Free for academic non-profit institutions. Other users need a Commercial license

Aliases for H3F3B Gene

Aliases for H3F3B Gene

  • H3 Histone Family Member 3B 2 3 5
  • H3 Histone, Family 3B (H3.3B) 2 3
  • H3.3B 3 4
  • H3 Histone, Family 3B 2
  • Histone H3.3 3
  • H3F3A H3F3B 4
  • H3.3A 4
  • H3F3 4

External Ids for H3F3B Gene

Previous GeneCards Identifiers for H3F3B Gene

  • GC17M073749
  • GC17M076798
  • GC17M074237
  • GC17M074371
  • GC17M074372
  • GC17M071284
  • GC17M069198

Summaries for H3F3B Gene

Entrez Gene Summary for H3F3B Gene

  • Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded by this gene is a replication-independent histone that is a member of the histone H3 family. Pseudogenes of this gene have been identified on the X chromosome, and on chromosomes 5, 13 and 17. [provided by RefSeq, Oct 2015]

GeneCards Summary for H3F3B Gene

H3F3B (H3 Histone Family Member 3B) is a Protein Coding gene. Diseases associated with H3F3B include Brain Stem Cancer and Adult Astrocytic Tumour. Among its related pathways are Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3 and Meiosis. GO annotations related to this gene include protein heterodimerization activity and RNA polymerase II distal enhancer sequence-specific DNA binding. An important paralog of this gene is H3F3A.

UniProtKB/Swiss-Prot for H3F3B Gene

  • Variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. Constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis. Deposited at sites of nucleosomal displacement throughout transcribed genes, suggesting that it represents an epigenetic imprint of transcriptionally active chromatin. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for H3F3B Gene

Genomics for H3F3B Gene

Regulatory Elements for H3F3B Gene

Enhancers for H3F3B Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH17G076734 2.7 Ensembl ENCODE dbSUPER 12.5 -951.4 -951366 7.8 CREB3L1 MLX AGO1 ZFP64 FEZF1 DMAP1 YY1 SLC30A9 ZNF143 ZNF548 UNK MXRA7 ENSG00000267342 ENSG00000267546 CDK3 H3F3B ENSG00000266980 TRIM65 PRCD ENSG00000272386
GH17G075776 2.4 ENCODE dbSUPER 12.9 +7.4 7367 4.9 MLX CREB3L1 AGO1 ZFP64 DMAP1 YY1 SLC30A9 ZNF143 ZNF263 SP3 MRPL38 H3F3B UNK NT5C METTL23 UNC13D ENSG00000267342 TEN1 GC17P075777 GC17M075778
GH17G075288 2.1 FANTOM5 Ensembl ENCODE dbSUPER 12 +492.2 492235 11.0 CREB3L1 MLX ZFP64 DMAP1 YBX1 YY1 SLC30A9 ZNF143 ZNF263 SP3 GRB2 NUP85 SUMO2 CDK3 H3F3B TMEM94 ENSG00000267342 LLGL2 UNK TEN1
GH17G076638 1.6 Ensembl ENCODE dbSUPER 12.5 -856.8 -856765 7.8 HDGF PKNOX1 FOXA2 CREB3L1 ARNT ZFP64 SIN3A ZNF766 DEK ZHX2 MXRA7 METTL23 H3F3B UNK JMJD6 AANAT UBE2O RNU6-24P ST6GALNAC1 GC17M076570
GH17G075863 1.6 FANTOM5 Ensembl ENCODE dbSUPER 11.2 -79.0 -78955 1.7 PKNOX1 ZBTB40 GLIS2 ZNF143 ETV6 RELB IKZF2 CREM CBFB GATAD2B TRIM65 UNK H3F3B MRPL38 TRIM47 WBP2 ENSG00000267801
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around H3F3B on UCSC Golden Path with GeneCards custom track

Promoters for H3F3B Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000098450 793 1401 MLX CREB3L1 ZFP64 DMAP1 YY1 SLC30A9 ZNF143 ZNF548 ZNF263 SP3

Genomic Location for H3F3B Gene

Chromosome:
17
Start:
75,776,434 bp from pter
End:
75,785,893 bp from pter
Size:
9,460 bases
Orientation:
Minus strand

