Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



HEXIM1 Gene

protein-coding   GIFtS: 53
GCID: GC17P043224

Hexamethylene Bis-Acetamide Inducible 1

  Try our

disease database 

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
Hexamethylene Bis-Acetamide Inducible 11 2     MAQ12 3
CLP12 3 5     HMBA-inducible2
HIS12 3 5     Hexamethylene Bisacetamide-Inducible Protein2
Cardiac Lineage Protein 12 3     Hexamethylene-Bis-Acetamide-Inducible Transcript 12
Estrogen Down-Regulated Gene 1 Protein2 3     Hexamthylene Bis-Acetamide Inducible 12
Hexamethylene Bis-Acetamide-Inducible Protein 12 3     Menage A Quatre 12
Menage A Quatre Protein 12 3     Protein HEXIM12
EDG12 3     

External Ids:    HGNC: 249531   Entrez Gene: 106142   Ensembl: ENSG000001868347   OMIM: 6073285   UniProtKB: O949923   

Export aliases for HEXIM1 gene to outside databases

Previous GC identifers: GC17P040583 GC17P038987


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for HEXIM1 Gene:
Expression of this gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. This gene has
no introns. (provided by RefSeq, Jul 2008)

GeneCards Summary for HEXIM1 Gene:
HEXIM1 (hexamethylene bis-acetamide inducible 1) is a protein-coding gene. GO annotations related to this gene include cyclin-dependent protein serine/threonine kinase inhibitor activity and snRNA binding. An important paralog of this gene is HEXIM2.

UniProtKB/Swiss-Prot: HEXI1_HUMAN, O94992
Function: Transcriptional regulator which functions as a general RNA polymerase II transcription inhibitor. In
cooperation with 7SK snRNA sequesters P-TEFb in a large inactive 7SK snRNP complex preventing RNA polymerase II
phosphorylation and subsequent transcriptional elongation. May also regulate NF-kappa-B, ESR1, NR3C1 and
CIITA-dependent transcriptional activity

Gene Wiki entry for HEXIM1 Gene


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
Regulatory elements:
   Regulatory transcription factor binding sites in the HEXIM1 gene promoter:
         E2F-4   E2F-3a   E2F-5   E2F-1   E2F   E2F-2   Nkx2-5   C/EBPalpha   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidHEXIM1 promoter sequence
   Search Chromatin IP Primers for HEXIM1

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat HEXIM1


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 17q21.31   Ensembl cytogenetic band:  17q21.31   HGNC cytogenetic band: 17q21.31

HEXIM1 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
HEXIM1 gene location

GeneLoc information about chromosome 17         GeneLoc Exon Structure

GeneLoc location for GC17P043224:  view genomic region     (about GC identifiers)

Start:
43,224,684 bp from pter      End:
43,229,468 bp from pter
Size:
4,785 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: HEXI1_HUMAN, O94992 (See protein sequence)
Recommended Name: Protein HEXIM1  
Size: 359 amino acids; 40623 Da
Subunit: Homooligomer and heterooligomer with HEXIM2; probably dimeric. Component of the 7SK snRNP complex at
least composed of P-TEFb (composed of CDK9 and CCNT1/cyclin-T1), HEXIM1, HEXIM2, BCDIN3, SART3 proteins and 7SK
and U6 snRNAs. Interacts with the N-CoR complex through NCOR1. Interacts with ESR1 and NR3C1. May interact with
NF-kappa-B through RELA
Miscellaneous: Inhibits Tat activity which is required for HIV-1 transcription
2 PDB 3D structures from and Proteopedia for HEXIM1:
2GD7 (3D)        3S9G (3D)    
Secondary accessions: B2R8Y5

Explore the universe of human proteins at neXtProt for HEXIM1: NX_O94992

Explore proteomics data for HEXIM1 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See HEXIM1 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_006451.1  
    ENSEMBL proteins: 
     ENSP00000328773  

    HEXIM1 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate for HEXIM1
    OriGene Custom MassSpec
    OriGene Custom Protein Services for HEXIM1
    GenScript Custom Purified and Recombinant Proteins Services for HEXIM1
    Novus Biologicals HEXIM1 Proteins
    Novus Biologicals HEXIM1 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    ProSpec Recombinant Protein for HEXIM1
    Cloud-Clone Corp. Proteins for HEXIM1

     
    Search eBioscience for Proteins for HEXIM1 

    HEXIM1 Antibody Products:

    EMD Millipore Mono- and Polyclonal Antibodies for the study of HEXIM1
    R&D Systems Antibodies for HEXIM1 (Hexim 1)
    Cell Signaling Technology (CST) Antibodies for HEXIM1 
    OriGene Antibodies for HEXIM1
    OriGene Custom Antibody Services for HEXIM1
    Novus Biologicals HEXIM1 Antibodies
    Abcam antibodies for HEXIM1
    Cloud-Clone Corp. Antibodies for HEXIM1
    ThermoFisher Antibodies for HEXIM1
    LSBio Antibodies in human, mouse, rat for HEXIM1

    HEXIM1 Assay Products:

    EMD Millipore Kits and Assays for the Analysis of HEXIM1
    OriGene Custom Assay Services for HEXIM1
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for HEXIM1
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for HEXIM1
    Cloud-Clone Corp. CLIAs for HEXIM1
    Search eBioscience for ELISAs for HEXIM1 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR024872 HEXIM

    Graphical View of Domain Structure for InterPro Entry O94992

    ProtoNet protein and cluster: O94992

    UniProtKB/Swiss-Prot: HEXI1_HUMAN, O94992
    Domain: The coiled-coil domain mediates oligomerization
    Similarity: Belongs to the HEXIM family


    Find genes that share domains with HEXIM1           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: HEXI1_HUMAN, O94992
    Function: Transcriptional regulator which functions as a general RNA polymerase II transcription inhibitor. In
    cooperation with 7SK snRNA sequesters P-TEFb in a large inactive 7SK snRNP complex preventing RNA polymerase II
    phosphorylation and subsequent transcriptional elongation. May also regulate NF-kappa-B, ESR1, NR3C1 and
    CIITA-dependent transcriptional activity
    Induction: Up-regulated by HMBA (hexamethylene bisacetamide) (at protein level). Down-regulated by estrogen

         Gene Ontology (GO): 3 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004861cyclin-dependent protein serine/threonine kinase inhibitor activity IDA14580347
    GO:0005515protein binding IPI14580347
    GO:0017069snRNA binding IDA14580347
         
    Find genes that share ontologies with HEXIM1           About GenesLikeMe


    Phenotypes:
         3 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Hexim1):
     cardiovascular system  mortality/aging  muscle 

    Find genes that share phenotypes with HEXIM1           About GenesLikeMe

    Animal Models:
         MGI mouse knock-out Hexim1tm1Maqs for HEXIM1

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for HEXIM1
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for HEXIM1

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for HEXIM1
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for HEXIM1

    miRNA
    Products:
        
    miRTarBase miRNAs that target HEXIM1:
    hsa-mir-17-3p (MIRT050765), hsa-mir-20a-5p (MIRT050623), hsa-mir-324-3p (MIRT042951), hsa-mir-503-5p (MIRT041122), hsa-mir-17-5p (MIRT051053), hsa-mir-222-3p (MIRT046764)

    Block miRNA regulation of human, mouse, rat HEXIM1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate HEXIM1 (see all 48):
    hsa-miR-607 hsa-miR-3607-3p hsa-miR-550a* hsa-miR-10b* hsa-miR-124 hsa-miR-4330 hsa-miR-29a* hsa-miR-506
    SwitchGear 3'UTR luciferase reporter plasmidHEXIM1 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for HEXIM1
    Predesigned siRNA for gene silencing in human, mouse, rat HEXIM1

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for HEXIM1

    Clone
    Products:
         
    OriGene clones in human, mouse for HEXIM1 (see all 8)
    OriGene ORF clones in mouse, rat for HEXIM1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: HEXIM1 (NM_006460)
    Sino Biological Human cDNA Clone for HEXIM1
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for HEXIM1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HEXIM1

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for HEXIM1
    Browse ESI BIO Cell Lines and PureStem Progenitors for HEXIM1 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HEXIM1

    Flow Cytometry
    Products:
       

     
    eBioscience FlowRNA Probe Sets ( VA1-10512) for HEXIM1 


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    HEXI1_HUMAN, O94992: Nucleus. Cytoplasm. Note=Binds alpha-importin and is mostly nuclear
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    nucleus5
    cytosol2

    Gene Ontology (GO): 3 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus IDA--
    GO:0005730NOT nucleolus IDA--
    GO:0005737cytoplasm IDA12581153

    Find genes that share ontologies with HEXIM1           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for HEXIM1 About    
    See pathways by source

    SuperPathContained pathways About
    1Chromatin Regulation / Acetylation
    Chromatin Regulation / Acetylation


    Find genes that share SuperPaths with HEXIM1           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways

    5 Downloadable PowerPoint Slides of GeneGlobe Pathway Central Maps for HEXIM1
        Ceramide Pathway
    S-1P Stimulated Signaling
    eNOS Signaling
    Human Embryonic Stem Cell Pluripotency
    VEGF and S-1P Signaling

    1 Cell Signaling Technology (CST) Pathway for HEXIM1
        Chromatin Regulation / Acetylation



        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for HEXIM1
    Interactions:

        GeneGlobe Interaction Network for HEXIM1

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    Selected Interacting proteins for HEXIM1 (O949921, 2, 3 ENSP000003287734) via UniProtKB, MINT, STRING, and/or I2D (see all 35)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    LARP7Q4G0J31, 2, 3, ENSP000003143114EBI-2832510,EBI-2371923 MINT-6629492 MINT-6629521 MINT-6629505 MINT-6629464 MINT-6629588 MINT-6629479 MINT-6629534 I2D: score=1 STRING: ENSP00000314311
    CCNT1O605632, 3, ENSP000002619004MINT-6629492 MINT-6629521 MINT-6629505 MINT-7266411 MINT-6629464 MINT-6629479 MINT-7266429 MINT-6629547 MINT-6629534 I2D: score=4 STRING: ENSP00000261900
    CDK9P507501, 2, 3, ENSP000003623614EBI-2832510,EBI-1383449 MINT-6629492 MINT-6629521 MINT-6629505 MINT-7266411 MINT-6629464 MINT-6629577 MINT-7266429 MINT-6629479 MINT-6629547 MINT-6629534 I2D: score=4 STRING: ENSP00000362361
    CCNT2O605833, ENSP000002641574I2D: score=3 STRING: ENSP00000264157
    BRD4O608853, ENSP000002633774I2D: score=1 STRING: ENSP00000263377
    About this table

    Gene Ontology (GO): 5 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000122negative regulation of transcription from RNA polymerase II promoter IDA14580347
    GO:0006351transcription, DNA-templated IEA--
    GO:0007507heart development IEA--
    GO:0045736negative regulation of cyclin-dependent protein serine/threonine kinase activity IDA14580347
    GO:0045892negative regulation of transcription, DNA-templated IDA14580347

    Find genes that share ontologies with HEXIM1           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for HEXIM1 (HEXI1)

    2 Novoseek inferred chemical compound relationships for HEXIM1 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    hmba 87.2 14 17937499 (3), 12581153 (2), 16362050 (1), 14580347 (1) (see all 7)
    cyclohexane 74.4 5 17088550 (1), 18371977 (1), 18407829 (1), 12581153 (1) (see all 5)



    Find genes that share compounds with HEXIM1           About GenesLikeMe



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for HEXIM1 gene: 
    NM_006460.2  

    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000332499(uc002iig.3)
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat HEXIM1 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate HEXIM1 (see all 48):
    hsa-miR-607 hsa-miR-3607-3p hsa-miR-550a* hsa-miR-10b* hsa-miR-124 hsa-miR-4330 hsa-miR-29a* hsa-miR-506
    SwitchGear 3'UTR luciferase reporter plasmidHEXIM1 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for HEXIM1
    Predesigned siRNA for gene silencing in human, mouse, rat HEXIM1
    Clone
    Products:
         
    OriGene clones in human, mouse for HEXIM1 (see all 8)
    OriGene ORF clones in mouse, rat for HEXIM1
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: HEXIM1 (NM_006460)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for HEXIM1
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HEXIM1
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for HEXIM1
    OriGene qSTAR qPCR primer pairs in human, mouse for HEXIM1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HEXIM1
      QuantiTect SYBR Green Assays in human, mouse, rat HEXIM1
      QuantiFast Probe-based Assays in human, mouse, rat HEXIM1
    Flow Cytometry
    Products:
       

     
    eBioscience FlowRNA Probe Sets ( VA1-10512) for HEXIM1 

    Selected AceView cDNA sequences (see all 165):

    AI364065 N40566 AI590074 N46607 CR614564 W68584 AW169178 CR617663 
    BQ227655 BM915356 BU073220 AA579952 AI061204 CD671077 AA653157 CB853296 
    CD518239 CA865829 AI685477 N57225 AW471147 AA758486 AA599583 AA630587 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    HEXIM1 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: CTTTTGCAGT
    HEXIM1 Expression
    About this image

    HEXIM1 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    HEXIM1 Protein Expression

    UniProtKB/Swiss-Prot: HEXI1_HUMAN, O94992
    Tissue specificity: Ubiquitously expressed with higher expression in placenta. HEXIM1 and HEXIM2 are
    differentially expressed. Expressed in endocrine tissues

        Custom PCR Arrays for HEXIM1
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for HEXIM1
    OriGene qSTAR qPCR primer pairs in human, mouse for HEXIM1
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HEXIM1
    QuantiTect SYBR Green Assays in human, mouse, rat HEXIM1
    QuantiFast Probe-based Assays in human, mouse, rat HEXIM1
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HEXIM1

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for HEXIM1 gene from Selected species (see all 12)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Hexim11 , 5 hexamethylene bis-acetamide inducible 11, 5 88.01(n)1
    86.52(a)1
      11 (66.71 cM)5
    1922311  NM_138753.21  NP_620092.11 
     1031162315 
    chicken
    (Gallus gallus)
    Aves HEXIM11 hexamethylene bis-acetamide inducible 1 81.36(n)
    80.65(a)
      100857796  XM_003642783.1  XP_003642831.1 
    lizard
    (Anolis carolinensis)
    Reptilia HEXIM16
    hexamethylene bis-acetamide inducible 1
    61(a)
    1 ↔ 1
    6(64978945-64979961)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.25892 Xenopus laevis transcribed sequence with weak similarity more 76.53(n)    CA789057.1 
    zebrafish
    (Danio rerio)
    Actinopterygii wufd44h022 Transcribed sequence with weak similarity to protein more 78.41(n)    CD752877.1 


    ENSEMBL Gene Tree for HEXIM1 (if available)
    TreeFam Gene Tree for HEXIM1 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for HEXIM1 gene
    HEXIM22  
    1 SIMAP similar gene for HEXIM1 using alignment to 1 protein entry:     HEXI1_HUMAN:
    HEXIM2

    Find genes that share paralogs with HEXIM1           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for HEXIM1 (see all 188)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 17 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs670682071,2
    C--43222702(+) ACAAC-/AGCAGGGCCACCTTGGTGG
    GGGATGCAGGCCTGGAGCTGA
    AGCCA
    1 -- us2k10--------
    rs2008230611,2
    --43222703(+) AACAG-/CCAGGG 1 -- us2k10--------
    rs1841110961,2
    --43222708(+) GCAGGG/TCCACC 1 -- us2k10--------
    rs1138615431,2
    C,F--43222777(+) GGAACC/TTGGGT 1 -- us2k11Minor allele frequency- T:0.50WA 2
    rs1450040691,2
    C--43222786(+) GTAAG-/ATATTTT 1 -- us2k10--------
    rs129372301,2
    C,F,A--43222788(+) AAGATT/ATTTTT 1 -- us2k14Minor allele frequency- A:0.25WA NA CSA 8
    rs1394335551,2
    --43222852(+) AGTGGC/TGCGAT 1 -- us2k10--------
    rs1865415351,2
    --43222855(+) GGCGCA/GATCTC 1 -- us2k10--------
    rs74054721,2
    C,A--43222942(+) GCGGGC/GGCCAC 1 -- us2k13Minor allele frequency- G:0.20NA CSA 5
    rs1165239821,2
    C,F--43223170(+) ATAAGG/ACAGTC 1 -- us2k12Minor allele frequency- A:0.15WA EA 238

    HapMap Linkage Disequilibrium report for HEXIM1 (43224684 - 43229468 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 6 variations for HEXIM1:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv2062CNV Insertion18451855
    nsv527788CNV Loss19592680
    nsv908300CNV Loss21882294
    nsv908297CNV Loss21882294
    dgv3179n71CNV Loss21882294
    nsv828022CNV Gain20364138

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing HEXIM1
    DNA2.0 Custom Variant and Variant Library Synthesis for HEXIM1

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 607328    OMIM disorders: --


    Find genes that share disorders with HEXIM1           About GenesLikeMe

    2 Novoseek inferred disease relationships for HEXIM1 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    cardiac hypertrophy 48.1 3 17671421 (2), 14627702 (1)
    immunodeficiency 41.3 4 16382153 (1), 17671421 (1), 15169877 (1), 19617712 (1)

    Genetic Association Database (GAD): HEXIM1

    Export disorders for HEXIM1 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for HEXIM1 gene, integrated from 10 sources (see all 97):
    (articles sorted by number of sources associating them with HEXIM1)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. MAQ1 and 7SK RNA interact with CDK9/cyclin T complexes in a transcription-dependent manner. (PubMed id 12832472)1, 2, 3 Michels A.A.... Bensaude O. (Mol. Cell. Biol. 2003)
    2. HEXIM1 forms a transcriptionally abortive complex with glucocorticoid receptor without involving 7SK RNA and positive transcription elongation factor b. (PubMed id 15941832)1, 2, 9 Shimizu N.... Tanaka H. (Proc. Natl. Acad. Sci. U.S.A. 2005)
    3. A human immunodeficiency virus type 1 Tat-like arginine-rich RNA- binding domain is essential for HEXIM1 to inhibit RNA polymerase II transcription through 7SK snRNA-mediated inactivation of P-TEFb. (PubMed id 15169877)1, 2, 9 Yik J.H.N.... Zhou Q. (Mol. Cell. Biol. 2004)
    4. Analysis of the large inactive P-TEFb complex indicates that it contains one 7SK molecule, a dimer of HEXIM1 or HEXIM2, and two P-TEFb molecules containing Cdk9 phosphorylated at threonine 186. (PubMed id 15965233)1, 2, 9 Li Q.... Price D.H. (J. Biol. Chem. 2005)
    5. Inhibition of P-TEFb (CDK9/Cyclin T) kinase and RNA polymerase II transcription by the coordinated actions of HEXIM1 and 7SK snRNA. (PubMed id 14580347)1, 2, 9 Yik J.H.N.... Zhou Q. (Mol. Cell 2003)
    6. Compensatory contributions of HEXIM1 and HEXIM2 in maintaining the balance of active and inactive positive transcription elongation factor b complexes for control of transcription. (PubMed id 15713661)1, 2, 9 Yik J.H.N.... Zhou Q. (J. Biol. Chem. 2005)
    7. Interplay between 7SK snRNA and oppositely charged regions in HEXIM1 direct the inhibition of P-TEFb. (PubMed id 16362050)1, 2, 9 Barboric M....Peterlin B.M. (EMBO J. 2005)
    8. Suppression of NF-kappaB-dependent gene expression by a hexamethylene bisacetamide-inducible protein HEXIM1 in human vascular smooth muscle cells. (PubMed id 12581153)1, 2, 9 Ouchida R.... Tanaka H. (Genes Cells 2003)
    9. Genome-wide association study identifies eight loci associated with blood pressure. (PubMed id 19430483)1, 4 Newton-Cheh C....Munroe P.B. (Nat. Genet. 2009)
    10. Systematic analysis of the protein interaction network for the human transcription machinery reveals the identity of the 7SK capping enzyme. (PubMed id 17643375)1, 2 Jeronimo C.... Coulombe B. (Mol. Cell 2007)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 10614 HGNC: 24953 AceView: HIS1 Ensembl:ENSG00000186834 euGenes: HUgn10614
    ECgene: HEXIM1 H-InvDB: HEXIM1

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for HEXIM1 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for HEXIM1 gene:
    Search GeneIP for patents involving HEXIM1

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     Browse Purified and Recombinant Proteins at EMD Millipore
     EMD Millipore Mono- and Polyclonal Antibodies for the study of HEXIM1
     Browse Small Molecules at EMD Millipore
     EMD Millipore Kits and Assays for the Analysis of HEXIM1
     
     EMD Millipore genomic analysis products

      
     Antibodies for HEXIM1 (Hexim 1)   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for HEXIM1   OriGene RNAi products in human, mouse, rat for HEXIM1  
     OriGene qPCR primer pairs and template standards for HEXIM1   OriGene Protein Over-expression Lysate for HEXIM1  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for HEXIM1  
     OriGene qSTAR qPCR primer pairs in human, mouse for HEXIM1   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
     OriGene ORF clones in mouse, rat for HEXIM1   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for HEXIM1   OriGene Custom Protein Services for HEXIM1  

     
     
     Block miRNA regulation of human, mouse, rat HEXIM1 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing HEXIM1
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat HEXIM1 Predesigned siRNA for gene silencing in human, mouse, rat HEXIM1
     QuantiFast Probe-based Assays in human, mouse, rat HEXIM1 QuantiTect SYBR Green Assays in human, mouse, rat HEXIM1
     Custom PCR Arrays for HEXIM1 Search Chromatin IP Primers for HEXIM1
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat HEXIM1  GeneGlobe Interaction Network for HEXIM1
     Regulatory tfbs in HEXIM1 promoter
     GenScript Custom Purified and Recombinant Proteins Services for HEXIM1 GenScript cDNA clones with any tag delivered in your preferred vector for HEXIM1
     GenScript Custom Assay Services for HEXIM1 GenScript Custom overexpressing Cell Line Services for HEXIM1
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Antibodies & Assays for HEXIM1 

     Search Tocris compounds for HEXIM1 (HEXI1)
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for HEXIM1
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     HEXIM1 antibodies
     HEXIM1 proteins
     HEXIM1 lysates
     Antibodies for HEXIM1
     See all of Abcam's Antibodies, Kits and Proteins for HEXIM1
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for HEXIM1
     Proteins for HEXIM1
     Antibodies for HEXIM1
     ELISAs for HEXIM1
     CLIAs for HEXIM1



     Browse ESI BIO Cell Lines and PureStem Progenitors for HEXIM1
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HEXIM1
     SwitchGear 3'UTR luciferase reporter plasmids for HEXIM1
     SwitchGear Promoter luciferase reporter plasmids for HEXIM1
     ThermoFisher Antibodies for HEXIM1
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat HEXIM1
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for HEXIM1
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for HEXIM1
     LSBio Antibodies in human, mouse, rat for HEXIM1
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for HEXIM1
      Search eBioscience for proteins for HEXIM1
      Search eBioscience for elisas for HEXIM1
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      HEXIM1 gene at Home site.
    Version: 3.12.224 13 Oct 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4