Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



HIPK3 Gene

protein-coding   GIFtS: 60
GCID: GC11P033278

Homeodomain Interacting Protein Kinase 3

(Previous name: homeodomain-interacting protein kinase 3)
  Search for HIPK3
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Homeodomain Interacting Protein Kinase 31 2     Homolog Of Protein Kinase YAK12 3
DYRK62 3 5     ANPK2 3
PKY2 3 5     FIST2 3
Homeodomain-Interacting Protein Kinase 31 2     FIST32 3
Androgen Receptor-Interacting Nuclear Protein Kinase2 3     EC 2.7.11.13 8
Fas-Interacting Serine/Threonine-Protein Kinase2 3     YAK12

External Ids:    HGNC: 49151   Entrez Gene: 101142   Ensembl: ENSG000001104227   OMIM: 6044245   UniProtKB: Q9H4223   

Export aliases for HIPK3 gene to outside databases

Previous GC identifers: GC11P034811 GC11P033957 GC11P033318 GC11P033272 GC11P033264 GC11P033235 GC11P032973


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

GeneCards Summary for HIPK3 Gene:
HIPK3 (homeodomain interacting protein kinase 3) is a protein-coding gene. GO annotations related to this gene include protein serine/threonine kinase activity and protein kinase activity. An important paralog of this gene is DYRK1A.

UniProtKB/Swiss-Prot: HIPK3_HUMAN, Q9H422
Function: Serine/threonine-protein kinase involved in transcription regulation, apoptosis and steroidogenic gene
expression. Phosphorylates JUN and RUNX2. Seems to negatively regulate apoptosis by promoting FADD
phosphorylation. Enhances androgen receptor-mediated transcription. May act as a transcriptional corepressor for
NK homeodomain transcription factors. The phosphorylation of NR5A1 activates SF1 leading to increased
steroidogenic gene expression upon cAMP signaling pathway stimulation. In osteoblasts, supports transcription
activation: phosphorylates RUNX2 that synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the
osteocalcin FGF-responsive element (OCFRE)

Gene Wiki entry for HIPK3 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence at NCBI GenBank:
NC_000011.9  NT_009237.19  NC_018922.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the HIPK3 gene promoter:
         HFH-3   AhR   Sox5   Nkx2-5   Evi-1   CREB   FOXI1   deltaCREB   STAT3   Pax-4a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 3): HIPK3 promoter sequence
   Search Chromatin IP Primers for HIPK3

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat HIPK3


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 11p13   Ensembl cytogenetic band:  11p13   HGNC cytogenetic band: 11p13

HIPK3 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
HIPK3 gene location

GeneLoc information about chromosome 11         GeneLoc Exon Structure

GeneLoc location for GC11P033278:  view genomic region     (about GC identifiers)

Start:
33,278,218 bp from pter      End:
33,378,569 bp from pter
Size:
100,352 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: HIPK3_HUMAN, Q9H422 (See protein sequence)
Recommended Name: Homeodomain-interacting protein kinase 3  
Size: 1215 amino acids; 133743 Da
Subunit: Interacts with Nkx1-2. Interacts with FAS and DAXX. Probably part of a complex consisting of HIPK3, FAS
and FADD. Interacts with and stabilizes ligand-bound androgen receptor (AR) (By similarity). Interacts with
UBL1/SUMO-1. Binds to NR5A1/SF1, SPEN/MINT and RUNX2
Secondary accessions: O14632 Q2PBG4 Q2PBG5 Q92632 Q9HAS2
Alternative splicing: 2 isoforms:  Q9H422-1   Q9H422-2   

Explore the universe of human proteins at neXtProt for HIPK3: NX_Q9H422

Explore proteomics data for HIPK3 at MOPED

Post-translational modifications: 

  • Autophosphorylated, but autophosphorylation is not required for catalytic activity (By similarity)1
  • May be sumoylated (By similarity)1
  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus
  • Selected DME Specific Peptides for HIPK3 (Q9H422) (see all 12)
     ETLNHPF  SDTDEEE  HLLDFPHS  CGLKRKSEE 


