Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HOTTIP Gene

Subcategory (RNA class) for HOTTIP Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for HOTTIP Gene

  • HOXA Distal Transcript Antisense RNA 2 3 5
  • HOXA Distal Transcript Antisense RNA (Non-Protein Coding) 2 3
  • HOXA Cluster Antisense RNA 6 (Non-Protein Coding) 2 3
  • HOXA13 Antisense RNA 1 (Non-Protein Coding) 2 3
  • HOXA Transcript At The Distal Tip 2
  • HoxA Transcript At The Distal Tip 3
  • Non-Protein Coding RNA 213 2
  • HOXA13-AS1 3
  • NCRNA00213 3
  • HOXA-AS6 3

External Ids for HOTTIP Gene

Previous HGNC Symbols for HOTTIP Gene

  • NCRNA00213

Previous GeneCards Identifiers for HOTTIP Gene

  • GC07P027246
  • GC07P027249
  • GC07P027251
  • GC07P027257

Summaries for HOTTIP Gene

GeneCards Summary for HOTTIP Gene

HOTTIP (HOXA Distal Transcript Antisense RNA) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HOTTIP Gene

Genomics for HOTTIP Gene

Regulatory Elements for HOTTIP Gene

Enhancers for HOTTIP Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH07G027920 1.1 Ensembl ENCODE 11.6 +722.7 722740 0.6 SIN3A ZNF76 BMI1 FEZF1 ZNF2 RAD21 RFX5 ZSCAN5C FOS RELB HOTTIP HOXA13 ENSG00000253508 HOXA11 HOXA11-AS HOXA9 HOXA10 ENSG00000253308 EVX1 EVX1-AS
GH07G028082 1.3 FANTOM5 Ensembl ENCODE 9.2 +885.1 885109 2.6 BHLHE40 CEBPB NR3C1 EP300 RFX5 YY1 FOXA1 JUND ATF3 STAT3 JAZF1 JAZF1-AS1 HOXA11 HOXA11-AS HOXA9 HOXA10 ENSG00000253508 HOXA13 HOTTIP EVX1-AS
GH07G027602 1.1 FANTOM5 ENCODE dbSUPER 10.6 +404.3 404273 1.1 ZNF263 PRDM6 PBX2 POU5F1 CHD7 YY1 HIBADH ENSG00000253508 HOTTIP HOXA13 TSL PIR36003
GH07G028018 1 Ensembl ENCODE 10.8 +821.2 821178 2.2 GTF2F1 CTCF ESRRA RB1 WRNIP1 MAX ZNF2 RAD21 RFX5 ZBTB48 ENSG00000253508 HOXA13 HOTTIP HOXA11 HOXA10 HOXA11-AS HOXA9 PIR54187 PIR39851
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around HOTTIP on UCSC Golden Path with GeneCards custom track

Promoters for HOTTIP Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000209863 1325 601 SUZ12 ZNF76 SIN3A E2F1 POLR2A PCBP1 TCF7L2 EZH2 SP3 STAT1

Genomic Location for HOTTIP Gene

27,198,575 bp from pter
27,207,259 bp from pter
8,685 bases
Plus strand

Genomic View for HOTTIP Gene

Genes around HOTTIP on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HOTTIP Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HOTTIP Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for HOTTIP Gene

Proteins for HOTTIP Gene

Post-translational modifications for HOTTIP Gene

No Post-translational modifications

No data available for DME Specific Peptides for HOTTIP Gene

Domains & Families for HOTTIP Gene

Gene Families for HOTTIP Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with HOTTIP: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for HOTTIP Gene

Function for HOTTIP Gene

Animal Model Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for HOTTIP Gene

Localization for HOTTIP Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for HOTTIP Gene

Pathways & Interactions for HOTTIP Gene

SuperPathways for HOTTIP Gene

No Data Available

Interacting Proteins for HOTTIP Gene

Gene Ontology (GO) - Biological Process for HOTTIP Gene


No data available for Pathways by source and SIGNOR curated interactions for HOTTIP Gene

Drugs & Compounds for HOTTIP Gene

No Compound Related Data Available

Transcripts for HOTTIP Gene


(3) Additional mRNA sequences :
(5) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HOTTIP Gene

HOXA distal transcript antisense RNA:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for HOTTIP Gene

No ASD Table

Relevant External Links for HOTTIP Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for HOTTIP Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for HOTTIP Gene

mRNA differential expression in normal tissues according to GTEx for HOTTIP Gene

This gene is overexpressed in Colon - Transverse (x15.4), Cervix - Endocervix (x8.3), Cervix - Ectocervix (x7.9), Prostate (x7.7), Vagina (x6.2), and Bladder (x5.4).

NURSA nuclear receptor signaling pathways regulating expression of HOTTIP Gene:


SOURCE GeneReport for Unigene cluster for HOTTIP Gene:

genes like me logo Genes that share expression patterns with HOTTIP: view

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for HOTTIP Gene

Orthologs for HOTTIP Gene

Evolution for HOTTIP Gene

Gene Tree for HOTTIP (if available)
Gene Tree for HOTTIP (if available)

No data available for Orthologs for HOTTIP Gene

Paralogs for HOTTIP Gene

No data available for Paralogs for HOTTIP Gene

Variants for HOTTIP Gene

Sequence variations from dbSNP and Humsavar for HOTTIP Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type
rs387906542 Pathogenic 27,199,671(-) GTCCT(-/GCTGCTGCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCT)CGGGA upstream-variant-2KB, reference, frameshift-variant
rs1000060724 -- 27,207,507(+) AATTT(C/T)TTTGA downstream-variant-500B
rs1000111576 -- 27,200,792(+) GGACT(A/G)CATTT nc-transcript-variant, upstream-variant-2KB
rs1000450095 -- 27,198,768(+) CTCCT(G/T)TCTGG intron-variant, upstream-variant-2KB
rs1000965196 -- 27,200,553(+) GAGAG(A/T)GGGGA intron-variant, upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for HOTTIP Gene

Variant ID Type Subtype PubMed ID
dgv1094n67 CNV gain 20364138
nsv519583 CNV gain 19592680
nsv5675 CNV insertion 18451855
nsv606468 CNV loss 21841781
nsv606469 CNV loss 21841781
nsv7393 OTHER inversion 18451855
nsv824042 CNV gain 20364138

Relevant External Links for HOTTIP Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for HOTTIP Gene

Disorders for HOTTIP Gene

Relevant External Links for HOTTIP

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for HOTTIP Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for HOTTIP Gene

Publications for HOTTIP Gene

  1. Multiple knockout mouse models reveal lincRNAs are required for life and brain development. (PMID: 24381249) Sauvageau M. … Rinn J.L. (Elife 2013) 2 3 64
  2. A long noncoding RNA maintains active chromatin to coordinate homeotic gene expression. (PMID: 21423168) Wang K.C. … Chang H.Y. (Nature 2011) 2 3 64
  3. Non-coding RNA: HOTTIP goes the distance. (PMID: 21483457) Burgess D.J. (Nat. Rev. Genet. 2011) 2 3 64
  4. Long non-coding RNA HOTTIP, a novel potential prognostic marker in cancers. (PMID: 28164688) Hu L. … Xiong S. (Minerva Med. 2017) 3 64
  5. Long noncoding RNA HOTTIP contributes to the progression of prostate cancer by regulating HOXA13. (PMID: 27064878) Zhang S.R. … Zhao L.C. (Cell. Mol. Biol. (Noisy-le-grand) 2016) 3 64

Products for HOTTIP Gene

Sources for HOTTIP Gene

Loading form....