Aliases for HSPA5 Gene
Aliases for HSPA5 Gene
- Heat Shock Protein Family A (Hsp70) Member 5 2 3 5
- Heat Shock 70kDa Protein 5 (Glucose-Regulated Protein, 78kDa) 2 3
- Endoplasmic Reticulum Lumenal Ca(2+)-Binding Protein Grp78 3 4
- Immunoglobulin Heavy Chain-Binding Protein 3 4
- Glucose-Regulated Protein, 78kDa 2 3
- GRP78 3 4
- BIP 3 4
- Heat Shock 70kD Protein 5 (Glucose-Regulated Protein, 78kD) 2
External Ids for HSPA5 Gene
- HGNC: 5238
- Entrez Gene: 3309
- Ensembl: ENSG00000044574
- OMIM: 138120
- UniProtKB: P11021
Previous HGNC Symbols for HSPA5 Gene
- GRP78
Previous GeneCards Identifiers for HSPA5 Gene
- GC09M119111
- GC09M119643
- GC09M121450
- GC09M123373
- GC09M125076
- GC09M127036
- GC09M127997
- GC09M097610
Summaries for HSPA5 Gene
-
The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
GeneCards Summary for HSPA5 Gene
HSPA5 (Heat Shock Protein Family A (Hsp70) Member 5) is a Protein Coding gene. Diseases associated with HSPA5 include Wolfram Syndrome and Cavernous Hemangioma. Among its related pathways are Proteolysis Role of Parkin in the Ubiquitin-Proteasomal Pathway and Innate Immune System. GO annotations related to this gene include calcium ion binding and ubiquitin protein ligase binding. An important paralog of this gene is HSPA8.
UniProtKB/Swiss-Prot for HSPA5 Gene
-
Probably plays a role in facilitating the assembly of multimeric protein complexes inside the endoplasmic reticulum. Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10, probably to facilitate the release of DNAJC10 from its substrate.
No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HSPA5 Gene
Genomics for HSPA5 Gene
Regulatory Elements for HSPA5 Gene
Enhancers for HSPA5 Gene
| GeneHancer Identifier | Enhancer Score | Enhancer Sources | Gene-Enhancer Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites within enhancer | Gene Targets for Enhancer |
|---|---|---|---|---|---|---|---|---|
| GH09G125630 | 3.1 | VISTA FANTOM5 Ensembl ENCODE dbSUPER | 2 | -391.5 | -391542 | 4.1 | HDGF PKNOX1 WRNIP1 ARID4B FEZF1 YBX1 TCF12 CBX5 ZNF143 ZNF207 | PRPS1P2 PBX3 HSPA5 PPP6C GAPVD1 HNRNPA1P15 MAPKAP1 |
| GH09G125659 | 1.7 | FANTOM5 Ensembl ENCODE dbSUPER | 1.2 | -418.6 | -418600 | 1.5 | PKNOX1 ZNF335 GLIS2 EGR1 FOS ETV6 IKZF2 CREM ZNF263 JUNB | RNU6-1020P GAPVD1 HSPA5 MAPKAP1 HNRNPA1P15 |
| GH09G125238 | 1.4 | ENCODE dbSUPER | 0.7 | -0.1 | -50 | 6.6 | CREB3L1 AGO1 ZFP64 DMAP1 YY1 SLC30A9 ZNF263 SP3 NFYC MEF2D | RABEPK GOLGA1 PRPS1P2 OLFML2A ENSG00000239705 GAPVD1 HSPA5 |
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around HSPA5 on UCSC Golden Path with GeneCards custom track
- Transcription factor binding sites by QIAGEN in the HSPA5 gene promoter:
Regulatory Element Products
Genomic Location for HSPA5 Gene
- Chromosome:
- 9
- Start:
- 125,234,848 bp from pter
- End:
- 125,241,387 bp from pter
- Size:
- 6,540 bases
- Orientation:
- Minus strand
Genomic View for HSPA5 Gene
Genes around HSPA5 on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 9q33.3 by Ensembl
- 9q33.3 by Entrez Gene
- 9q33.3 by HGNC
HSPA5 Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for HSPA5 Gene
Proteins for HSPA5 Gene
-
Protein details for HSPA5 Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P11021-GRP78_HUMAN
- Recommended name:
- 78 kDa glucose-regulated protein
- Protein Accession:
- P11021
- B0QZ61
- Q2EF78
- Q9NPF1
- Q9UK02
Protein attributes for HSPA5 Gene
- Size:
- 654 amino acids
- Molecular mass:
- 72333 Da
- Quaternary structure:
-
- Interacts with DNAJC1 (via J domain) (By similarity). Component of an EIF2 complex at least composed of CELF1/CUGBP1, CALR, CALR3, EIF2S1, EIF2S2, HSP90B1 and HSPA5. Part of a large chaperone multiprotein complex comprising DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PDIA6, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX (By similarity). Interacts with TMEM132A and TRIM21 (PubMed:12699405). May form a complex with ERLEC1, OS9, SEL1L and SYVN1 (PubMed:18264092,PubMed:18502753). Interacts with DNAJC10 (PubMed:12411443, PubMed:23769672). Interacts with MX1 (By similarity). Interacts with METTL23 (PubMed:23349634). Interacts with CEMIP; the interaction induces calcium leakage from the endoplasmic reticulum and cell migration (PubMed:23990668). Interacts with PCSK4 form; the interaction takes place in the endoplasmic reticulum (PubMed:21080038). Interacts with CIPC (PubMed:26657846). Interacts with CCDC88B (via C-terminus); the interaction opposes ERN1-mediated JNK activation, protecting against apoptosis (PubMed:21289099).
Protein Expression for HSPA5 Gene
Post-translational modifications for HSPA5 Gene
- Ubiquitination at isoforms=96, posLast=113113, posLast=118118, posLast=268268, posLast=326326, posLast=370370, isoforms=376, isoforms=523, posLast=547547, posLast=573573, and posLast=601601
- Glycosylation at posLast=6969, posLast=203203, and posLast=643643
- Modification sites at PhosphoSitePlus
Other Protein References for HSPA5 Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- EMD Millipore Complete listing of Mono and Polychlonal Antibodies for HSPA5
- R&D Systems Antibodies for HSPA5 (GRP78/HSPA5)
- Cell Signaling Technology (CST) Antibodies for HSPA5 (GRP78)
-
Custom Antibody ServicesOriGene Antibodies for HSPA5
- Novus Biologicals Antibodies for HSPA5
- Invitrogen Antibodies for HSPA5
- antibodies-online Antibodies for HSPA5: See all 404
- GeneTex HSPA5 antibody for HSPA5
-
Santa Cruz Biotechnology (SCBT) Antibodies for HSPA5
Protein Products
- Enzo Life Sciences proteins for HSPA5
-
OriGene Purified Proteins for HSPA5
- Search Origene for MassSpec and Protein Over-expression Lysates for HSPA5
- Origene Custom Protein Services for HSPA5
- ProSpec Recombinant Proteins for HSPA5
- antibodies-online Proteins for HSPA5: See all 27
- Search antibodies-online for peptides
- Search GeneTex for Proteins for HSPA5
No data available for DME Specific Peptides for HSPA5 Gene
Domains & Families for HSPA5 Gene
Gene Families for HSPA5 Gene
Protein Domains for HSPA5 Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for HSPA5 Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P11021- Family:
-
- Belongs to the heat shock protein 70 family.
Function for HSPA5 Gene
Molecular function for HSPA5 Gene
- GENATLAS Biochemistry:
- glucose regulated protein (78kDa),HSP70 homolog,in the endoplasmic reticulum,subunit of PPP1CC2
- UniProtKB/Swiss-Prot Function:
- Probably plays a role in facilitating the assembly of multimeric protein complexes inside the endoplasmic reticulum. Involved in the correct folding of proteins and degradation of misfolded proteins via its interaction with DNAJC10, probably to facilitate the release of DNAJC10 from its substrate.
- UniProtKB/Swiss-Prot Induction:
- By endoplasmic reticulum stress.
