Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HOTTIP Gene

Subcategory (RNA class) for HOTTIP Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for HOTTIP Gene

  • HOXA Distal Transcript Antisense RNA 2 3 5
  • HOXA Distal Transcript Antisense RNA (Non-Protein Coding) 2 3
  • HOXA Cluster Antisense RNA 6 (Non-Protein Coding) 2 3
  • HOXA13 Antisense RNA 1 (Non-Protein Coding) 2 3
  • HOXA Transcript At The Distal Tip 2
  • HoxA Transcript At The Distal Tip 3
  • Non-Protein Coding RNA 213 2
  • HOXA13-AS1 3
  • NCRNA00213 3
  • HOXA-AS6 3

External Ids for HOTTIP Gene

Previous HGNC Symbols for HOTTIP Gene

  • NCRNA00213

Previous GeneCards Identifiers for HOTTIP Gene

  • GC07P027246
  • GC07P027249
  • GC07P027251
  • GC07P027257

Summaries for HOTTIP Gene

GeneCards Summary for HOTTIP Gene

HOTTIP (HOXA Distal Transcript Antisense RNA) is an RNA Gene, and is affiliated with the non-coding RNA class.

Additional gene information for HOTTIP Gene

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HOTTIP Gene

Genomics for HOTTIP Gene

Regulatory Elements for HOTTIP Gene

Enhancers for HOTTIP Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH07H027095 3.3 VISTA FANTOM5 Ensembl ENCODE dbSUPER 11.2 -60.4 -60380 86 MLX FEZF1 DMAP1 YY1 ZNF143 SP3 NFYC ZC3H11A SSRP1 ZNF610 HNRNPA2B1 HOTAIRM1 HOXA10-AS HOXA2 HOXA-AS2 CBX3 HOXA9 HOXA11-AS HOXA10 TPM3P4
GH07H027920 1.1 Ensembl ENCODE 11.6 +722.7 722740 0 ZNF76 BMI1 FEZF1 ZNF2 RAD21 RFX5 ZSCAN5C ZNF654 ZNF362 ZEB2 ENSG00000253508 HOTTIP HOXA13 HOXA11 HOXA11-AS HOXA10 HOXA9 ENSG00000253308 EVX1 EVX1-AS
GH07H028082 1.3 FANTOM5 Ensembl ENCODE 9.2 +885.1 885109 2 FOXA2 CEBPB REST EP300 RFX5 YY1 JUND ATF3 POLR2A STAT3 JAZF1 JAZF1-AS1 HOXA11 HOXA11-AS HOXA9 HOXA10 HOXA13 ENSG00000253508 HOTTIP EVX1-AS
GH07H028018 1.1 Ensembl ENCODE 10.8 +821.2 821178 2 GTF2F1 CTCF RB1 MAX ZNF2 RAD21 RFX5 ZBTB48 SMC3 ZNF143 HOXA13 ENSG00000253508 HOTTIP HOXA11 HOXA10 HOXA11-AS HOXA9 PIR54187 PIR39851
GH07H027602 1 FANTOM5 ENCODE dbSUPER 10.6 +404.3 404273 1 PRDM6 POU5F1 HIBADH HOTTIP HOXA13 ENSG00000253508 TSL PIR36003
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around HOTTIP on UCSC Golden Path with GeneCards custom track

Promoters for HOTTIP Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000209863 1325 601 STAT1 SP3 SUZ12 ZNF76 SIN3A ZBTB8A SMARCB1 E2F1 POLR2A ZFX

Genomic Location for HOTTIP Gene

Chromosome:
7
Start:
27,198,575 bp from pter
End:
27,207,259 bp from pter
Size:
8,685 bases
Orientation:
Plus strand

Genomic View for HOTTIP Gene

Genes around HOTTIP on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HOTTIP Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HOTTIP Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HOTTIP Gene

Proteins for HOTTIP Gene

Post-translational modifications for HOTTIP Gene

No Post-translational modifications

No data available for DME Specific Peptides for HOTTIP Gene

Domains & Families for HOTTIP Gene

Gene Families for HOTTIP Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with HOTTIP: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for HOTTIP Gene

Function for HOTTIP Gene

Phenotypes From GWAS Catalog for HOTTIP Gene

Animal Model Products

CRISPR Products

Clone Products

  • Applied Biological Materials Clones for HOTTIP
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for HOTTIP Gene

Localization for HOTTIP Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for HOTTIP Gene

Pathways & Interactions for HOTTIP Gene

SuperPathways for HOTTIP Gene

No Data Available

Interacting Proteins for HOTTIP Gene

Gene Ontology (GO) - Biological Process for HOTTIP Gene

None

No data available for Pathways by source and SIGNOR curated interactions for HOTTIP Gene

Drugs & Compounds for HOTTIP Gene

No Compound Related Data Available

Transcripts for HOTTIP Gene

mRNA/cDNA for HOTTIP Gene

(3) Additional mRNA sequences :
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HOTTIP Gene

HOXA distal transcript antisense RNA:
Representative Sequences:

CRISPR Products

Clone Products

  • Applied Biological Materials Clones for HOTTIP
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for HOTTIP Gene

No ASD Table

Relevant External Links for HOTTIP Gene

GeneLoc Exon Structure for
HOTTIP
ECgene alternative splicing isoforms for
HOTTIP

Expression for HOTTIP Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HOTTIP Gene

mRNA differential expression in normal tissues according to GTEx for HOTTIP Gene

This gene is overexpressed in Colon - Transverse (x15.4), Cervix - Endocervix (x8.3), Cervix - Ectocervix (x7.9), Prostate (x7.7), Vagina (x6.2), and Bladder (x5.4).

NURSA nuclear receptor signaling pathways regulating expression of HOTTIP Gene:

HOTTIP

SOURCE GeneReport for Unigene cluster for HOTTIP Gene:

Hs.199486
genes like me logo Genes that share expression patterns with HOTTIP: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for HOTTIP Gene

Orthologs for HOTTIP Gene

Evolution for HOTTIP Gene

ENSEMBL:
Gene Tree for HOTTIP (if available)
TreeFam:
Gene Tree for HOTTIP (if available)

No data available for Orthologs for HOTTIP Gene

Paralogs for HOTTIP Gene

No data available for Paralogs for HOTTIP Gene

Variants for HOTTIP Gene

Sequence variations from dbSNP and Humsavar for HOTTIP Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type
rs387906542 Pathogenic 27,199,671(-) GTCCT(-/GCTGCTGCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCT)CGGGA upstream-variant-2KB, reference, frameshift-variant
rs1000060724 -- 27,207,507(+) AATTT(C/T)TTTGA downstream-variant-500B
rs1000111576 -- 27,200,792(+) GGACT(A/G)CATTT nc-transcript-variant, upstream-variant-2KB
rs1000450095 -- 27,198,768(+) CTCCT(G/T)TCTGG intron-variant, upstream-variant-2KB
rs1000965196 -- 27,200,553(+) GAGAG(A/T)GGGGA intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for HOTTIP Gene

Variant ID Type Subtype PubMed ID
dgv1094n67 CNV gain 20364138
nsv519583 CNV gain 19592680
nsv5675 CNV insertion 18451855
nsv606468 CNV loss 21841781
nsv606469 CNV loss 21841781
nsv7393 OTHER inversion 18451855
nsv824042 CNV gain 20364138

Relevant External Links for HOTTIP Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
HOTTIP

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for HOTTIP Gene

Disorders for HOTTIP Gene

Relevant External Links for HOTTIP

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
HOTTIP

No disorders were found for HOTTIP Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for HOTTIP Gene

Publications for HOTTIP Gene

  1. Multiple knockout mouse models reveal lincRNAs are required for life and brain development. (PMID: 24381249) Sauvageau M … Rinn JL (eLife 2013) 2 3 60
  2. Non-coding RNA: HOTTIP goes the distance. (PMID: 21483457) Burgess DJ (Nature reviews. Genetics 2011) 2 3 60
  3. A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. (PMID: 21423168) Wang KC … Chang HY (Nature 2011) 2 3 60
  4. Psip1/p52 regulates posterior Hoxa genes through activation of lncRNA Hottip. (PMID: 28384324) Pradeepa MM … Bickmore WA (PLoS genetics 2017) 3 60
  5. Long non-coding RNA HOTTIP, a novel potential prognostic marker in cancers. (PMID: 28164688) Hu L … Xiong S (Minerva medica 2017) 3 60

Products for HOTTIP Gene

Sources for HOTTIP Gene

Content
Loading form....