Genomic View for H3F3B Gene

Genes around H3F3B on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H3F3B Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H3F3B Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H3F3B Gene

Proteins for H3F3B Gene

  • Protein details for H3F3B Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P84243-H33_HUMAN
    Recommended name:
    Histone H3.3
    Protein Accession:
    P84243
    Secondary Accessions:
    • P06351
    • P33155
    • Q5VV55
    • Q5VV56
    • Q66I33
    • Q9V3W4

    Protein attributes for H3F3B Gene

    Size:
    136 amino acids
    Molecular mass:
    15328 Da
    Quaternary structure:
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. Interacts with HIRA, a chaperone required for its incorporation into nucleosomes. Interacts with ZMYND11; when trimethylated at Lys-36 (H3.3K36me3).
    • The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. The octamer wraps approximately 147 bp of DNA. Interacts with HIRA, a chaperone required for its incorporation into nucleosomes. Interacts with ZMYND11; when trimethylated at Lys-36 (H3.3K36me3).
    SequenceCaution:
    • Sequence=CAH73371.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

    Three dimensional structures from OCA and Proteopedia for H3F3B Gene

neXtProt entry for H3F3B Gene

Post-translational modifications for H3F3B Gene

  • Acetylation is generally linked to gene activation. Acetylation on Lys-10 (H3K9ac) impairs methylation at Arg-9 (H3R8me2s). Acetylation on Lys-19 (H3K18ac) and Lys-24 (H3K24ac) favors methylation at Arg-18 (H3R17me). Acetylation at Lys-123 (H3K122ac) by EP300/p300 plays a central role in chromatin structure: localizes at the surface of the histone octamer and stimulates transcription, possibly by promoting nucleosome instability.
  • Asymmetric dimethylation at Arg-18 (H3R17me2a) by CARM1 is linked to gene activation. Symmetric dimethylation at Arg-9 (H3R8me2s) by PRMT5 is linked to gene repression. Asymmetric dimethylation at Arg-3 (H3R2me2a) by PRMT6 is linked to gene repression and is mutually exclusive with H3 Lys-5 methylation (H3K4me2 and H3K4me3). H3R2me2a is present at the 3 of genes regardless of their transcription state and is enriched on inactive promoters, while it is absent on active promoters.
  • Citrullination at Arg-9 (H3R8ci) and/or Arg-18 (H3R17ci) by PADI4 impairs methylation and represses transcription.
  • Crotonylation (Kcr) is specifically present in male germ cells and marks testis-specific genes in post-meiotic cells, including X-linked genes that escape sex chromosome inactivation in haploid cells. Crotonylation marks active promoters and enhancers and confers resistance to transcriptional repressors. It is also associated with post-meiotically activated genes on autosomes.
  • Lysine deamination at Lys-5 (H3K4all) to form allysine is mediated by LOXL2. Allysine formation by LOXL2 only takes place on H3K4me3 and results in gene repression (PubMed:22483618).
  • Phosphorylated at Thr-4 (H3T3ph) by GSG2/haspin during prophase and dephosphorylated during anaphase. Phosphorylation at Ser-11 (H3S10ph) by AURKB is crucial for chromosome condensation and cell-cycle progression during mitosis and meiosis. In addition phosphorylation at Ser-11 (H3S10ph) by RPS6KA4 and RPS6KA5 is important during interphase because it enables the transcription of genes following external stimulation, like mitogens, stress, growth factors or UV irradiation and result in the activation of genes, such as c-fos and c-jun. Phosphorylation at Ser-11 (H3S10ph), which is linked to gene activation, prevents methylation at Lys-10 (H3K9me) but facilitates acetylation of H3 and H4. Phosphorylation at Ser-11 (H3S10ph) by AURKB mediates the dissociation of HP1 proteins (CBX1, CBX3 and CBX5) from heterochromatin. Phosphorylation at Ser-11 (H3S10ph) is also an essential regulatory mechanism for neoplastic cell transformation. Phosphorylated at Ser-29 (H3S28ph) by MLTK isoform 1, RPS6KA5 or AURKB during mitosis or upon ultraviolet B irradiation. Phosphorylation at Thr-7 (H3T6ph) by PRKCB is a specific tag for epigenetic transcriptional activation that prevents demethylation of Lys-5 (H3K4me) by LSD1/KDM1A. At centromeres, specifically phosphorylated at Thr-12 (H3T11ph) from prophase to early anaphase, by DAPK3 and PKN1. Phosphorylation at Thr-12 (H3T11ph) by PKN1 is a specific tag for epigenetic transcriptional activation that promotes demethylation of Lys-10 (H3K9me) by KDM4C/JMJD2C. Phosphorylation at Tyr-42 (H3Y41ph) by JAK2 promotes exclusion of CBX5 (HP1 alpha) from chromatin. Phosphorylation on Ser-32 (H3S31ph) is specific to regions bordering centromeres in metaphase chromosomes.
  • Specifically enriched in modifications associated with active chromatin such as methylation at Lys-5 (H3K4me), Lys-37 and Lys-80. Methylation at Lys-5 (H3K4me) facilitates subsequent acetylation of H3 and H4. Methylation at Lys-80 (H3K79me) is associated with DNA double-strand break (DSB) responses and is a specific target for TP53BP1. Methylation at Lys-10 (H3K9me) and Lys-28 (H3K27me), which are linked to gene repression, are underrepresented. Methylation at Lys-10 (H3K9me) is a specific target for HP1 proteins (CBX1, CBX3 and CBX5) and prevents subsequent phosphorylation at Ser-11 (H3S10ph) and acetylation of H3 and H4. Methylation at Lys-5 (H3K4me) and Lys-80 (H3K79me) require preliminary monoubiquitination of H2B at Lys-120. Methylation at Lys-10 (H3K9me) and Lys-28 (H3K27me) are enriched in inactive X chromosome chromatin. Monomethylation at Lys-57 (H3K56me1) by EHMT2/G9A in G1 phase promotes interaction with PCNA and is required for DNA replication.
  • Ubiquitinated. Monoubiquitinated by RAG1 in lymphoid cells, monoubiquitination is required for V(D)J recombination (By similarity).
  • Ubiquitination at isoforms=116
  • Modification sites at PhosphoSitePlus