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001948 | glycoprotein binding | IPI | 20477988 |
| GO:0005509 | calcium ion binding | TAS | 16130169 |
| GO:0005515 | protein binding | IPI | 11907036 |
| GO:0005524 | ATP binding | IEA | -- |
| GO:0016887 | ATPase activity | ISS,IDA | -- |
Phenotypes for HSPA5 Gene
- MGI mutant phenotypes for HSPA5:
-
inferred from 5 alleles
- mortality/aging
- cellular phenotype
- normal phenotype
- growth/size/body region phenotype
- nervous system phenotype
- homeostasis/metabolism phenotype
- cardiovascular system phenotype
- respiratory system phenotype
- digestive/alimentary phenotype
- neoplasm
- reproductive system phenotype
- hearing/vestibular/ear phenotype
- integument phenotype
- embryo phenotype
- renal/urinary system phenotype
- craniofacial phenotype
- GenomeRNAi human phenotypes for HSPA5:
-
- Increased vaccinia virus (VACV) infection
- Decreased hepcidin::fluc mRNA expression
- Negative genetic interaction between KRASG13D/+ and KRAS+/-
- Decreased viability
- Decreased IL-8 secretion
- Increased shRNA abundance
- Downregulation of Wnt pathway after Wnt3A stimulation
- Decreased DCP1a protein expression and assembly in processing bodies after arsenite stimulation
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for HSPA5
-
-
ViGene Biosciences lentiviral particle packaged cDNA for HSPA5 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for HSPA5 gene
- Search ViGene Biosciences for HSPA5
CRISPR Products
-
OriGene CRISPR knockouts for HSPA5
-
Santa Cruz Biotechnology (SCBT) CRISPR for HSPA5
- GenScript: Design CRISPR guide RNA sequences for HSPA5
miRNA for HSPA5 Gene
- miRTarBase miRNAs that target HSPA5
-
- hsa-mir-335-5p (MIRT018562)
- hsa-mir-16-5p (MIRT031900)
- hsa-mir-93-3p (MIRT038848)
- hsa-mir-199a-5p (MIRT053102)
- bta-mir-181a (MIRT053980)
- hsa-mir-30a-5p (MIRT054632)
- hsa-mir-545-3p (MIRT493546)
- hsa-mir-584-5p (MIRT493547)
- hsa-mir-597-5p (MIRT493548)
- hsa-mir-4451 (MIRT493549)
- hsa-mir-4650-3p (MIRT493550)
- hsa-mir-4729 (MIRT493551)
- hsa-mir-5579-5p (MIRT493552)
- hsa-mir-5582-3p (MIRT493553)
- hsa-mir-548x-3p (MIRT493554)
- hsa-mir-548j-3p (MIRT493555)
- hsa-mir-548aq-3p (MIRT493556)
- hsa-mir-548am-3p (MIRT493557)
- hsa-mir-548aj-3p (MIRT493558)
- hsa-mir-548ah-3p (MIRT493559)
- hsa-mir-548ae-3p (MIRT493560)
- hsa-mir-5688 (MIRT493561)
- hsa-mir-495-3p (MIRT493562)
- hsa-mir-668-3p (MIRT493563)
- hsa-mir-379-5p (MIRT493564)
- hsa-mir-3529-5p (MIRT493565)
- hsa-mir-2053 (MIRT571178)
- hsa-mir-7114-3p (MIRT571179)
- hsa-mir-5589-3p (MIRT571180)
- hsa-mir-1180-5p (MIRT571181)
- hsa-mir-4482-5p (MIRT571182)
- hsa-mir-4773 (MIRT571183)
- hsa-mir-3130-5p (MIRT571184)
- hsa-mir-3121-3p (MIRT571185)
- hsa-mir-6833-3p (MIRT647509)
- hsa-mir-4768-5p (MIRT647510)
- hsa-mir-6873-3p (MIRT647511)
- hsa-mir-627-3p (MIRT647512)
- hsa-mir-6845-3p (MIRT647513)
- hsa-mir-6832-3p (MIRT647514)
- hsa-mir-6756-3p (MIRT647515)
- hsa-mir-3127-3p (MIRT647516)
miRNA Products
- Search ViGene Biosciences for HSPA5
Inhibitory RNA Products
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for HSPA5
- Browse OriGene Inhibitory RNA Products For HSPA5
-
ViGene Biosciences ready-to-package AAV shRNAs for HSPA5 gene
Clone Products
-
OriGene ORF clones in human for HSPA5
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for HSPA5
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Addgene plasmids for HSPA5
- VectorBuilder custom plasmid, inducible vectors for HSPA5
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HSPA5
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Cell Line Products
-
ViGene Biosciences adenoviral particle packaged cDNA for HSPA5 gene
-
ViGene Biosciences lentiviral particle packaged cDNA for HSPA5 gene
-
ViGene Biosciences ready-to-package AAV shRNAs for HSPA5 gene
Flow Cytometry Products
- eBioscience FlowRNA Probe Sets (VA1-11084) for HSPA5
No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for HSPA5 Gene
Localization for HSPA5 Gene
Subcellular locations from UniProtKB/Swiss-Prot for HSPA5 Gene
- Endoplasmic reticulum lumen. Melanosome. Cytoplasm. Note=Identified by mass spectrometry in melanosome fractions from stage I to stage IV.
| Compartment | Confidence |
|---|---|
| extracellular | 5 |
| nucleus | 5 |
| endoplasmic reticulum | 5 |
| mitochondrion | 4 |
| cytosol | 4 |
| plasma membrane | 3 |
| cytoskeleton | 2 |
| lysosome | 2 |
| golgi apparatus | 2 |
| peroxisome | 1 |
| endosome | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | IMP | 11943137 |
| GO:0005737 | cytoplasm | IEA | -- |
| GO:0005739 | mitochondrion | IEA | -- |
| GO:0005783 | endoplasmic reticulum | IDA,TAS | 16130169 |
| GO:0005788 | endoplasmic reticulum lumen | TAS | -- |
Pathways & Interactions for HSPA5 Gene
Pathways by source for HSPA5 Gene
2 GeneTex pathways for HSPA5 Gene
1 Cell Signaling Technology pathway for HSPA5 Gene
17 Reactome pathways for HSPA5 Gene
5 KEGG pathways for HSPA5 Gene
6 GeneGo (Thomson Reuters) pathways for HSPA5 Gene
Interacting Proteins for HSPA5 Gene
Selected Interacting proteins:
ENSP00000324173
P11021-GRP78_HUMAN
for HSPA5 Gene via
STRING
MINT
IID
UniProtKB
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0006983 | ER overload response | IEA | -- |
| GO:0006987 | activation of signaling protein activity involved in unfolded protein response | IEA | -- |
| GO:0009314 | response to radiation | IEA | -- |
| GO:0010976 | positive regulation of neuron projection development | IEA | -- |
| GO:0021589 | cerebellum structural organization | IEA | -- |
No data available for SIGNOR curated interactions for HSPA5 Gene
Drugs & Compounds for HSPA5 Gene
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Transcripts for HSPA5 Gene
mRNA/cDNA for HSPA5 Gene
- (1) REFSEQ mRNAs :
- (7) Additional mRNA sequences :
- (1367) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for HSPA5 Gene
CRISPR Products
-
OriGene CRISPR knockouts for HSPA5
-
Santa Cruz Biotechnology (SCBT) CRISPR for HSPA5
- GenScript: Design CRISPR guide RNA sequences for HSPA5
miRNA Products
- Search ViGene Biosciences for HSPA5
Inhibitory RNA Products
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for HSPA5
- Browse OriGene Inhibitory RNA Products For HSPA5
-
ViGene Biosciences ready-to-package AAV shRNAs for HSPA5 gene
Clone Products
-
OriGene ORF clones in human for HSPA5
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for HSPA5
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Addgene plasmids for HSPA5
- VectorBuilder custom plasmid, inducible vectors for HSPA5
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HSPA5
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Flow Cytometry Products
- eBioscience FlowRNA Probe Sets (VA1-11084) for HSPA5
Expression for HSPA5 Gene
This gene is overexpressed in Bone marrow stromal cell (6.9) and Lymph node (6.5).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for HSPA5 Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of HSPA5 Gene:
HSPA5SOURCE GeneReport for Unigene cluster for HSPA5 Gene:
Hs.743241Evidence on tissue expression from TISSUES for HSPA5 Gene
- Nervous system(4.9)
- Liver(4.8)
- Muscle(4.6)
- Intestine(4.3)
- Pancreas(4.2)
- Lung(4)
- Thyroid gland(3.8)
- Heart(3.7)
- Kidney(3.4)
- Eye(3.3)
- Blood(3)
- Bone(3)
- Skin(3)
- Stomach(3)
- Bone marrow(2.8)
- Spleen(2.8)
- Adrenal gland(2.7)
- Lymph node(2.6)
Primer Products
-
OriGene qPCR primer pairs and template standards for HSPA5
-
OriGene qPCR primer pairs for HSPA5
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for HSPA5 Gene
Orthologs for HSPA5 Gene
This gene was present in the common ancestor of eukaryotes.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | HSPA5 34 35 |