    See HIPK3 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins (4 alternative transcripts): 
    NP_001041665.1  NP_001265091.1  NP_001265092.1  NP_005725.3  

    ENSEMBL proteins: 
     ENSP00000431710   ENSP00000304226   ENSP00000368301   ENSP00000433594   ENSP00000398241  

    HIPK3 Human Recombinant Protein Products:

    EMD Millipore Purified and/or Recombinant HIPK3 Protein
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for HIPK3
    OriGene Custom MassSpec
    OriGene Custom Protein Services for HIPK3
    GenScript Custom Purified and Recombinant Proteins Services for HIPK3
    Novus Biologicals HIPK3 Proteins
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for HIPK3

     
    Search eBioscience for Proteins for HIPK3 

    HIPK3 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for HIPK3
    OriGene Custom Antibody Services for HIPK3
    Novus Biologicals HIPK3 Antibodies
    Abcam antibodies for HIPK3
    Cloud-Clone Corp. Antibodies for HIPK3
    ThermoFisher Antibodies for HIPK3
    LSBio Antibodies in human, mouse, rat for HIPK3

    HIPK3 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for HIPK3
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for HIPK3
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for HIPK3
    Cloud-Clone Corp. CLIAs for HIPK3
    Search eBioscience for ELISAs for HIPK3 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    IUPHAR Guide to PHARMACOLOGY protein family classification: homeodomain interacting protein kinase 3
    HIPK subfamily

    5 InterPro protein domains:
     IPR017441 Protein_kinase_ATP_BS
     IPR002290 Ser/Thr_dual-sp_kinase_dom
     IPR011009 Kinase-like_dom
     IPR008271 Ser/Thr_kinase_AS
     IPR000719 Prot_kinase_dom

    Graphical View of Domain Structure for InterPro Entry Q9H422

    ProtoNet protein and cluster: Q9H422

    UniProtKB/Swiss-Prot: HIPK3_HUMAN, Q9H422
    Similarity: Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. HIPK subfamily
    Similarity: Contains 1 protein kinase domain


    Find genes that share domains with HIPK3           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: HIPK3_HUMAN, Q9H422
    Function: Serine/threonine-protein kinase involved in transcription regulation, apoptosis and steroidogenic gene
    expression. Phosphorylates JUN and RUNX2. Seems to negatively regulate apoptosis by promoting FADD
    phosphorylation. Enhances androgen receptor-mediated transcription. May act as a transcriptional corepressor for
    NK homeodomain transcription factors. The phosphorylation of NR5A1 activates SF1 leading to increased
    steroidogenic gene expression upon cAMP signaling pathway stimulation. In osteoblasts, supports transcription
    activation: phosphorylates RUNX2 that synergizes with SPEN/MINT to enhance FGFR2-mediated activation of the
    osteocalcin FGF-responsive element (OCFRE)
    Catalytic activity: ATP + a protein = ADP + a phosphoprotein

         Genatlas biochemistry entry for HIPK3:
    homeodomain interacting protein kinase 3,highly expressed in heart and muscle tissue,localizing in nuclear
    speckles,corepressor for homeo domain transcription factors,maybe involved in cell cycle
    regulation,over-expressed in multidrugg resistant cell-lines

         Enzyme Number (IUBMB): EC 2.7.11.11 2

         Gene Ontology (GO): Selected molecular function terms (see all 7):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004672protein kinase activity IDA14766760
    GO:0004674protein serine/threonine kinase activity ISS11034606
    GO:0004713protein tyrosine kinase activity ----
    GO:0005515protein binding ----
    GO:0005524ATP binding IEA--
         
    Find genes that share ontologies with HIPK3           About GenesLikeMe


    Phenotypes:
         1 GenomeRNAi human phenotype for HIPK3:
     Increased G2M DNA content 

         4 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Hipk3):
     cellular  endocrine/exocrine gland  homeostasis/metabolism  no phenotypic analysis 

    Find genes that share phenotypes with HIPK3           About GenesLikeMe

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for HIPK3
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for HIPK3

