 , 2 Nov 2014 , 8 Jan 2015 , 3 Feb 2015 , 31 Mar 2015

    View Random Gene

    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 

    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science
    This site does not provide medical advice and is for research use only
    Hot genes      Disease genes      HERPUD2 gene at Home site.
    Version: 3.12.394 10 May 2015
    hostname: index build: 128 solr: 1.4