Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HRC Gene

Aliases for HRC Gene

  • Histidine Rich Calcium Binding Protein 2 3 5
  • Histidine-Rich Calcium-Binding Protein 2
  • HCP 4

External Ids for HRC Gene

Previous GeneCards Identifiers for HRC Gene

  • GC19M050312
  • GC19M050022
  • GC19M054330
  • GC19M054346
  • GC19M049654
  • GC19M046030

Summaries for HRC Gene

Entrez Gene Summary for HRC Gene

  • This gene encodes a luminal sarcoplasmic reticulum protein identified by its ability to bind low-density lipoprotein with high affinity. The protein interacts with the cytoplasmic domain of triadin, the main transmembrane protein of the junctional sarcoplasmic reticulum (SR) of skeletal muscle. The protein functions in the regulation of releasable calcium into the SR. [provided by RefSeq, Sep 2008]

GeneCards Summary for HRC Gene

HRC (Histidine Rich Calcium Binding Protein) is a Protein Coding gene. Diseases associated with HRC include Mixed Glioma and Dilated Cardiomyopathy. Gene Ontology (GO) annotations related to this gene include calcium ion binding and ATPase binding.

UniProtKB/Swiss-Prot for HRC Gene

  • May play a role in the regulation of calcium sequestration or release in the SR of skeletal and cardiac muscle.

Gene Wiki entry for HRC Gene

Additional gene information for HRC Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HRC Gene

Genomics for HRC Gene

GeneHancer (GH) Regulatory Elements for HRC Gene

Promoters and enhancers for HRC Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH19I049154 Promoter/Enhancer 2.4 EPDnew Ensembl ENCODE dbSUPER 558.2 -1.3 -1334 5.1 HDGF PKNOX1 SMAD1 ZFP64 ARID4B SIN3A FEZF1 ZNF2 YY1 POLR2B TRPM4 HRC PRR12 SEC1P GRWD1 RPS11 SNORD35A RPL13A PIH1D1 RPL18
GH19I049155 Enhancer 0.5 Ensembl dbSUPER 550.8 +1.5 1528 0.2 EBF1 HRC PPFIA3
GH19I048612 Promoter/Enhancer 2.5 EPDnew Ensembl ENCODE dbSUPER 4.6 +538.7 538667 7.8 CLOCK ZFP64 FEZF1 DMAP1 IRF4 YY1 SLC30A9 ZNF213 E2F8 ZNF143 RPL18 FAM83E PIR55128 SPHK2 PRR12 PIH1D1 SNORD35A SNORD35B ALDH16A1 KDELR1
GH19I049148 Promoter/Enhancer 1.8 Ensembl ENCODE dbSUPER 0.4 +5.2 5200 4.4 HDGF PKNOX1 CLOCK ARNT ARID4B SIN3A DMAP1 ZNF2 YY1 CBX5 SNRNP70 PPFIA3 PRR12 GRWD1 PIH1D1 SNORD35A ALDH16A1 RPL13A PTOV1-AS2 KDELR1
GH19I049142 Promoter/Enhancer 1.5 Ensembl ENCODE dbSUPER 0.4 +12.6 12612 1.1 HDGF PKNOX1 ATF1 SIN3A RFX5 GLIS2 FOS ATF7 CREM ZBTB2 PPFIA3 C19orf73 LIN7B SNRNP70 NTF4 CGB7 KCNA7 SLC6A16 CD37 CCDC155
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around HRC on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the HRC gene promoter:

Genomic Locations for HRC Gene

Genomic Locations for HRC Gene
chr19:49,151,198-49,155,429
(GRCh38/hg38)
Size:
4,232 bases
Orientation:
Minus strand
chr19:49,654,455-49,658,681
(GRCh37/hg19)

Genomic View for HRC Gene

Genes around HRC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HRC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HRC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HRC Gene

Proteins for HRC Gene

  • Protein details for HRC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P23327-SRCH_HUMAN
    Recommended name:
    Sarcoplasmic reticulum histidine-rich calcium-binding protein
    Protein Accession:
    P23327
    Secondary Accessions:
    • Q504Y6

    Protein attributes for HRC Gene

    Size:
    699 amino acids
    Molecular mass:
    80244 Da
    Quaternary structure:
    No Data Available

neXtProt entry for HRC Gene

Post-translational modifications for HRC Gene

No Post-translational modifications

Other Protein References for HRC Gene

No data available for DME Specific Peptides for HRC Gene

Domains & Families for HRC Gene

Gene Families for HRC Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins
  • Predicted secreted proteins

