Free for academic non-profit institutions. Other users need a Commercial license

Aliases for HCG4B Gene

Subcategory (RNA class) for HCG4B Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for HCG4B Gene

  • HLA Complex Group 4B (Non-Protein Coding) 2 3 5
  • HLA Complex Group 4 Pseudogene 6 2 3
  • HCGIV-6 Pseudogene 2 3
  • BPG309N1.1 3
  • BQB90C11.3 3
  • BCX67J3.3 3
  • HCGIV-06 3
  • HCGIV-6 3
  • HCGIV.5 3
  • HCG4P6 3

External Ids for HCG4B Gene

Previous HGNC Symbols for HCG4B Gene

  • HCG4P6

Previous GeneCards Identifiers for HCG4B Gene

  • GC06M029898
  • GC06M029906
  • GC06M029921
  • GC06M029934
  • GC06M029954
  • GC06M030015
  • GC06M029958
  • GC06M030024

Summaries for HCG4B Gene

GeneCards Summary for HCG4B Gene

HCG4B (HLA Complex Group 4B (Non-Protein Coding)) is an RNA Gene, and is affiliated with the non-coding RNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for HCG4B Gene

Genomics for HCG4B Gene

Regulatory Elements for HCG4B Gene

Promoters for HCG4B Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around HCG4B on UCSC Golden Path with GeneCards custom track

Genomic Location for HCG4B Gene

29,924,592 bp from pter
29,927,215 bp from pter
2,624 bases
Minus strand

Genomic View for HCG4B Gene

Genes around HCG4B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
HCG4B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for HCG4B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

Proteins for HCG4B Gene

Post-translational modifications for HCG4B Gene

No Post-translational modifications

No data available for DME Specific Peptides for HCG4B Gene

Domains & Families for HCG4B Gene

Graphical View of Domain Structure for InterPro Entry

No data available for Gene Families , Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for HCG4B Gene

Function for HCG4B Gene

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for HCG4B Gene

Localization for HCG4B Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for HCG4B Gene

Pathways & Interactions for HCG4B Gene

SuperPathways for HCG4B Gene

No Data Available

Interacting Proteins for HCG4B Gene

Gene Ontology (GO) - Biological Process for HCG4B Gene


No data available for Pathways by source and SIGNOR curated interactions for HCG4B Gene

Drugs & Compounds for HCG4B Gene

No Compound Related Data Available

Transcripts for HCG4B Gene

mRNA/cDNA for HCG4B Gene

(3) Additional mRNA sequences :
(1) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for HCG4B Gene

HLA complex group 4B (non-protein coding):
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for HCG4B Gene

No ASD Table

Relevant External Links for HCG4B Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for HCG4B Gene

mRNA expression in normal human tissues for HCG4B Gene

SOURCE GeneReport for Unigene cluster for HCG4B Gene Hs.661198

genes like me logo Genes that share expression patterns with HCG4B: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for HCG4B Gene

Orthologs for HCG4B Gene

Evolution for HCG4B Gene

Gene Tree for HCG4B (if available)
Gene Tree for HCG4B (if available)

No data available for Orthologs for HCG4B Gene

Paralogs for HCG4B Gene

No data available for Paralogs for HCG4B Gene

Variants for HCG4B Gene

Sequence variations from dbSNP and Humsavar for HCG4B Gene

SNP ID Clin Chr 06 pos Sequence Context AA Info Type
rs9259821 -- 29,925,888(+) GAGCT(C/G)CCTCT nc-transcript-variant
rs9259835 -- 29,927,890(+) GAATT(A/C)GGAGA upstream-variant-2KB
rs55803658 -- 29,928,351(+) TGGAG(G/T)GGGGG upstream-variant-2KB
rs150301960 -- 29,925,880(+) CCCAG(-/GGCGAGCTCCCTCTCTGGCATCGAGCTCCCTCTCTGGC)GGCGA nc-transcript-variant
rs370123067 -- 29,925,917(+) CTGGC(-/CAG)GGCGA nc-transcript-variant

