Aliases for H19 Gene
Subcategory (RNA class) for H19 Gene
Quality Score for this RNA gene is
Aliases for H19 Gene
External Ids for H19 Gene
- HGNC: 4713
- Entrez Gene: 283120
- Ensembl: ENSG00000130600
- OMIM: 103280
Previous GeneCards Identifiers for H19 Gene
- GC11U990149
- GC11M001980
- GC11M001972
- GC11M001976
- GC11M002016
- GC11M001807
Summaries for H19 Gene
-
This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been associated with Beckwith-Wiedemann Syndrome and Wilms tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
GeneCards Summary for H19 Gene
H19 (H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding)) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with H19 include Wilms Tumor 2 and Beckwith-Wiedemann Syndrome.
Additional gene information for H19 Gene
- Monarch Initiative
- Search for H19 at DataMed
- Search for H19 at HumanCyc
No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for H19 Gene
Genomics for H19 Gene
GeneHancer (GH) Regulatory Elements for H19 Gene
Regulatory Element Products
Genomic Locations for H19 Gene
- chr11:1,995,163-2,001,470
- (GRCh38/hg38)
- Size:
- 6,308 bases
- Orientation:
- Minus strand
- chr11:2,016,406-2,022,700
- (GRCh37/hg19)
Genomic View for H19 Gene
- Cytogenetic band:
-
- 11p15.5 by Ensembl
- 11p15.5 by Entrez Gene
- 11p15.5 by HGNC


RefSeq DNA sequence for H19 Gene
Proteins for H19 Gene
Post-translational modifications for H19 Gene
Antibody Products
- Search GeneTex for Antibodies for H19
Protein Products
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for H19
- Origene Custom Protein Services for H19
- Search GeneTex for Proteins for H19
No data available for DME Specific Peptides for H19 Gene
Domains & Families for H19 Gene
Gene Families for H19 Gene
Graphical View of Domain Structure for InterPro Entry
No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for H19 Gene
Function for H19 Gene
Molecular function for H19 Gene
- GENATLAS Biochemistry:
- DNA segment,single copy,probe H19S1,highly expressed in endodermal and mesodermal embryonic tissues,in adult brain,only in the pons and globus pallidus,paternally imprinted,(?same as ASMG),telomeric imprinting domain at 11p15,containing ASCL2,IGF2 and H19,silenced and hypermethylated in most Wilms tumor and in bladder carcinomas,but hypomethylated in benign ovarian teratoma
Phenotypes From GWAS Catalog for H19 Gene
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for H19
-
- Search ViGene Biosciences for H19
CRISPR Products
- Browse CRISPR knockouts for H19
- Applied Biological Materials CRISPR for H19
-
Vectors and viruses for KO, Activation, Repression, and more
miRNA Products
- Search ViGene Biosciences for H19
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for H19
- Browse OriGene Inhibitory RNA Products For H19
- Search ViGene Biosciences for H19
Clone Products
- GenScript: Custom all cDNA clones Services for H19
- VectorBuilder custom plasmid, inducible vectors for H19
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for H19
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for H19
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for H19 Gene
Localization for H19 Gene
No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from the Human Protein Atlas (HPA) and Gene Ontology (GO) - Cellular Components for H19 Gene
Drugs & Compounds for H19 Gene
Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
---|---|---|---|---|---|---|
Platinum compounds | Pharma | 0 |
Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
---|
Transcripts for H19 Gene
mRNA/cDNA for H19 Gene
- (25) Additional mRNA sequences :
- (2627) Selected AceView cDNA sequences:
- (13) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for H19 Gene
CRISPR Products
- Browse CRISPR knockouts for H19
- Applied Biological Materials CRISPR for H19
-
Vectors and viruses for KO, Activation, Repression, and more
miRNA Products
- Search ViGene Biosciences for H19
Inhibitory RNA Products
- Origene sirna, shrna, and RNAi products in human, mouse, rat for H19
- Browse OriGene Inhibitory RNA Products For H19
- Search ViGene Biosciences for H19
Clone Products
- GenScript: Custom all cDNA clones Services for H19
- VectorBuilder custom plasmid, inducible vectors for H19
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for H19
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Applied Biological Materials Clones for H19
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for H19 Gene
mRNA differential expression in normal tissues according to GTEx for H19 Gene
NURSA nuclear receptor signaling pathways regulating expression of H19 Gene:
H19SOURCE GeneReport for Unigene cluster for H19 Gene:
Hs.533566Phenotype-based relationships between genes and organs from Gene ORGANizer for H19 Gene
- ectoderm
- endoderm
- mesoderm
- cardiovascular
- digestive
- endocrine
- integumentary
- nervous
- reproductive
- respiratory
- skeletal muscle
- skeleton
- urinary
- brain
- cheek
- chin
- ear
- eye
- eyelid
- face
- forehead
- head
- jaw
- lip
- mandible
- maxilla
- meninges
- mouth
- neck
- outer ear
