Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HTT-AS Gene

Subcategory (RNA class) for HTT-AS Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for HTT-AS Gene

  • HTT Antisense RNA (Head To Head) 2 3 5
  • HTT Antisense RNA 1 (Non-Protein Coding) 2 3
  • HTT Antisense RNA 1 (Head To Head) 3
  • HTT Antisense RNA 1 2
  • HTT-AS1 3
  • HTTAS 3

External Ids for HTT-AS Gene

Previous HGNC Symbols for HTT-AS Gene

  • HTT-AS1

Summaries for HTT-AS Gene

GeneCards Summary for HTT-AS Gene

HTT-AS (HTT Antisense RNA (Head To Head)) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for HTT-AS Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HTT-AS Gene

Genomics for HTT-AS Gene

GeneHancer (GH) Regulatory Elements for HTT-AS Gene

Promoters and enhancers for HTT-AS Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH04I003073 Promoter/Enhancer 2 EPDnew Ensembl ENCODE 550.8 -0.7 -660 3.5 HDGF PKNOX1 FOXA2 SMAD1 MLX ARID4B SIN3A DMAP1 YY1 POLR2B HTT GC04P003074 HTT-AS RNF4 FAM193A HAUS3 MSANTD1 DOK7 NOP14-AS1 GC04M003078
GH04I002930 Promoter/Enhancer 2.3 EPDnew Ensembl ENCODE dbSUPER 10.4 +140.3 140312 8.2 HDGF PKNOX1 SMAD1 FOXA2 MLX ARID4B SIN3A DMAP1 ZNF2 IRF4 NOP14-AS1 MFSD10 GRK4 HTT HTT-AS GC04P002904 PIR46708 NOP14
GH04I003039 Enhancer 1 Ensembl ENCODE 15.7 +33.2 33157 3.1 RB1 ARID4B ZNF48 IKZF2 BCLAF1 RUNX3 RXRA SMAD5 CEBPB ELF1 HTT-AS GRK4 GC04P003044 GC04M003004
GH04I003044 Enhancer 1.4 FANTOM5 Ensembl ENCODE 10.6 +27.6 27617 4.4 PKNOX1 CLOCK ATF1 ARID4B ZNF2 ZNF48 ZNF143 FOS ATF7 RUNX3 GC04P003047 SH3BP2 HTT-AS GRK4 HGFAC RGS12 TNIP2 GC04P003058
GH04I003037 Enhancer 1 Ensembl ENCODE 11.9 +36.6 36590 1.8 ARNT ZSCAN4 ARID4B ZNF2 RAD21 ZNF335 ZNF207 ZNF143 BCLAF1 RUNX3 RNF4 HAUS3 HTT HTT-AS RNU7-33P GRK4 GC04P003044 GC04M003004
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HTT-AS on UCSC Golden Path with GeneCards custom track

Genomic Locations for HTT-AS Gene

Genomic Locations for HTT-AS Gene
chr4:3,063,246-3,074,514
(GRCh38/hg38)
Size:
11,269 bases
Orientation:
Minus strand
chr4:3,065,198-3,076,241
(GRCh37/hg19)

Genomic View for HTT-AS Gene

Genes around HTT-AS on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HTT-AS Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HTT-AS Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HTT-AS Gene

Proteins for HTT-AS Gene

Post-translational modifications for HTT-AS Gene

No Post-translational modifications

No data available for DME Specific Peptides for HTT-AS Gene

Domains & Families for HTT-AS Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for HTT-AS Gene

Function for HTT-AS Gene

Animal Model Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for HTT-AS Gene

Localization for HTT-AS Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for HTT-AS Gene

Pathways & Interactions for HTT-AS Gene

SuperPathways for HTT-AS Gene

No Data Available

Interacting Proteins for HTT-AS Gene

Gene Ontology (GO) - Biological Process for HTT-AS Gene

None

No data available for Pathways by source and SIGNOR curated interactions for HTT-AS Gene

Drugs & Compounds for HTT-AS Gene

No Compound Related Data Available

Transcripts for HTT-AS Gene

mRNA/cDNA for HTT-AS Gene

(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for HTT-AS Gene

No ASD Table

Relevant External Links for HTT-AS Gene

GeneLoc Exon Structure for
HTT-AS
ECgene alternative splicing isoforms for
HTT-AS

Expression for HTT-AS Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HTT-AS Gene

genes like me logo Genes that share expression patterns with HTT-AS: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for HTT-AS Gene

Orthologs for HTT-AS Gene

Evolution for HTT-AS Gene

ENSEMBL:
Gene Tree for HTT-AS (if available)
TreeFam:
Gene Tree for HTT-AS (if available)

No data available for Orthologs for HTT-AS Gene

Paralogs for HTT-AS Gene

No data available for Paralogs for HTT-AS Gene

Variants for HTT-AS Gene

Sequence variations from dbSNP and Humsavar for HTT-AS Gene

SNP ID Clin Chr 04 pos Variation AA Info Type
rs71180116 benign, pathogenic, Huntington's chorea 3,074,877(-) CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA/CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA upstream_transcript_variant
rs751281707 benign, not specified 3,074,924(-) GC/ upstream_transcript_variant
rs754481229 benign, not specified 3,074,927(-) GCAG/ upstream_transcript_variant
rs587777899 not-provided, not provided 3,074,929(-) A/C upstream_transcript_variant
rs1000216512 -- 3,075,551(-) G/A upstream_transcript_variant

Structural Variations from Database of Genomic Variants (DGV) for HTT-AS Gene

Variant ID Type Subtype PubMed ID
esv28565 CNV gain 19812545
esv3599420 CNV gain 21293372
nsv461163 CNV gain 19166990
nsv593437 CNV gain 21841781

Additional Variant Information for HTT-AS Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
HTT-AS

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for HTT-AS Gene

Disorders for HTT-AS Gene

Additional Disease Information for HTT-AS

No disorders were found for HTT-AS Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for HTT-AS Gene

Publications for HTT-AS Gene

  1. Roles of long noncoding RNAs in brain development, functional diversification and neurodegenerative diseases. (PMID: 23756188) Wu P … Ji A (Brain research bulletin 2013) 2 3 58
  2. A natural antisense transcript at the Huntington's disease repeat locus regulates HTT expression. (PMID: 21672921) Chung DW … Margolis RL (Human molecular genetics 2011) 2 3 58
  3. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K … Sugano S (Genome research 2006) 3 58

Products for HTT-AS Gene

Sources for HTT-AS Gene

Content
Loading form....