Protein Domains for HRC Gene

InterPro:
ProtoNet:

Graphical View of Domain Structure for InterPro Entry

P23327

UniProtKB/Swiss-Prot:

SRCH_HUMAN :
  • Belongs to the HRC family.
Family:
  • Belongs to the HRC family.
genes like me logo Genes that share domains with HRC: view

Function for HRC Gene

Molecular function for HRC Gene

GENATLAS Biochemistry:
histidine-rich calcium binding protein (sarcoplasmic reticulum,luminal)
UniProtKB/Swiss-Prot Function:
May play a role in the regulation of calcium sequestration or release in the SR of skeletal and cardiac muscle.

Phenotypes From GWAS Catalog for HRC Gene

Gene Ontology (GO) - Molecular Function for HRC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005509 calcium ion binding IEA,IDA 24125847
GO:0005515 protein binding IPI 17526652
GO:0044325 ion channel binding IPI 17526652
GO:0051117 ATPase binding IPI 17526652
genes like me logo Genes that share ontologies with HRC: view
genes like me logo Genes that share phenotypes with HRC: view

miRNA for HRC Gene

miRTarBase miRNAs that target HRC

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for HRC Gene

Localization for HRC Gene

Subcellular locations from UniProtKB/Swiss-Prot for HRC Gene

Sarcoplasmic reticulum lumen.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for HRC gene
Compartment Confidence
endoplasmic reticulum 5
extracellular 3
plasma membrane 1
mitochondrion 1
peroxisome 1
cytosol 1
lysosome 1

Gene Ontology (GO) - Cellular Components for HRC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005788 endoplasmic reticulum lumen TAS --
GO:0016529 sarcoplasmic reticulum IEA --
GO:0030018 Z disc IDA 24125847
GO:0033017 sarcoplasmic reticulum membrane IEA --
GO:0033018 sarcoplasmic reticulum lumen TAS 11504710
genes like me logo Genes that share ontologies with HRC: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for HRC Gene

Pathways & Interactions for HRC Gene

No Data Available

Interacting Proteins for HRC Gene

STRING Interaction Network Preview (showing 4 interactants - click image to see details)
http://version10.5.string-db.org/api/image/networkList?limit=0&targetmode=proteins&caller_identity=gene_cards&network_flavor=evidence&identifiers=9606.ENSP00000252825%0d%0a9606.ENSP00000381240%0d%0a9606.ENSP00000355533%0d%0a9606.ENSP00000373884%0d%0a9606.ENSP00000352608%0d%0a
Selected Interacting proteins: P23327-SRCH_HUMAN ENSP00000252825 for HRC Gene via IID STRING UniProtKB

Gene Ontology (GO) - Biological Process for HRC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0002027 regulation of heart rate IMP 18617481
GO:0006936 muscle contraction TAS 2037293
GO:0008016 regulation of heart contraction IEA --
GO:0010460 positive regulation of heart rate IGI 24125847
GO:0010880 regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum IGI 24125847
genes like me logo Genes that share ontologies with HRC: view

No data available for Pathways by source and SIGNOR curated interactions for HRC Gene

Drugs & Compounds for HRC Gene

(2) Drugs for HRC Gene - From: HMDB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
calcium Approved Nutra 0
genes like me logo Genes that share compounds with HRC: view

Transcripts for HRC Gene

Unigene Clusters for HRC Gene

Histidine rich calcium binding protein:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for HRC Gene

ExUns: 1 ^ 2a · 2b ^ 3 ^ 4a · 4b ^ 5 ^ 6
SP1: -
SP2:

Relevant External Links for HRC Gene

GeneLoc Exon Structure for
HRC
ECgene alternative splicing isoforms for
HRC

Expression for HRC Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HRC Gene

mRNA differential expression in normal tissues according to GTEx for HRC Gene

This gene is overexpressed in Heart - Left Ventricle (x24.9), Heart - Atrial Appendage (x12.0), and Muscle - Skeletal (x10.9).