- pituitary gland
- skull
- tongue
- tooth
- chest wall
- clavicle
- diaphragm
- heart
- heart valve
- lung
- rib
- rib cage
- scapula
- sternum
- abdominal wall
- adrenal gland
- intestine
- kidney
- large intestine
- liver
- pancreas
- small intestine
- stomach
- ovary
- pelvis
- penis
- testicle
- ureter
- urethra
- urinary bladder
- vagina
- ankle
- arm
- digit
- elbow
- femur
- fibula
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- radius
- shin
- shoulder
- thigh
- tibia
- toe
- ulna
- upper limb
- wrist
- blood
- blood vessel
- peripheral nerve
- peripheral nervous system
- skin
- spinal column
- spinal cord
- sweat gland
- vertebrae
Primer Products
-
OriGene qPCR primer pairs for H19
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners , mRNA Expression by UniProt/SwissProt and Evidence on tissue expression from TISSUES for H19 Gene
Orthologs for H19 Gene
No data available for Orthologs for H19 Gene
Paralogs for H19 Gene
No data available for Paralogs for H19 Gene
Variants for H19 Gene
SNP ID | Clin | Chr 11 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs431825163 | not-provided, Beckwith-Wiedemann syndrome | 2,001,815(-) | G/A | upstream_transcript_variant | |
rs431825164 | not-provided, Beckwith-Wiedemann syndrome | 2,001,083(-) | G/A | genic_upstream_transcript_variant, intron_variant | |
rs431825165 | not-provided, Beckwith-Wiedemann syndrome | 2,001,763(-) | TTAGCATCTCAAGCTCCTAAATTAGCATCTCAA/TTAGCATCTCAA | upstream_transcript_variant | |
rs431825166 | not-provided, Beckwith-Wiedemann syndrome | 2,000,708(-) | T/A | genic_upstream_transcript_variant, intron_variant | |
rs431825167 | not-provided, Beckwith-Wiedemann syndrome | 2,000,108(-) | C/A/T | genic_upstream_transcript_variant, intron_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
dgv1015n100 | CNV | gain | 25217958 |
dgv1016n100 | CNV | gain | 25217958 |
esv29980 | CNV | loss | 17803354 |
nsv1047474 | CNV | gain | 25217958 |
nsv467645 | CNV | gain | 19166990 |
nsv469926 | CNV | loss | 18288195 |
nsv522320 | CNV | loss | 19592680 |
nsv553047 | CNV | gain | 21841781 |
nsv553064 | CNV | loss | 21841781 |
nsv951283 | CNV | deletion | 24416366 |
Additional Variant Information for H19 Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for H19 Gene
Disorders for H19 Gene

(20) MalaCards diseases for H19 Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, Novoseek, and GeneCards
Disorder | Aliases | PubMed IDs |
---|---|---|
wilms tumor 2 |
|
|
beckwith-wiedemann syndrome |
|
|
hemihyperplasia, isolated |
|
|
wilms tumor 1 |
|
|
silver-russell syndrome |
|
|
Additional Disease Information for H19
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for UniProtKB/Swiss-Prot and Genatlas for H19 Gene
Publications for H19 Gene
- The H19 gene imprinting in normal pregnancy and pre-eclampsia. (PMID: 19342096) Yu L … Li L (Placenta 2009) 3 22 44 58
- Polymorphisms in the H19 gene and the risk of bladder cancer. (PMID: 18262338) Verhaegh GW … Kiemeney LA (European urology 2008) 3 22 44 58
- Common genetic variants associated with breast cancer and mammographic density measures that predict disease. (PMID: 20145138) Odefrey F … Australian Twins and Sisters Mammographic Density Study (Cancer research 2010) 3 44 58
- FGFR2 and other loci identified in genome-wide association studies are associated with breast cancer in African-American and younger women. (PMID: 20554749) Barnholtz-Sloan JS … Millikan RC (Carcinogenesis 2010) 3 44 58
- Examination of genetic polymorphisms in newborns for signatures of sex-specific prenatal selection. (PMID: 20587610) Ucisik-Akkaya E … Dorak MT (Molecular human reproduction 2010) 3 44 58
Products for H19 Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Browse OriGene Antibodies
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- Search Origene for Purified Proteins, MassSpec and Protein Over-expression Lysates for H19
- Origene Custom Protein Services for H19
- Origene sirna, shrna, and RNAi products in human, mouse, rat for H19
- Browse OriGene Inhibitory RNA Products For H19
- OriGene qPCR primer pairs for H19
- Browse CRISPR knockouts for H19
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For H19
- GenScript: Custom all cDNA clones Services for H19
- GenScript Custom Purified and Recombinant Proteins Services for H19
- GenScript Custom Assay Services for H19
- GenScript Custom overexpressing Cell Line Services for H19
- Browse GenScript CRISPR for H19
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for H19
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Browse Sino Biological Antibodies
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Cyagen custom Knockout/knockin (KOKI) mouse models for H19
- VectorBuilder custom plasmid, inducible vectors for H19
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for H19
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Search GeneTex for Antibodies for H19
- Search GeneTex for Proteins for H19
- Search ViGene Biosciences for H19
Sources for H19 Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew