Free for academic non-profit institutions. Other users need a Commercial license

H19 Gene(RNA Gene)

H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding)

GCID:
GC11M001995
GIFtS:
35
Genes Participants
UDN Logo

Aliases for H19 Gene

Subcategory (RNA class) for H19 Gene

non-coding RNA

Quality Score for this RNA gene is

3

Aliases for H19 Gene

  • H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding) 2 3 5
  • H19, Imprinted Maternally Expressed Untranslated MRNA 2 3
  • Long Intergenic Non-Protein Coding RNA 8 2 3
  • Non-Protein Coding RNA 8 2
  • NCRNA00008 3
  • LINC00008 3
  • D11S813E 3
  • ASM1 3
  • BWS 3
  • ASM 3
  • WT2 3

External Ids for H19 Gene

Previous GeneCards Identifiers for H19 Gene

  • GC11U990149
  • GC11M001980
  • GC11M001972
  • GC11M001976
  • GC11M002016
  • GC11M001807

Summaries for H19 Gene

Entrez Gene Summary for H19 Gene

  • This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been associated with Beckwith-Wiedemann Syndrome and Wilms tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

GeneCards Summary for H19 Gene

H19 (H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding)) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with H19 include Wilms Tumor 2 and Beckwith-Wiedemann Syndrome.

Gene Wiki entry for H19 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for H19 Gene

Genomics for H19 Gene

Products:

  1. Regulatory Element

Regulatory Elements for H19 Gene

Enhancers for H19 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11G001810 0.9 Ensembl 11.3 +190.5 190470 0.8 AGO1 KLF17 ARID4B ZSCAN9 ZNF48 RAD21 ZNF335 GLIS2 ZNF143 THAP11 TNNI2 CTSD ENSG00000229512 ENSG00000250644 ENSG00000235027 IFITM10 MRPL23-AS1 LINC01219 H19 KRTAP5-6
GH11G001849 1.6 FANTOM5 ENCODE dbSUPER 5.3 +148.7 148666 6.3 HDGF SIN3A GLI4 GLIS2 ELK1 ZNF143 ZNF207 ZNF263 ZNF202 JUNB LSP1 TNNI2 TNNT3 H19 C11orf21 TSPAN32 IGF2
GH11G002267 1.2 ENCODE dbSUPER 5.3 -267.6 -267639 3.5 ARID4B DMAP1 ZNF48 TCF12 SP5 MXD4 REST MXD3 GLIS1 ETV4 C11orf21 H19 ASCL2 GC11M002224
GH11G002001 0.9 Ensembl ENCODE 0.7 -0.8 -770 1.7 ZBTB10 CTCF ZNF654 RB1 REST ZBTB7A RAD21 TARDBP SMC3 CREM TNNI2 SYT8 KRTAP5-6 FAM99B LOC100505570 H19 PIR50683
GH11G001999 0.9 ENCODE dbSUPER 0.7 +1.5 1505 0.2 ZBTB10 CTCF ZNF654 REST RAD21 NR2F2 SMC3 SETDB1 MRPL23-AS1 GC11P001999 H19
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around H19 on UCSC Golden Path with GeneCards custom track

Transcription factor binding sites by QIAGEN in the H19 gene promoter:

Genomic Location for H19 Gene

Chromosome:
11
Start:
1,995,163 bp from pter
End:
2,001,470 bp from pter
Size:
6,308 bases
Orientation:
Minus strand

Genomic View for H19 Gene

Genes around H19 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H19 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H19 Gene
GeneLoc Logo Genomic Neighborhood • Exon Structure • Gene Density

RefSeq DNA sequence for H19 Gene

Proteins for H19 Gene

Products:

  1. Antibody
  2. Protein
  3. Assay

Post-translational modifications for H19 Gene

No Post-translational modifications

No data available for DME Specific Peptides for H19 Gene

Domains & Families for H19 Gene

Gene Families for H19 Gene

HGNC:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with H19: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for H19 Gene

Function for H19 Gene

Products:

  1. Animal Model
  2. CRISPR
  3. miRNA
  4. Inhibitory RNA
  5. Clone
  6. Cell Line

Molecular function for H19 Gene

GENATLAS Biochemistry:
DNA segment,single copy,probe H19S1,highly expressed in endodermal and mesodermal embryonic tissues,in adult brain,only in the pons and globus pallidus,paternally imprinted,(?same as ASMG),telomeric imprinting domain at 11p15,containing ASCL2,IGF2 and H19,silenced and hypermethylated in most Wilms tumor and in bladder carcinomas,but hypomethylated in benign ovarian teratoma

Human Phenotype Ontology for H19 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for H19 Gene

Localization for H19 Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for H19 gene
Compartment Confidence
nucleus 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for H19 Gene

Pathways & Interactions for H19 Gene

SuperPathways for H19 Gene

PathCards logo More details on SuperPathways for H19
No Data Available

Interacting Proteins for H19 Gene

Gene Ontology (GO) - Biological Process for H19 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for H19 Gene

Drugs & Compounds for H19 Gene

Products:

  1. Drug

(6) Drugs for H19 Gene - From: PharmGKB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Platinum compounds Pharma 0

(13) Additional Compounds for H19 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with H19: view

Transcripts for H19 Gene

Products:

  1. CRISPR
  2. miRNA
  3. Inhibitory RNA
  4. Clone

mRNA/cDNA for H19 Gene

(25) Additional mRNA sequences :
(2627) Selected AceView cDNA sequences:
(13) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for H19 Gene

H19, imprinted maternally expressed transcript (non-protein coding):
Representative Sequences:

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for H19 Gene

No ASD Table

Relevant External Links for H19 Gene

GeneLoc Exon Structure for
H19
ECgene alternative splicing isoforms for
H19

Expression for H19 Gene

Products:

  1. Primer

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for H19 Gene

mRNA expression in normal human tissues for H19 Gene
mRNA expression by BioGPS for H19 GenemRNA expression by GTEx for H19 Gene

mRNA differential expression in normal tissues according to GTEx for H19 Gene

This gene is overexpressed in Muscle - Skeletal (x11.1) and Adrenal Gland (x4.6).

NURSA nuclear receptor signaling pathways regulating expression of H19 Gene:

H19

SOURCE GeneReport for Unigene cluster for H19 Gene:

Hs.533566

Phenotype-based relationships between genes and organs from Gene ORGANizer for H19 Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • endocrine
  • integumentary
  • nervous
  • reproductive
  • respiratory
  • skeletal muscle
  • skeleton
  • urinary
Organs:
Head and neck:
  • brain
  • cheek
  • chin
  • ear
  • eye
  • eyelid
  • face
  • forehead
  • head
  • jaw
  • lip
  • mandible
  • maxilla
  • meninges
  • mouth
  • neck
  • outer ear
  • pituitary gland
  • skull
  • tongue
  • tooth
Thorax:
  • chest wall
  • clavicle
  • diaphragm
  • heart
  • heart valve
  • lung
  • rib
  • rib cage
  • scapula
  • sternum
Abdomen:
  • abdominal wall
  • adrenal gland
  • intestine
  • kidney
  • large intestine
  • liver
  • pancreas
  • small intestine
  • stomach
Pelvis:
  • ovary
  • pelvis
  • penis
  • testicle
  • ureter
  • urethra
  • urinary bladder
  • vagina
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • fibula
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shin
  • shoulder
  • thigh
  • tibia
  • toe
  • ulna
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • peripheral nerve
  • peripheral nervous system
  • skin
  • spinal column
  • spinal cord
  • sweat gland
  • vertebrae
genes like me logo Genes that share expression patterns with H19: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for H19 Gene

Orthologs for H19 Gene

Evolution for H19 Gene

ENSEMBL:
Gene Tree for H19 (if available)
TreeFam:
Gene Tree for H19 (if available)

No data available for Orthologs for H19 Gene

Paralogs for H19 Gene

No data available for Paralogs for H19 Gene

Variants for H19 Gene

Sequence variations from dbSNP and Humsavar for H19 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs431825163 untested 2,001,815(+) GGAAT(A/G)TTAAT intron-variant, upstream-variant-2KB
rs431825164 untested 2,001,083(+) CCCCC(A/G)ATGAC intron-variant
rs431825165 untested 2,001,763(+) GCTCT(-/TTAGCATCTCAAGCTCCTAAA)TTAGC intron-variant, upstream-variant-2KB
rs431825166 untested 2,000,708(+) TGGCT(A/T)GCGGG intron-variant
rs431825167 untested 2,000,108(+) CCCTG(A/C)GAGAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for H19 Gene

Variant ID Type Subtype PubMed ID
dgv1015n100 CNV gain 25217958
dgv1016n100 CNV gain 25217958
esv29980 CNV loss 17803354
nsv1047474 CNV gain 25217958
nsv467645 CNV gain 19166990
nsv469926 CNV loss 18288195
nsv522320 CNV loss 19592680
nsv553047 CNV gain 21841781
nsv553064 CNV loss 21841781
nsv951283 CNV deletion 24416366

Relevant External Links for H19 Gene

Human Gene Mutation Database (HGMD)
H19
SNPedia medical, phenotypic, and genealogical associations of SNPs for
H19

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for H19 Gene

Disorders for H19 Gene

MalaCards: The human disease database

(22) MalaCards diseases for H19 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search H19 in MalaCards View complete list of genes associated with diseases

Relevant External Links for H19

Genetic Association Database (GAD)
H19
Human Genome Epidemiology (HuGE) Navigator
H19
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
H19
genes like me logo Genes that share disorders with H19: view

No data available for UniProtKB/Swiss-Prot and Genatlas for H19 Gene

Publications for H19 Gene

  1. The H19 gene imprinting in normal pregnancy and pre-eclampsia. (PMID: 19342096) Yu L. … Li L. (Placenta 2009) 3 22 46 64
  2. Polymorphisms in the H19 gene and the risk of bladder cancer. (PMID: 18262338) Verhaegh G.W. … Kiemeney L.A. (Eur. Urol. 2008) 3 22 46 64
  3. Common genetic variants associated with breast cancer and mammographic density measures that predict disease. (PMID: 20145138) Odefrey F. … Southey M.C. (Cancer Res. 2010) 3 46 64
  4. FGFR2 and other loci identified in genome-wide association studies are associated with breast cancer in African-American and younger women. (PMID: 20554749) Barnholtz-Sloan J.S. … Millikan R.C. (Carcinogenesis 2010) 3 46 64
  5. Association of birth weight with polymorphisms in the IGF2, H19, and IGF2R genes. (PMID: 20639793) Adkins R.M. … Krushkal J. (Pediatr. Res. 2010) 3 46 64

Products for H19 Gene

Sources for H19 Gene

Content
Loading form....