|
||
| oppossum (Monodelphis domestica) |
Mammalia | HSPA5 35 |
|
OneToOne | |
| platypus (Ornithorhynchus anatinus) |
Mammalia | HSPA5 35 |
|
OneToOne | |
| dog (Canis familiaris) |
Mammalia | HSPA5 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | HSPA5 34 |
|
||
| mouse (Mus musculus) |
Mammalia | Hspa5 16 35 34 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Hspa5 34 |
|
||
| chicken (Gallus gallus) |
Aves | HSPA5 34 35 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | HSPA5 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | LOC100492570 34 |
|
||
| Str.3462 34 |
|
||||
| African clawed frog (Xenopus laevis) |
Amphibia | hspa5-prov 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | hspa5 34 35 |
|
||
| Dr.26116 34 |
|
||||
| rainbow trout (Oncorhynchus mykiss) |
Actinopterygii | Omy.11216 34 |
|
||
| fruit fly (Drosophila melanogaster) |
Insecta | Hsc70-3 34 35 |
|
||
| African malaria mosquito (Anopheles gambiae) |
Insecta | AgaP_AGAP004192 34 |
|
||
| worm (Caenorhabditis elegans) |
Secernentea | hsp-4 35 |
|
OneToMany | |
| hsp-3 34 35 |
|
||||
| K. lactis yeast (Kluyveromyces lactis) |
Saccharomycetes | KLLA0D09559g 34 |
|
||
| baker's yeast (Saccharomyces cerevisiae) |
Saccharomycetes | KAR2 34 37 |
|
||
| SSA2 35 |
|
OneToMany | |||
| A. gosspyii yeast (Ashbya gossypii) |
Saccharomycetes | AGOS_ACR038W 34 |
|
||
| thale cress (Arabidopsis thaliana) |
eudicotyledons | BIP1 34 |
|
||
| soybean (Glycine max) |
eudicotyledons | Gma.17631 34 |
|
||
| Alicante grape (Vitis vinifera) |
eudicotyledons | Vvi.4801 34 |
|
||
| rice (Oryza sativa) |
Liliopsida | Os02g0115900 34 |
|
||
| sea squirt (Ciona savignyi) |
Ascidiacea | -- 35 |
|
OneToOne | |
| fission yeast (Schizosaccharomyces pombe) |
Schizosaccharomycetes | bip1 34 |
|
||
| bread mold (Neurospora crassa) |
Ascomycetes | NCU03982 34 |
|
- Species where no ortholog for HSPA5 was found in the sources mined by GeneCards:
-
- Actinobacteria (Mycobacterium tuberculosis)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for HSPA5 Gene
(14) SIMAP similar genes for HSPA5 Gene using alignment to 1 proteins:
Pseudogenes.org Pseudogenes for HSPA5 Gene
Variants for HSPA5 Gene
| SNP ID | Clin | Chr 09 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs1000089203 | -- | 125,242,018(+) | CACCC(C/T)TGCCC | nc-transcript-variant, upstream-variant-2KB | |
| rs1000192312 | -- | 125,241,627(+) | GACTT(C/G)TGACC | upstream-variant-2KB | |
| rs1001027372 | -- | 125,235,962(+) | AGATG(-/TGGAT)TAACT | utr-variant-3-prime | |
| rs1001147608 | -- | 125,243,149(+) | ACCCG(A/G)GAGGT | intron-variant, upstream-variant-2KB | |
| rs1001276387 | -- | 125,234,659(+) | GTATT(-/TATATATGTATACATAAACACA)TATAT | downstream-variant-500B |
Residual Variation Intolerance Score:
14.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
1.09;
22.11% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for HSPA5 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HSPA5 Gene
Disorders for HSPA5 Gene
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| wolfram syndrome |
|
|
| cavernous hemangioma |
|
|
| transient cerebral ischemia |
|
|
| short-rib thoracic dysplasia 2 with or without polydactyly |
|
|
| spinocerebellar ataxia 14 |
|
|
Search HSPA5 in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
GRP78_HUMAN- Note=Autoantigen in rheumatoid arthritis. {ECO:0000269 PubMed:11160188}.
Relevant External Links for HSPA5
No data available for Genatlas for HSPA5 Gene
Publications for HSPA5 Gene
- A newly uncovered group of distantly related lysine methyltransferases preferentially interact with molecular chaperones to regulate their activity. (PMID: 23349634) Cloutier P. … Coulombe B. (PLoS Genet. 2013) 3 4 64
- Unraveling the role of KIAA1199, a novel endoplasmic reticulum protein, in cancer cell migration. (PMID: 23990668) Evensen N.A. … Cao J. (J. Natl. Cancer Inst. 2013) 3 4 64
- ERdj5 is the ER reductase that catalyzes the removal of non-native disulfides and correct folding of the LDL receptor. (PMID: 23769672) Oka O.B. … Bulleid N.J. (Mol. Cell 2013) 3 4 64
- Identification and characterization of a novel human methyltransferase modulating Hsp70 protein function through lysine methylation. (PMID: 23921388) Jakobsson M.E. … Falnes P.A.9. (J. Biol. Chem. 2013) 3 4 64
- The precursor to the germ cell-specific PCSK4 proteinase is inefficiently activated in transfected somatic cells: evidence of interaction with the BiP chaperone. (PMID: 21080038) Gyamera-Acheampong C. … Mbikay M. (Mol. Cell. Biochem. 2011) 3 4 64
Products for HSPA5 Gene
- R&D Systems Antibodies for HSPA5 (GRP78/HSPA5)
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for HSPA5
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for HSPA5
- Search Origene for MassSpec and Protein Over-expression Lysates for HSPA5
- Origene Custom Protein Services for HSPA5
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for HSPA5
- Browse OriGene Inhibitory RNA Products For HSPA5
- OriGene qPCR primer pairs and template standards for HSPA5
- OriGene qPCR primer pairs for HSPA5
- OriGene CRISPR knockouts for HSPA5
- OriGene ORF clones in human for HSPA5
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For HSPA5
- GenScript: Next-day shipping cDNA ORF clone for HSPA5 in any vector
- GenScript Custom Purified and Recombinant Proteins Services for HSPA5
- GenScript Custom Assay Services for HSPA5
- GenScript Custom overexpressing Cell Line Services for HSPA5
- GenScript: Design CRISPR guide RNA sequences for HSPA5
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for HSPA5
- Cell Signaling Technology (CST) Antibodies for HSPA5 (GRP78)
- Search for Antibodies & Assays
- Sino Biological Human cDNA Clone for HSPA5
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Enzo Life Sciences proteins for HSPA5
- Enzo Life Sciences assays for HSPA5
- Browse drugs & compounds from Enzo Life Sciences
- Search Enzo Life Sciences for proteins, assays, substrates, inhibitors & antibodies
- Novus Biologicals Antibodies for HSPA5
- Novus Biologicals proteins and lysates for HSPA5
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- ProSpec Recombinant Proteins for HSPA5
- Addgene plasmids for HSPA5
- antibodies-online Antibodies for HSPA5: See all 404
- antibodies-online Kits for HSPA5: See all 32
- antibodies-online Proteins for HSPA5: See all 27
- Search antibodies-online for peptides
- GeneTex HSPA5 antibody for HSPA5
- Search GeneTex for Proteins for HSPA5
- ViGene Biosciences adenoviral particle packaged cDNA for HSPA5 gene
- ViGene Biosciences lentiviral particle packaged cDNA for HSPA5 gene
- ViGene Biosciences ready-to-package AAV shRNAs for HSPA5 gene
- Search ViGene Biosciences for HSPA5
- Santa Cruz Biotechnology (SCBT) Antibodies for HSPA5
- Search Santa Cruz Biotechnology (SCBT) for HSPA5 siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for HSPA5
- Cyagen custom Knockout/knockin (KOKI) mouse models for HSPA5
- VectorBuilder custom plasmid, inducible vectors for HSPA5
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for HSPA5
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for HSPA5 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer