Free for academic non-profit institutions. Other users need a Commercial license

Aliases for H19 Gene

Subcategory (RNA class) for H19 Gene

non-coding RNA

Quality Score for this RNA gene is


Aliases for H19 Gene

  • H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding) 2 3 5
  • H19, Imprinted Maternally Expressed Untranslated MRNA 2 3
  • Long Intergenic Non-Protein Coding RNA 8 2 3
  • Non-Protein Coding RNA 8 2
  • NCRNA00008 3
  • LINC00008 3
  • D11S813E 3
  • ASM1 3
  • BWS 3
  • ASM 3
  • WT2 3

External Ids for H19 Gene

Previous GeneCards Identifiers for H19 Gene

  • GC11U990149
  • GC11M001980
  • GC11M001972
  • GC11M001976
  • GC11M002016
  • GC11M001807

Summaries for H19 Gene

Entrez Gene Summary for H19 Gene

  • This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been associated with Beckwith-Wiedemann Syndrome and Wilms tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

GeneCards Summary for H19 Gene

H19 (H19, Imprinted Maternally Expressed Transcript (Non-Protein Coding)) is an RNA Gene, and is affiliated with the non-coding RNA class. Diseases associated with H19 include Wilms Tumor 2 and Beckwith-Wiedemann Syndrome.

Gene Wiki entry for H19 Gene

No data available for UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for H19 Gene

Genomics for H19 Gene

Regulatory Elements for H19 Gene

Enhancers for H19 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11F001810 0.5 Ensembl 11.3 +190.5 190470 0.8 ARID4B KLF17 ZSCAN9 RAD21 ZNF48 ZNF335 GLIS2 ZNF143 THAP11 ZNF654 TNNI2 CTSD ENSG00000229512 ENSG00000250644 ENSG00000235027 IFITM10 MRPL23-AS1 LINC01219 H19 MIR675
GH11F002267 0.9 ENCODE 5.3 -267.6 -267639 3.5 ARID4B DMAP1 ZNF48 SP5 MXD4 REST GLIS1 ETV4 MXD3 SETDB1 C11orf21 H19 ASCL2 GC11M002224
GH11F001850 1 FANTOM5 ENCODE 5.3 +148.7 148666 6.3 HDGF SIN3A GLI4 GLIS2 ELK1 ZNF143 ZNF207 ZNF263 ZNF202 JUNB LSP1 KCNQ1OT1 TNNI2 TNNT3 H19 C11orf21 TSPAN32 IGF2 MIR7847
GH11F002189 1.5 FANTOM5 Ensembl ENCODE 4.7 -191.0 -191043 5.8 PKNOX1 MLX ZFP64 ARID4B DMAP1 ZNF48 SLC30A9 GLIS2 ZNF143 SP5 TH ASCL2 NAP1L4 H19 GC11M002206 MIR4686
GH11F002001 1.2 Ensembl ENCODE 0.8 -0.8 -770 1.7 ZBTB10 CTCF ZNF654 REST ZBTB7A RAD21 SMC3 CREM MYC SETDB1 TNNI2 SYT8 KRTAP5-6 FAM99B LOC100505570 MIR675 H19 PIR50683
- Elite enhancer/Elite enhancer-gene association Download Table
Download GeneHancer data dump

Enhancers around H19 on UCSC Golden Path with GeneCards custom track

Genomic Location for H19 Gene

1,995,163 bp from pter
2,001,470 bp from pter
6,308 bases
Minus strand

Genomic View for H19 Gene

Genes around H19 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
H19 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for H19 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for H19 Gene

Proteins for H19 Gene

Post-translational modifications for H19 Gene

No Post-translational modifications

No data available for DME Specific Peptides for H19 Gene

Domains & Families for H19 Gene

Gene Families for H19 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with H19: view

No data available for Protein Domains , Suggested Antigen Peptide Sequences and UniProtKB/Swiss-Prot for H19 Gene

Function for H19 Gene

Molecular function for H19 Gene

GENATLAS Biochemistry:
DNA segment,single copy,probe H19S1,highly expressed in endodermal and mesodermal embryonic tissues,in adult brain,only in the pons and globus pallidus,paternally imprinted,(?same as ASMG),telomeric imprinting domain at 11p15,containing ASCL2,IGF2 and H19,silenced and hypermethylated in most Wilms tumor and in bladder carcinomas,but hypomethylated in benign ovarian teratoma

