Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

HCG17 Gene

RNA gene   GIFtS: 13
GCID: GC06M030202

HLA Complex Group 17 (Non-Protein Coding)

  Search for HCG17
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

Subcategory (RNA class): lncRNA

Quality score for this RNA gene is 3

Aliases
HLA Complex Group 17 (Non-Protein Coding)1 2
Long Intergenic Non-Protein Coding RNA 461
Non-Protein Coding RNA 461
LINC000462
NCRNA000462

External Ids:    HGNC: 313391   Entrez Gene: 4147782   Ensembl: ENSG000002706047   
ORGUL members:         
NONCODE14:n406544 n377818 n377837 n378231 n378712 see all 11      

Export aliases for HCG17 gene to outside databases

Previous GC identifers: GC00U915706 GC06U900760


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

GeneCards Summary for HCG17 Gene: 
HCG17 (HLA complex group 17 (non-protein coding)) is an RNA gene, and is affiliated with the lncRNA class.


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
Regulatory elements:
   Search SABiosciences Regulatory transcription factor binding sites for HCG17
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for HCG17

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat HCG17


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 6p21   Ensembl cytogenetic band:  6p22.1   HGNC cytogenetic band: 6p21

HCG17 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
HCG17 gene location

GeneLoc information about chromosome 6         GeneLoc Exon Structure

GeneLoc location for GC06M030202:  view genomic region     (about GC identifiers)

Start:
30,201,816 bp from pter      End:
30,293,911 bp from pter
Size:
92,096 bases      Orientation:
minus strand
ORGUL member locations:
Legend (see complete legend)

ORGUL Member Locations for HCG17

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB: --


(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section
HGNC Gene Families: 
LNCRNA: Long non-coding RNAs

  --

(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
About This Section

Animal Models:
   inGenious Targeting Laboratory - Custom generated mouse model solutions for HCG17 
   inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for HCG17

   genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for HCG17 
   genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for HCG17 

miRNA
Products:
    
QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat HCG17
Search QIAGEN for miScript miRNA Assays for microRNAs that regulate HCG17
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
    
Browse for Gene Knock-down Tools from EMD Millipore
Browse OriGene RNAi
Search QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat HCG17

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for HCG17

Clone
Products:
     
Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for HCG17
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for HCG17
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat HCG17

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for HCG17
Search LifeMap BioReagents cell lines for HCG17
In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HCG17


(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
About This Section



Interactions:

    Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for HCG17

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section
Browse Small Molecules at EMD Millipore
Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for HCG17

Search CenterWatch for drugs/clinical trials and news about HCG17

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

2 Ensembl transcripts including schematic representations, and UCSC links where relevant:
ENST00000455957(lincRNA) ENST00000453558(lincRNA)
miRNA
Products:
     
QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat HCG17
Search QIAGEN for miScript miRNA Assays for microRNAs that regulate HCG17
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
     
Browse for Gene Knock-down Tools from EMD Millipore
Browse OriGene RNAi
Search QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat HCG17
Clone
Products:
     
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for HCG17
DNA2.0 Custom Codon Optimized Gene Synthesis Service for HCG17
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat HCG17
Primer
Products:
    
Browse OriGene qPCR
Search SABiosciences RT2 qPCR Primer Assays in human, mouse, rat HCG17
  Search QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat HCG17
  Search QIAGEN QuantiFast Probe-based Assays in human, mouse, rat HCG17

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

Expression evidence for HCG17:none

HCG17 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>2/3
CGAP TAG: --
HCG17 Expression
About this image

    SABiosciences Custom PCR Arrays for HCG17
Primer
Products:
Browse OriGene qPCR
Search SABiosciences RT2 qPCR Primer Assays in human, mouse, rat HCG17
Search QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat HCG17
Search QIAGEN QuantiFast Probe-based Assays in human, mouse, rat HCG17
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HCG17

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section
  --

ENSEMBL Gene Tree for HCG17 (if available)
TreeFam Gene Tree for HCG17 (if available)

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section
  --

(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

10/540 SNPs in HCG17 are shown (see all 540)    About this table     
Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 6 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs92786241,2
C--30122962(+) taatt-/AATT  
        
tttta
1 -- int10--------
rs340568411,2
C--30125760(+) AAAAA-/ATAAAA 1 -- int11Minor allele frequency- A:0.00NA 2
rs576658431,2
C--30144683(+) AGTTT-/TTTTTCAACAGAGGTGAGGCTGGGACATTTCTATT
CATGTCTTAACTTTTAAGTTTCACTGAGCTGCCACTT
ACTCC
1 -- int10--------
rs1465497951,2
C--30201570(+) CTACAG/TGAGAT 1 -- int10--------
rs9165711,2
C,F,A,H--30201955(-) TCCTGC/TGTTGT 1 -- nc-transcript-variant33Minor allele frequency- T:0.39MN NS EA NA WA CSA 3552
rs9165681,2
C,F,A,H--30202052(-) TTTTTG/AACACA 1 -- int113Minor allele frequency- A:0.41NS EA NA WA CSA 782
rs1412745171,2
C--30202056(+) TCAAAA/GAAAGA 1 -- int10--------
rs794520301,2
C--30202216(+) TGCATA/CAGTAA 1 -- nc-transcript-variant0--------
rs1437211251,2
C--30202280(+) AGCTGA/CATTGT 1 -- int10--------
rs1137190631,2
C--30202368(+) AAACAT/CGATTT 1 -- int11Minor allele frequency- C:0.00CSA 1