Structural Variations from Database of Genomic Variants (DGV) for HCG4B Gene

Variant ID Type Subtype PubMed ID
esv25966 CNV Gain+Loss 19812545
dgv1039e201 CNV Deletion 23290073
dgv1086e199 CNV Deletion 23128226
esv2731775 CNV Deletion 23290073
esv2670487 CNV Deletion 23128226
dgv1910e1 CNV Complex 17122850
esv2665698 CNV Deletion 23128226
nsv820564 CNV Deletion 20802225
nsv823469 CNV Loss 20364138
nsv508398 CNV Loss 20534489
esv32544 CNV Gain+Loss 17666407
dgv1911e1 CNV Complex 17122850
dgv1912e1 CNV Complex 17122850
dgv211e55 CNV Loss 17911159
nsv442976 CNV CNV 18776908
nsv10810 CNV Gain+Loss 18304495
nsv5240 CNV Loss 18451855
dgv6451n71 CNV Gain 21882294
nsv883559 CNV Gain 21882294
dgv1087e199 CNV Deletion 23128226
dgv6452n71 CNV Loss 21882294
esv2589773 CNV Loss 19546169
dgv6455n71 CNV Gain+Loss 21882294
dgv6459n71 CNV Gain 21882294
nsv883593 CNV Loss 21882294
nsv499693 CNV Loss 21111241
dgv7e195 CNV Deletion 20811451
esv3124 CNV Deletion 18987735
dgv6462n71 CNV Gain 21882294
nsv823470 CNV Loss 20364138
dgv6467n71 CNV Gain+Loss 21882294
dgv6468n71 CNV Loss 21882294
dgv6470n71 CNV Loss 21882294
esv6014 CNV Loss 19470904
dgv1040e201 CNV Deletion 23290073
dgv1914e1 CNV Complex 17122850
essv1660 CNV CNV 17122850
nsv462733 CNV Loss 19166990
dgv6482n71 CNV Loss 21882294
dgv6483n71 CNV Gain+Loss 21882294
dgv6487n71 CNV Gain 21882294
dgv6491n71 CNV Loss 21882294
dgv6492n71 CNV Gain 21882294
dgv212e55 CNV Loss 17911159
dgv6493n71 CNV Loss 21882294
dgv6494n71 CNV Gain 21882294
dgv6495n71 CNV Gain 21882294
esv2659548 CNV Deletion 23128226
dgv6496n71 CNV Gain+Loss 21882294
dgv6498n71 CNV Loss 21882294
dgv116n17 CNV Loss 16327808
dgv6499n71 CNV Gain 21882294
dgv6500n71 CNV Gain 21882294
dgv6501n71 CNV Loss 21882294
essv101795 CNV Loss 18971310
dgv1088e199 CNV Deletion 23128226
dgv6502n71 CNV Gain 21882294
dgv6503n71 CNV Gain+Loss 21882294
dgv6504n71 CNV Loss 21882294
dgv1915e1 CNV Complex 17122850
dgv6505n71 CNV Loss 21882294
dgv6506n71 CNV Loss 21882294
dgv1089e199 CNV Deletion 23128226
essv101815 CNV Loss 18971310

Relevant External Links for HCG4B Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for HCG4B Gene

Disorders for HCG4B Gene

Relevant External Links for HCG4B

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for HCG4B Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for HCG4B Gene

Publications for HCG4B Gene

  1. Molecular dynamics of MHC genesis unraveled by sequence analysis of the 1,796,938-bp HLA class I region. (PMID: 10557312) Shiina T. … Inoko H. (Proc. Natl. Acad. Sci. U.S.A. 1999) 2 3 67
  2. Rapid evolution of major histocompatibility complex class I genes in primates generates new disease alleles in humans via hitchhiking diversity. (PMID: 16702430) Shiina T. … Bahram S. (Genetics 2006) 3
  3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3

Products for HCG4B Gene

Sources for HCG4B Gene

Back to Top