No data available for DME Specific Peptides for H3F3B Gene

Domains & Families for H3F3B Gene

Gene Families for H3F3B Gene

Protein Domains for H3F3B Gene

Suggested Antigen Peptide Sequences for H3F3B Gene

Graphical View of Domain Structure for InterPro Entry

P84243

UniProtKB/Swiss-Prot:

H33_HUMAN :
  • Specific interaction of trimethylated form at Lys-36 (H3.3K36me3) with ZMYND11 is mediated by the encapsulation of Ser-32 residue with a composite pocket formed by the tandem bromo-PWWP domains.
  • Belongs to the histone H3 family.
Domain:
  • Specific interaction of trimethylated form at Lys-36 (H3.3K36me3) with ZMYND11 is mediated by the encapsulation of Ser-32 residue with a composite pocket formed by the tandem bromo-PWWP domains.
Family:
  • Belongs to the histone H3 family.
genes like me logo Genes that share domains with H3F3B: view

Function for H3F3B Gene

Molecular function for H3F3B Gene

GENATLAS Biochemistry:
histone family 3,replacement subtype,replication independent protein,species H3.3B
UniProtKB/Swiss-Prot Function:
Variant histone H3 which replaces conventional H3 in a wide range of nucleosomes in active genes. Constitutes the predominant form of histone H3 in non-dividing cells and is incorporated into chromatin independently of DNA synthesis. Deposited at sites of nucleosomal displacement throughout transcribed genes, suggesting that it represents an epigenetic imprint of transcriptionally active chromatin. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling.

Gene Ontology (GO) - Molecular Function for H3F3B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000979 RNA polymerase II core promoter sequence-specific DNA binding IDA 19633671
GO:0000980 RNA polymerase II distal enhancer sequence-specific DNA binding IDA 19633671
GO:0003677 DNA binding IEA --
GO:0005515 protein binding IPI 19494831
GO:0031492 nucleosomal DNA binding IDA 19633671
genes like me logo Genes that share ontologies with H3F3B: view
genes like me logo Genes that share phenotypes with H3F3B: view

Animal Models for H3F3B Gene

MGI Knock Outs for H3F3B:

Animal Model Products

CRISPR Products

miRNA for H3F3B Gene

miRTarBase miRNAs that target H3F3B

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for H3F3B Gene

Localization for H3F3B Gene

Subcellular locations from UniProtKB/Swiss-Prot for H3F3B Gene

Nucleus. Chromosome.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H3F3B gene
Compartment Confidence
extracellular 5
nucleus 5

Gene Ontology (GO) - Cellular Components for H3F3B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000228 nuclear chromosome IDA 14718166
GO:0000784 nuclear chromosome, telomeric region IDA 19135898
GO:0000786 nucleosome IEA,IDA 21636898
GO:0000788 nuclear nucleosome IDA 19633671
GO:0001740 Barr body IEA --
genes like me logo Genes that share ontologies with H3F3B: view

Pathways & Interactions for H3F3B Gene

SuperPathways for H3F3B Gene

SuperPathway Contained pathways
1 Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3
2 Cellular Senescence
3 Cell Cycle, Mitotic
.60
4 Mitotic Prophase
5 Development NOTCH1-mediated pathway for NF-KB activity modulation
genes like me logo Genes that share pathways with H3F3B: view

Gene Ontology (GO) - Biological Process for H3F3B Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000183 chromatin silencing at rDNA TAS --
GO:0001649 osteoblast differentiation IEA --
GO:0006334 nucleosome assembly IMP 25615412
GO:0006336 DNA replication-independent nucleosome assembly IDA 14718166
GO:0006997 nucleus organization IEA --
genes like me logo Genes that share ontologies with H3F3B: view

No data available for SIGNOR curated interactions for H3F3B Gene

Drugs & Compounds for H3F3B Gene

No Compound Related Data Available

Transcripts for H3F3B Gene

Unigene Clusters for H3F3B Gene

H3 histone, family 3B (H3.3B):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for H3F3B Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4a · 4b ^ 5a · 5b · 5c
SP1: - -
SP2: -
SP3: - -
SP4: -

Relevant External Links for H3F3B Gene

GeneLoc Exon Structure for
H3F3B
ECgene alternative splicing isoforms for
H3F3B

Expression for H3F3B Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for H3F3B Gene

mRNA differential expression in normal tissues according to GTEx for H3F3B Gene

This gene is overexpressed in Whole Blood (x4.1).

Protein differential expression in normal tissues from HIPED for H3F3B Gene

This gene is overexpressed in Frontal cortex (9.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for H3F3B Gene



Protein tissue co-expression partners for H3F3B Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of H3F3B Gene:

H3F3B

SOURCE GeneReport for Unigene cluster for H3F3B Gene:

Hs.180877

Evidence on tissue expression from TISSUES for H3F3B Gene

  • Nervous system(5)
  • Eye(4.9)
  • Liver(4.8)
  • Lung(4.7)
  • Pancreas(4.6)
  • Blood(4.5)
  • Skin(4.5)
  • Kidney(3.9)
  • Intestine(3.8)
  • Muscle(3.4)
  • Bone(3.3)
  • Stomach(3.2)
  • Heart(3.1)
  • Spleen(2.3)
genes like me logo Genes that share expression patterns with H3F3B: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for H3F3B Gene

Orthologs for H3F3B Gene

This gene was present in the common ancestor of animals and fungi.

Orthologs for H3F3B Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia H3F3A 35
  • 100 (a)
OneToOne
H3F3B 34
  • 92.16 (n)
oppossum
(Monodelphis domestica)
Mammalia H3F3B 35
  • 100 (a)
OneToOne
mouse
(Mus musculus)
Mammalia H3f3a 35
  • 100 (a)
OneToOne
H3f3b 34 16
  • 91.91 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia H3F3B 35
  • 100 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia H3F3C 35
  • 100 (a)
OneToOne
H3F3B 34
  • 99.02 (n)
rat
(Rattus norvegicus)
Mammalia H3f3b 34
  • 91.91 (n)
dog
(Canis familiaris)
Mammalia H3F3B 34 35
  • 78.19 (n)
chicken
(Gallus gallus)
Aves H3-IX 35
  • 100 (a)
OneToOne
H3F3B 34
  • 88.24 (n)
lizard
(Anolis carolinensis)
Reptilia -- 35
  • 100 (a)
ManyToMany
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC101730642 34
  • 82.35 (n)
zebrafish
(Danio rerio)
Actinopterygii h3f3a 35
  • 100 (a)
OneToMany
H3F3B (1 of 3) 35
  • 100 (a)
OneToMany
H3F3B (3 of 3) 35
  • 100 (a)
OneToMany
LOC565028 34
  • 80.64 (n)
fruit fly
(Drosophila melanogaster)
Insecta His3.3A 36 35
  • 100 (a)
His3.3B 36
  • 100 (a)
His3:CG33857 34
  • 77.7 (n)
worm
(Caenorhabditis elegans)
Secernentea his-71 36 35
  • 99 (a)
his-72 36
  • 98 (a)
W05B10.1 36
  • 93 (a)
his-69 36
  • 88 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes HHT1 35
  • 90 (a)
ManyToMany
HHT2 35
  • 90 (a)
ManyToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.1064 35
  • 100 (a)
OneToOne
Species where no ortholog for H3F3B was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for H3F3B Gene

ENSEMBL:
Gene Tree for H3F3B (if available)
TreeFam:
Gene Tree for H3F3B (if available)

Paralogs for H3F3B Gene

genes like me logo Genes that share paralogs with H3F3B: view

Variants for H3F3B Gene

Sequence variations from dbSNP and Humsavar for H3F3B Gene

SNP ID Clin Chr 17 pos Sequence Context AA Info Type
rs1000160446 -- 75,778,942(+) ATCTC(C/T)CGAAG reference, synonymous-codon
rs1000377083 -- 75,781,318(+) CAGTG(A/G)TGCAG upstream-variant-2KB
rs1000757772 -- 75,776,676(+) AGCCT(A/T)CTATG utr-variant-3-prime
rs1000847097 -- 75,776,829(+) ATCTT(-/AATCTCATTCTGAAGCACAGTGAGGAATC)AAGTG utr-variant-3-prime
rs1001485619 -- 75,781,931(+) ATCAT(A/G)TACCT upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for H3F3B Gene

Variant ID Type Subtype PubMed ID
nsv470606 CNV loss 18288195
nsv476922 CNV novel sequence insertion 20440878
nsv833545 CNV gain 17160897
nsv960530 CNV duplication 23825009

Variation tolerance for H3F3B Gene

Residual Variation Intolerance Score: 43.7% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 8.66; 86.38% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for H3F3B Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
H3F3B

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for H3F3B Gene

Disorders for H3F3B Gene

MalaCards: The human disease database

(6) MalaCards diseases for H3F3B Gene - From: DISEASES and GeneCards

Disorder Aliases PubMed IDs
brain stem cancer
  • malignant neoplasm of brain stem
adult astrocytic tumour
  • adult astrocytoma
spinal cord astrocytoma
  • astrocytoma of spinal cord
bone giant cell sarcoma
  • giant cell sarcoma of the bone
clear cell chondrosarcoma
- elite association - COSMIC cancer census association via MalaCards
Search H3F3B in MalaCards View complete list of genes associated with diseases

Relevant External Links for H3F3B

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
H3F3B
genes like me logo Genes that share disorders with H3F3B: view

No data available for UniProtKB/Swiss-Prot and Genatlas for H3F3B Gene

Publications for H3F3B Gene

  1. The human replacement histone H3.3B gene (H3F3B). (PMID: 8586426) Albig W. … Doenecke D. (Genomics 1995) 2 3 4 22 64
  2. ZMYND11 links histone H3.3K36me3 to transcription elongation and tumour suppression. (PMID: 24590075) Wen H. … Shi X. (Nature 2014) 3 4 64
  3. Histone H3.1 and H3.3 complexes mediate nucleosome assembly pathways dependent or independent of DNA synthesis. (PMID: 14718166) Tagami H. … Nakatani Y. (Cell 2004) 3 4 64
  4. Serine ADP-ribosylation depends on HPF1. (PMID: 28190768) Bonfiglio J.J. … Matic I. (Mol. Cell 2017) 4 64
  5. Interaction of amyotrophic lateral sclerosis/frontotemporal lobar degeneration-associated fused-in-sarcoma with proteins involved in metabolic and protein degradation pathways. (PMID: 25192599) Wang T. … Xu J. (Neurobiol. Aging 2015) 3 64

Products for H3F3B Gene

Sources for H3F3B Gene