Human Phenotype Ontology for H19 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Phenotypes , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for H19 Gene

Localization for H19 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for H19 Gene

Pathways & Interactions for H19 Gene

SuperPathways for H19 Gene

No Data Available

Interacting Proteins for H19 Gene

Gene Ontology (GO) - Biological Process for H19 Gene


No data available for Pathways by source and SIGNOR curated interactions for H19 Gene

Drugs & Compounds for H19 Gene

(6) Drugs for H19 Gene - From: PharmGKB and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Platinum compounds Pharma 0

(13) Additional Compounds for H19 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with H19: view

Transcripts for H19 Gene

Unigene Clusters for H19 Gene

H19, imprinted maternally expressed transcript (non-protein coding):
Representative Sequences:

Inhibitory RNA Products

Clone Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for H19 Gene

No ASD Table

Relevant External Links for H19 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for H19 Gene

mRNA expression in normal human tissues for H19 Gene

mRNA differential expression in normal tissues according to GTEx for H19 Gene

This gene is overexpressed in Muscle - Skeletal (x11.1) and Adrenal Gland (x4.6).

NURSA nuclear receptor signaling pathways regulating expression of H19 Gene:


SOURCE GeneReport for Unigene cluster for H19 Gene:

genes like me logo Genes that share expression patterns with H19: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for H19 Gene

Orthologs for H19 Gene

Evolution for H19 Gene

Gene Tree for H19 (if available)
Gene Tree for H19 (if available)

No data available for Orthologs for H19 Gene

Paralogs for H19 Gene

No data available for Paralogs for H19 Gene

Variants for H19 Gene

Sequence variations from dbSNP and Humsavar for H19 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs431825163 untested 2,001,815(+) GGAAT(A/G)TTAAT intron-variant, upstream-variant-2KB
rs431825164 untested 2,001,083(+) CCCCC(A/G)ATGAC intron-variant
rs431825165 untested 2,001,763(+) GCTCT(-/TTAGCATCTCAAGCTCCTAAA)TTAGC intron-variant, upstream-variant-2KB
rs431825166 untested 2,000,708(+) TGGCT(A/T)GCGGG intron-variant
rs431825167 untested 2,000,108(+) CCCTG(A/C)GAGAA intron-variant

Structural Variations from Database of Genomic Variants (DGV) for H19 Gene

Variant ID Type Subtype PubMed ID
dgv1015n100 CNV gain 25217958
dgv1016n100 CNV gain 25217958
esv29980 CNV loss 17803354
nsv1047474 CNV gain 25217958
nsv467645 CNV gain 19166990
nsv469926 CNV loss 18288195
nsv522320 CNV loss 19592680
nsv553047 CNV gain 21841781
nsv553064 CNV loss 21841781
nsv951283 CNV deletion 24416366

Relevant External Links for H19 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Variation tolerance for H19 Gene

Disorders for H19 Gene

MalaCards: The human disease database

(21) MalaCards diseases for H19 Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, Novoseek, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search H19 in MalaCards View complete list of genes associated with diseases

Relevant External Links for H19

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with H19: view

No data available for UniProtKB/Swiss-Prot and Genatlas for H19 Gene

Publications for H19 Gene

  1. The H19 gene imprinting in normal pregnancy and pre-eclampsia. (PMID: 19342096) Yu L. … Li L. (Placenta 2009) 3 22 46 64
  2. Polymorphisms in the H19 gene and the risk of bladder cancer. (PMID: 18262338) Verhaegh G.W. … Kiemeney L.A. (Eur. Urol. 2008) 3 22 46 64
  3. Common genetic variants associated with breast cancer and mammographic density measures that predict disease. (PMID: 20145138) Odefrey F. … Southey M.C. (Cancer Res. 2010) 3 46 64
  4. FGFR2 and other loci identified in genome-wide association studies are associated with breast cancer in African-American and younger women. (PMID: 20554749) Barnholtz-Sloan J.S. … Millikan R.C. (Carcinogenesis 2010) 3 46 64
  5. Examination of genetic polymorphisms in newborns for signatures of sex-specific prenatal selection. (PMID: 20587610) Ucisik-Akkaya E. … Dorak M.T. (Mol. Hum. Reprod. 2010) 3 46 64

Products for H19 Gene

Sources for H19 Gene

Loading form....