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for HIPK3
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for HIPK3

    miRNA
    Products:
        
    miRTarBase miRNAs that target HIPK3:
    hsa-mir-335-5p (MIRT018461), hsa-mir-19b-3p (MIRT004064), hsa-mir-20b-5p (MIRT001782), hsa-mir-1 (MIRT023984), hsa-mir-124-3p (MIRT022918), hsa-mir-106a-5p (MIRT001837), hsa-mir-92a-3p (MIRT004090)

    Block miRNA regulation of human, mouse, rat HIPK3 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate HIPK3 (see all 71):
    hsa-miR-520e hsa-miR-3653 hsa-miR-578 hsa-miR-519a hsa-miR-3622b-3p hsa-miR-642b hsa-miR-3174 hsa-miR-92b
    SwitchGear 3'UTR luciferase reporter plasmidHIPK3 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for HIPK3
    Predesigned siRNA for gene silencing in human, mouse, rat HIPK3

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for HIPK3

    Clone
    Products:
         
    OriGene clones in human, mouse for HIPK3 (see all 15)
    OriGene ORF clones in mouse, rat for HIPK3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): HIPK3 (NM_005734)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for HIPK3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HIPK3
    Addgene plasmids for HIPK3 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for HIPK3
    Browse ESI BIO Cell Lines and PureStem Progenitors for HIPK3 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HIPK3


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    HIPK3_HUMAN, Q9H422: Cytoplasm. Nucleus
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    nucleus5
    cytosol3
    endoplasmic reticulum1
    mitochondrion1
    plasma membrane1

    Gene Ontology (GO): 4 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA--
    GO:0005737cytoplasm IDA--
    GO:0016020membrane ----
    GO:0016605PML body IEA--

    Find genes that share ontologies with HIPK3           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus



        Pathway & Disease-focused RT2 Profiler PCR Array including HIPK3: 
              Apoptosis 384HT in human mouse rat

    Interactions:

        GeneGlobe Interaction Network for HIPK3

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for HIPK3 (Q9H4222, 3 ENSP000003042264) via UniProtKB, MINT, STRING, and/or I2D (see all 96)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    HEYLQ9NQ872, 3, ENSP000003619434MINT-61740 I2D: score=3 STRING: ENSP00000361943
    LIMD1Q9UGP42, 3, ENSP000002733174MINT-61750 I2D: score=3 STRING: ENSP00000273317
    ARRB2P321212, 3MINT-61748 I2D: score=3 
    C1QAP027452, 3MINT-61745 I2D: score=3 
    GORASP1Q9BQQ32, 3MINT-61752 I2D: score=3 
    About this table

    Gene Ontology (GO): Selected biological process terms (see all 9):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006355regulation of transcription, DNA-templated IEA--
    GO:0006468protein phosphorylation IDA14766760
    GO:0006915apoptotic process IEA--
    GO:0009103lipopolysaccharide biosynthetic process ----
    GO:0009299mRNA transcription IDA17210646

    Find genes that share ontologies with HIPK3           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for HIPK3

    2 HMDB Compounds for HIPK3    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--

    2 Novoseek inferred chemical compound relationships for HIPK3 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    threonine 36.2 2 10961928 (1), 9373137 (1)
    serine 22 2 10961928 (1), 9373137 (1)



    Find genes that share compounds with HIPK3           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for HIPK3 gene (4 alternative transcripts): 
    NM_001048200.2  NM_001278162.1  NM_001278163.1  NM_005734.4  

    Unigene Cluster for HIPK3:

    Homeodomain interacting protein kinase 3
    Hs.201918  [show with all ESTs]
    Unigene Representative Sequence: NM_005734
    6 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000525975 ENST00000303296(uc001mul.1) ENST00000379016(uc001mum.1)
    ENST00000531504 ENST00000534262(uc009yjw.1) ENST00000456517(uc009yjv.1)

    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat HIPK3 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate HIPK3 (see all 71):
    hsa-miR-520e hsa-miR-3653 hsa-miR-578 hsa-miR-519a hsa-miR-3622b-3p hsa-miR-642b hsa-miR-3174 hsa-miR-92b
    SwitchGear 3'UTR luciferase reporter plasmidHIPK3 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for HIPK3
    Predesigned siRNA for gene silencing in human, mouse, rat HIPK3
    Clone
    Products:
         