HapMap Linkage Disequilibrium report for HCG17 (30201816 - 30293911 bp)

Structural Variations
      Database of Genomic Variants (DGV) variations for HCG17: --
SABiosciences Cancer Mutation PCR Assays
Search QIAGEN SeqTarget long-range PCR primers for resequencing HCG17
DNA2.0 Custom Variant and Variant Library Synthesis for HCG17

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section
  --

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

PubMed article for HCG17 gene integrated from 9 sources:
(articles sorted by number of sources associating them with HCG17)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Normalization and subtraction: two approaches to facilitate gene discovery. (PubMed id 8889548)1 Bonaldo M.F.... Soares M.B. (1996)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section
Entrez Gene: 414778 HGNC: 31339 Ensembl:ENSG00000270604 euGenes: HUgn414778 ECgene: HCG17
H-InvDB: HCG17

(According to HUGE)
About This Section
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section
NameDescription
PharmGKB entry for HCG17 Pharmacogenomics, SNPs, Pathways

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section
Patent Information for HCG17 gene:
Search GeneIP for patents involving HCG17

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

 
 EMD Millipore Custom Antibody & Bulk Services
 EMD Millipore Preclinical / Clinical Development Services
 EMD Millipore Immunoassay Services
 EMD Millipore Target Screening & Profiling Services

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
 Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Protease Activity Assays and Reagents   Browse Recombinant/Natural Proteins  
 Browse Stem Cell Products   Browse Tocris Biochemicals & Compounds  
 Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
 Browse OriGene Antibodies   Browse OriGene RNAi products  
 Browse OriGene qPCR primer pairs and template standards   Browse OriGene Protein Over-expression Lysates  
 OriGene Custom Mass Spec   Browse OriGene clones  
 Browse OriGene qSTAR qPCR primer pairs   Browse OriGene full length recombinant human proteins expressed in human HEK293 cells  
 Browse OriGene ORF clones   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for HCG17   OriGene Custom Protein Services for HCG17  

 
 
 QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat HCG17
 Search QIAGEN SeqTarget long-range PCR primers for resequencing in HCG17
 QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat HCG17
 Search QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat HCG17
 Search QIAGEN QuantiFast Probe-based Assays in human, mouse, rat HCG17
 Search QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat HCG17
 GenScript Custom Purified and Recombinant Proteins Services for HCG17 GenScript Custom cDNA clones with any tag delivered in your preferred vector Services for HCG17
 GenScript Custom Assay Services for HCG17 GenScript Custom Superior Antibodies Services for HCG17
 GenScript Custom overexpressing Cell Line Services for HCG17 CloneReady with Over 120,000 Genes
 Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
 Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
 Custom Peptide Services
 Search for Antibodies & Assays

 Search Regulatory tfbs for HCG17
 Search Chromatin IP Primers for HCG17
 Search RT2 qPCR Primer Assays in human, mouse, rat HCG17
 Search GNC Networks for HCG17
 SABiosciences Custom PCR Arrays for HCG17
 Search Tocris compounds for HCG17
 Browse Sino Biological Proteins and Antibodies
 Browse Sino Biological Cell Lysates
 Browse Sino Biological cDNA Clones
 4000+ Proteins
 Search Sino Biological for antibodies, proteins & pathways
 Protein Production Services
 Transfection Reagents
 Protein A/G/L resins
 Isotyping reagents
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
 Novus Biologicals
 Novus Tissue Slides
 Search for Antibodies for HCG17 at Abcam
 See all of Abcam's Antibodies, Kits and Proteins for HCG17
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins




 Browse Proteins at Cloud-Clone Corp.
 Browse Antibodies at Cloud-Clone Corp.
 Browse ELISAs at Cloud-Clone Corp.
 Browse CLIAs at Cloud-Clone Corp.
 Search LifeMap BioReagents cell lines for HCG17
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for HCG17
 Browse SwitchGear 3'UTR luciferase reporter plasmids for HCG17
 Browse SwitchGear Promoter luciferase reporter plasmids for HCG17
 Search ThermoFisher Antibodies for HCG17
 Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat HCG17
 inGenious Targeting Laboratory - Custom generated mouse model solutions for HCG17
 inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for HCG17
Customized:
 lentivirus for stable overexpression
 lentivirus expression plasmids for stable overexpression
 adenovirus for overexpression
 Search LSBio for Antibodies for HCG17
Customized transgenic rodents for:
 Humanization
 Biomarker expression
 Off-target effect monitoring
 Translational medicine
 Tissue-specific gene expresssion
 Time-controlled gene expresssion
       
GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 4 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

View Random Gene

Category
(GIFtS: 73)
transforming growth factor, beta 1
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      HCG17 gene at Home site.
hostname: 356980-web2.xennexinc.com index build: 106 solr: 1.4