Protein differential expression in normal tissues from HIPED for HRC Gene

This gene is overexpressed in Heart (45.5) and Fetal heart (14.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, MaxQB, and MOPED for HRC Gene



NURSA nuclear receptor signaling pathways regulating expression of HRC Gene:

HRC

SOURCE GeneReport for Unigene cluster for HRC Gene:

Hs.436885

Evidence on tissue expression from TISSUES for HRC Gene

  • Muscle(4.7)
  • Liver(4.2)
  • Heart(3.6)
genes like me logo Genes that share expression patterns with HRC: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for HRC Gene

Orthologs for HRC Gene

This gene was present in the common ancestor of chordates.

Orthologs for HRC Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia HRC 33 34
  • 96.59 (n)
cow
(Bos Taurus)
Mammalia HRC 33 34
  • 79.14 (n)
dog
(Canis familiaris)
Mammalia HRC 34
  • 58 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Hrc 34
  • 48 (a)
OneToOne
platypus
(Ornithorhynchus anatinus)
Mammalia HRC 34
  • 41 (a)
OneToOne
zebrafish
(Danio rerio)
Actinopterygii HRC 34
  • 30 (a)
OneToOne
Species where no ortholog for HRC was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for HRC Gene

ENSEMBL:
Gene Tree for HRC (if available)
TreeFam:
Gene Tree for HRC (if available)

Paralogs for HRC Gene

No data available for Paralogs for HRC Gene

Variants for HRC Gene

Sequence variations from dbSNP and Humsavar for HRC Gene

SNP ID Clin Chr 19 pos Variation AA Info Type
rs61355957 likely-benign, Progressive familial heart block 49,154,454(-) CATCATCATCATCATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC/CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCATC coding_sequence_variant, inframe_deletion, inframe_insertion
rs1000176076 -- 49,155,832(-) T/G upstream_transcript_variant
rs1001165739 -- 49,152,463(-) C/G intron_variant
rs1002428648 -- 49,151,691(-) C/G genic_downstream_transcript_variant, intron_variant
rs1003238759 -- 49,151,925(-) A/G downstream_transcript_variant, genic_downstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for HRC Gene

Variant ID Type Subtype PubMed ID
dgv3621n100 CNV gain 25217958
dgv667e214 CNV gain 21293372
esv2760526 CNV gain 21179565
esv3644616 CNV gain 21293372
nsv1060108 CNV gain 25217958
nsv470149 CNV loss 18288195
nsv524235 CNV gain 19592680
nsv833859 CNV loss 17160897
nsv9739 CNV gain+loss 18304495

Variation tolerance for HRC Gene

Residual Variation Intolerance Score: 92.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 10.86; 91.80% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for HRC Gene

Human Gene Mutation Database (HGMD)
HRC
SNPedia medical, phenotypic, and genealogical associations of SNPs for
HRC

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for HRC Gene

Disorders for HRC Gene

MalaCards: The human disease database

(2) MalaCards diseases for HRC Gene - From: HGMD, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
mixed glioma
  • mixed gliomas
dilated cardiomyopathy
  • cardiomyopathy, familial idiopathic
- elite association - COSMIC cancer census association via MalaCards
Search HRC in MalaCards View complete list of genes associated with diseases

Additional Disease Information for HRC

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with HRC: view

No data available for UniProtKB/Swiss-Prot and Genatlas for HRC Gene

Publications for HRC Gene

  1. cDNA and genomic cloning of HRC, a human sarcoplasmic reticulum protein, and localization of the gene to human chromosome 19 and mouse chromosome 7. (PMID: 2037293) Hofmann SL … Francke U (Genomics 1991) 2 3 4 22 58
  2. The Ser96Ala variant in histidine-rich calcium-binding protein is associated with life-threatening ventricular arrhythmias in idiopathic dilated cardiomyopathy. (PMID: 18617481) Arvanitis DA … Kranias EG (European heart journal 2008) 3 22 44 58
  3. Histidine-rich Ca-binding protein interacts with sarcoplasmic reticulum Ca-ATPase. (PMID: 17526652) Arvanitis DA … Kranias EG (American journal of physiology. Heart and circulatory physiology 2007) 3 22 58
  4. Regulation of myocardial function by histidine-rich, calcium-binding protein. (PMID: 15191886) Fan GC … Kranias EG (American journal of physiology. Heart and circulatory physiology 2004) 3 22 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for HRC Gene

Sources for HRC Gene

Content
Loading form....