    OriGene clones in human, mouse for HIPK3 (see all 15)
    OriGene ORF clones in mouse, rat for HIPK3
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector (see all 2): HIPK3 (NM_005734)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for HIPK3
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HIPK3
    Addgene plasmids for HIPK3 
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for HIPK3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HIPK3
      QuantiTect SYBR Green Assays in human, mouse, rat HIPK3
      QuantiFast Probe-based Assays in human, mouse, rat HIPK3

    Additional mRNA sequence: 

    AF004849.1 AF305239.1 AK293009.1 AK304063.1 AK315277.1 AY425958.1 Y09306.1 

    6 DOTS entries:

    DT.95162334  DT.213566  DT.40312677  DT.86852349  DT.430672  DT.95162333 

    Selected AceView cDNA sequences (see all 122):

    BM662067 AA788819 AA555172 AY425958 BM828164 AI123918 AF305239 AW819916 
    BE003823 BM820433 AA341581 BX503224 BU674709 BU508689 AI803943 BM751730 
    AA504423 AA897698 AA361465 BF110365 AL701033 AI744863 BX500487 AI357260 

    GeneLoc Exon Structure

    2 Alternative Splicing Database (ASD) splice patterns (SP) for HIPK3    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12 ^ 13 ^ 14 ^ 15 ^ 16a · 16b
    SP1:                                                                                                      
    SP2:                                                              -                                       


    ECgene alternative splicing isoforms for HIPK3

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    HIPK3 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: GCACAAGAAA
    HIPK3 Expression
    About this image


    HIPK3 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 4) fully expand
     
     Limb (Muscoskeletal System)    fully expand to see all 3 entries
             Mesenchymal Condensate Cells Zeugopod
             Zeugopod
     
     Bone (Muscoskeletal System)    fully expand to see all 2 entries
             Mesenchymal Condensate Cells Zeugopod
             Zeugopod Long Bone
     
     Gut Tube (Gastrointestinal Tract)
             Foregut
     
     Cartilage (Muscoskeletal System)
             Mesenchymal Condensate Cells Zeugopod
    HIPK3 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    HIPK3 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.201918

    UniProtKB/Swiss-Prot: HIPK3_HUMAN, Q9H422
    Tissue specificity: Overexpressed in multidrug resistant cells. Highly expressed in heart and skeletal muscle, and
    at lower levels in placenta, pancreas, brain, spleen, prostate, thymus, testis, small intestine, colon and
    leukocytes. Not found in liver and lung

        Pathway & Disease-focused RT2 Profiler PCR Array including HIPK3: 
              Apoptosis 384HT in human mouse rat

    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for HIPK3
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HIPK3
    QuantiTect SYBR Green Assays in human, mouse, rat HIPK3
    QuantiFast Probe-based Assays in human, mouse, rat HIPK3
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HIPK3

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of animals and fungi.

    Orthologs for HIPK3 gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Hipk31 , 5 homeodomain interacting protein kinase 31, 5 88.89(n)1
    90.76(a)1
      2 (54.74 cM)5
    152591  NM_010434.21  NP_034564.21 
     1044264815 
    chicken
    (Gallus gallus)
    Aves HIPK31 homeodomain interacting protein kinase 3 80.56(n)
    81.88(a)
      421597  NM_001199411.1  NP_001186340.2 
    lizard
    (Anolis carolinensis)
    Reptilia HIPK36
    homeodomain interacting protein kinase 3
    79(a)
    1 ↔ 1
    1(61643301-61705287)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.105382 Xenopus laevis transcribed sequence with weak similarity more 76.19(n)    BM331714.1 
    zebrafish
    (Danio rerio)
    Actinopterygii hipk3b1 homeodomain interacting protein kinase 3b 67.08(n)
    67.34(a)
      569156  NM_001080159.2  NP_001073628.1 
    fruit fly
    (Drosophila melanogaster)
    Insecta hipk6
    homeodomain interacting protein kinase
    33(a)
    1 → many
    3L(543060-581099)
    worm
    (Caenorhabditis elegans)
    Secernentea hpk-16
    Protein HPK-1, isoform c (hpk-1) mRNA, complete cd...
    40(a)
    1 → many
    X(4210654-4217290) WBGene00001994
    baker's yeast
    (Saccharomyces cerevisiae)
    Saccharomycetes YAK16
    Serine-threonine protein kinase; component of a gl...
    25(a)
    1 → many
    X(147967-150390) YJL141C


    ENSEMBL Gene Tree for HIPK3 (if available)
    TreeFam Gene Tree for HIPK3 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for HIPK3 gene
    DYRK1A2  DYRK22  DYRK32  HIPK12  ENSG000002729212  DYRK42  HIPK42  HIPK22  
    DYRK1B2  
    2 SIMAP similar genes for HIPK3 using alignment to 2 protein entries:     HIPK3_HUMAN (see all proteins):
    HIPK2    HIPK1

    Find genes that share paralogs with HIPK3           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for HIPK3 (see all 1878)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 11 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1417148791,2
    Cuntested133374746(+) TTTCTC/G/TATGGA 8 H Y mis10--------
    rs610942301,2
    C--33026835(+) TATCT-/ATC/TATCTATCTATC/
    TATCTATCTATCTATCTATC
    TATCT
    12 -- int1 cds10--------
    rs1125654291,2
    C--33276316(+) CAAGAC/TCATCC 1 -- us2k11Minor allele frequency- T:0.50CSA 2
    rs1929750631,2
    --33276438(+) TGAACC/GTGGGA 1 -- us2k10--------
    rs1490515861,2
    --33276490(+) GAGAAC/TCGCCT 1 -- us2k10--------
    rs1421021551,2
    --33276552(+) GAAGGA/GGAAGA 1 -- us2k10--------
    rs1511804781,2
    --33276598(+) GGTATA/TAAGTG 1 -- us2k10--------
    rs1824093501,2
    --33276649(+) TTACTA/GAGGTC 1 -- us2k10--------
    rs1171931581,2
    C,F--33276715(+) GATGAG/AGCCGG 1 -- us2k11Minor allele frequency- A:0.02EA 120
    rs2674501,2
    C,F,A--33276905(+) caggaG/Taattg 3 -- us2k14Minor allele frequency- T:0.05NA WA 124

    HapMap Linkage Disequilibrium report for HIPK3 (33278218 - 33378569 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 8 variations for HIPK3:    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2677639CNV Deletion23128226
    nsv521130CNV Gain19592680
    nsv467786CNV Gain19166990
    nsv897203CNV Gain21882294
    dgv1067n71CNV Gain21882294
    dgv1065n71CNV Gain21882294
    dgv11n68CNV Gain17160897
    nsv897202CNV Gain21882294

    Site Specific Mutation Identification with PCR Assays
    Search QIAGEN SeqTarget long-range PCR primers for resequencing HIPK3
    DNA2.0 Custom Variant and Variant Library Synthesis for HIPK3

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 604424    OMIM disorders: --


    Find genes that share disorders with HIPK3           About GenesLikeMe

    1 Novoseek inferred disease relationship for HIPK3 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    tumors 0 1 14766760 (1)

    Genetic Association Database (GAD): HIPK3
    Human Genome Epidemiology (HuGE) Navigator: HIPK3 (2 documents)

    Export disorders for HIPK3 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for HIPK3 gene, integrated from 10 sources (see all 29):
    (articles sorted by number of sources associating them with HIPK3)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification and sequence of human PKY, a putative kinase with increased expression in multidrug-resistant cells, with homology to yeast protein kinase Yak1. (PubMed id 9373137)1, 2, 3, 9 Begley D.A.... Abraham I. (Gene 1997)
    2. Cyclic AMP stimulates SF-1-dependent CYP11A1 expression through homeodomain-interacting protein kinase 3-mediated Jun N-terminal kinase and c-Jun phosphorylation. (PubMed id 17210646)1, 2, 9 Lan H.-C.... Chung B.-C. (Mol. Cell. Biol. 2007)
    3. JNK regulates HIPK3 expression and promotes resistance to Fas- mediated apoptosis in DU 145 prostate carcinoma cells. (PubMed id 14766760)1, 2, 9 Curtin J.F. and Cotter T.G. (J. Biol. Chem. 2004)
    4. MicroRNAs and target site screening reveals a pre-microRNA-30e variant associated with schizophrenia. (PubMed id 20347265)1, 4 Xu Y....Liu P. (Schizophr. Res. 2010)
    5. An approach based on a genome-wide association study reveals candidate loci for narcolepsy. (PubMed id 20677014)1, 4 Shimada M....Tokunaga K. (Hum. Genet. 2010)
    6. Human chromosome 11 DNA sequence and analysis including novel gene identification. (PubMed id 16554811)1, 2 Taylor T.D....Sakaki Y. (Nature 2006)
    7. Covalent modification of p73alpha by SUMO-1. Two-hybrid screening with p73 identifies novel SUMO-1-interacting proteins and a SUMO-1 interaction motif. (PubMed id 10961991)1, 2 Minty A.... Caput D. (J. Biol. Chem. 2000)
    8. FIST/HIPK3: a Fas/FADD-interacting serine/threonine kinase that induces FADD phosphorylation and inhibits Fas-mediated Jun NH2- terminal kinase activation. (PubMed id 11034606)1, 2 Rochat-Steiner V....Tschopp J. (J. Exp. Med. 2000)
    9. Activation of androgen receptor function by a novel nuclear protein kinase. (PubMed id 9725910)1, 2 Moilanen A.-M.... Palvimo J.J. (Mol. Biol. Cell 1998)
    10. Homeodomain-interacting protein kinases, a novel family of co-repressors for homeodomain transcription factors. (PubMed id 9748262)1, 3 Kim Y.H....Kim Y. (J. Biol. Chem. 1998)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 10114 HGNC: 4915 AceView: HIPK3 Ensembl:ENSG00000110422 euGenes: HUgn10114
    ECgene: HIPK3 H-InvDB: HIPK3

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for HIPK3 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for HIPK3 gene:
    Search GeneIP for patents involving HIPK3

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     EMD Millipore Purified and/or Recombinant HIPK3 Protein
     Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
     Browse Small Molecules at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for HIPK3   OriGene RNAi products in human, mouse, rat for HIPK3  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for HIPK3  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for HIPK3  
     OriGene qSTAR qPCR primer pairs in human, mouse for HIPK3   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for HIPK3   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for HIPK3   OriGene Custom Protein Services for HIPK3  

     
     
     Block miRNA regulation of human, mouse, rat HIPK3 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing HIPK3
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat HIPK3 Predesigned siRNA for gene silencing in human, mouse, rat HIPK3
     QuantiFast Probe-based Assays in human, mouse, rat HIPK3 QuantiTect SYBR Green Assays in human, mouse, rat HIPK3
     PCR Arrays including human, mouse, rat HIPK3 Search Chromatin IP Primers for HIPK3
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HIPK3  GeneGlobe Interaction Network for HIPK3
     Regulatory tfbs in HIPK3 promoter
     GenScript Custom Purified and Recombinant Proteins Services for HIPK3 GenScript cDNA clones with any tag delivered in your preferred vector for HIPK3
     GenScript Custom Assay Services for HIPK3 GenScript Custom overexpressing Cell Line Services for HIPK3
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for HIPK3
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     HIPK3 antibodies
     HIPK3 proteins
     Antibodies for HIPK3
     See all of Abcam's Antibodies, Kits and Proteins for HIPK3
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for HIPK3
     Antibodies for HIPK3
     ELISAs for HIPK3
     CLIAs for HIPK3



     Browse ESI BIO Cell Lines and PureStem Progenitors for HIPK3
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HIPK3
     SwitchGear 3'UTR luciferase reporter plasmids for HIPK3
     SwitchGear Promoter luciferase reporter plasmids for HIPK3
     ThermoFisher Antibodies for HIPK3
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HIPK3
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for HIPK3
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for HIPK3
     LSBio Antibodies in human, mouse, rat for HIPK3
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Addgene plasmids for HIPK3
      Search eBioscience for proteins for HIPK3
      Search eBioscience for elisas for HIPK3
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      HIPK3 gene at Home site.
    Version: 3.12.212 17 Sep 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4