Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

GSTA4 Gene

protein-coding   GIFtS: 66
GCID: GC06M052889

glutathione S-transferase alpha 4

(Previous name: glutathione S-transferase A4 )
 Explore 32 diseases affiliated with
GSTA4 via our new
 Human Malady Compendium 
Biological research products
for GSTA4
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Glutathione S-Transferase Alpha 41 2     GTA42
Glutathione S-Transferase A41 2     Glutathione S-Alkyltransferase A42
Glutathione S-Transferase A4-42 3     Glutathione S-Aralkyltransferase A42
GST Class-Alpha Member 42 3     Glutathione S-Aryltransferase A42
EC 2.5.1.183 8     Glutathione Transferase A4-42
GSTA4-42     S-(Hydroxyalkyl)Glutathione Lyase A42

External Ids:    HGNC: 46291   Entrez Gene: 29412   Ensembl: ENSG000001708997   OMIM: 6054505   UniProtKB: O152173   

Export aliases for GSTA4 gene to outside databases

Previous GC identifers: GC06M052844 GC06M052950 GC06M052674


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for GSTA4:
Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These
enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic
compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have
been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase
belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly
related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid
peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of
degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis.
(provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: GSTA4_HUMAN, O15217
Function: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.
This isozyme has a high catalytic efficiency with 4-hydroxyalkenals such as 4-hydroxynonenal (4-HNE)

summary for GSTA4:
Glutathione S-transferases (GSTs) are a family of enzymes that catalyze a variety of reactions in both
eukaryotes and prokaryotes. They catalyze the conjugation of reduced glutathione with potentially toxic,
xenobiotic substrates, thus aiding excretion from the body.

Gene Wiki entry for GSTA4


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000006.11  NC_018917.1  NT_007592.15  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the GSTA4 gene promoter:
         POU2F2 (Oct-2.1)   Oct-B1   oct-B3   oct-B2   Nkx2-5   POU2F2   POU2F2C   POU2F1   POU2F1a   POU2F2B   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidGSTA4 promoter sequence
   Search SABiosciences Chromatin IP Primers for GSTA4

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat GSTA4


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 6p12.1   Ensembl cytogenetic band:  6p12.2   HGNC cytogenetic band: 6p12.2

GSTA4 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
GSTA4 gene location

GeneLoc information about chromosome 6         GeneLoc Exon Structure

GeneLoc location for GC06M052889:  view genomic region     (about GC identifiers)

Start:
52,842,746 bp from pter      End:
52,860,178 bp from pter
Size:
17,433 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: GSTA4_HUMAN, O15217 (See protein sequence)
Recommended Name: Glutathione S-transferase A4  
Size: 222 amino acids; 25704 Da
Subunit: Homodimer
Subcellular location: Cytoplasm
3 PDB 3D structures from and Proteopedia for GSTA4:
1GUL (3D)        1GUM (3D)        3IK7 (3D)    
Secondary accessions: B2RD15 Q5T7Q8 Q9BX18 Q9H414

Explore the universe of human proteins at neXtProt for GSTA4: NX_O15217

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_O15217

  • 4/5 DME Specific Peptides for GSTA4 (O15217) (see all 5)
     SNIPTIK  RYFPVFEK  FLVGNQLS  LAAAGVEF 

    GSTA4 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_001503.1  
    ENSEMBL proteins: 
     ENSP00000360002   ENSP00000359999   ENSP00000359998   ENSP00000394228   ENSP00000439439  
    Reactome Protein details: O15217
    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein: GSTA4
    OriGene Protein Over-expression Lysate: GSTA4
    OriGene Custom Protein Services for GSTA4 
    GenScript Custom Purified and Recombinant Proteins Services for GSTA4
    Novus Biologicals GSTA4 Proteins
    Novus Biologicals GSTA4 Lysates
    Browse Sino Biological Recombinant Proteins
    ProSpec Recombinant Protein for GSTA4
    Browse Proteins at Uscn

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005829cytosol TAS--


    GSTA4 for ontologies           About GeneDecksing



    GSTA4 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies (see all 4): GSTA4
    OriGene Custom Antibody Services for GSTA4 
    GenScript Custom Superior Antibodies Services for GSTA4
    Novus Biologicals GSTA4 Antibodies
    Abcam antibodies for GSTA4 
    Browse Antibodies at Uscn
    Search ThermoFisher Antibodies for GSTA4

    Assay Products for GSTA4: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for GSTA4
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs and CLIAs at Uscn


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    GSTA4 for domains           About GeneDecksing

    5/6 InterPro domains/families (see all 6):
     IPR012336 Thioredoxin-like_fold
     IPR003080 GST_alpha
     IPR004046 GST_C
     IPR017933 Glutathione_S_Trfase/Cl_chnl_C
     IPR004045 Glutathione_S-Trfase_N

    Graphical View of Domain Structure for InterPro Entry O15217

    ProtoNet protein and cluster: O15217

    2 Blocks protein families:
    IPB003080 Alpha-class glutathione S-transferase signature
    IPB004045 Glutathione S-transferase


    UniProtKB/Swiss-Prot: GSTA4_HUMAN, O15217
    Similarity: Belongs to the GST superfamily. Alpha family
    Similarity: Contains 1 GST C-terminal domain
    Similarity: Contains 1 GST N-terminal domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:

         UniProtKB/Swiss-Prot: GSTA4_HUMAN, O15217
    Function: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.
    This isozyme has a high catalytic efficiency with 4-hydroxyalkenals such as 4-hydroxynonenal (4-HNE)
    Catalytic activity: RX + glutathione = HX + R-S-glutathione

         Genatlas biochemistry entry for GSTA4:
    glutathione S-transferase,alpha 4,ubiquitously expressed

    Enzyme Number (IUBMB): EC 2.5.1.181 2

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: GSTA4
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat GSTA4
    5 QIAGEN miScript miRNA Assays for microRNAs that regulate GSTA4:
    hsa-miR-29a hsa-miR-29c hsa-miR-767-5p hsa-miR-450b-3p hsa-miR-29b
    SwitchGear 3'UTR luciferase reporter plasmidGSTA4 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for GSTA4 (see all 7)
    OriGene shRNA RFP: GSTA4
    OriGene siRNA: GSTA4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat GSTA4

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for GSTA4

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for GSTA4 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for GSTA4 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: GSTA4 (NM_001512)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for GSTA4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat GSTA4 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for GSTA4
    Search LifeMap BioReagents cell lines for GSTA4

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for GSTA4

    Gene Ontology (GO): 2 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0004364glutathione transferase activity IDA11851347
    GO:0042803protein homodimerization activity IPI10329152


    GSTA4 for ontologies           About GeneDecksing


    Animal Models:
         Mouse knock-out Gsta4tm1Pzim for GSTA4
         5 MGI mutant phenotypes (inferred from 2 alleles(MGI details for Gsta4):
     cellular  homeostasis/metabolism  immune system  reproductive system  skeleton 

    GSTA4 for phenotypes           About GeneDecksing


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways - 5/6 super-pathways (see all 6About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1Glutathione metabolism
    Glutathione metabolism1.00
    glutathione-mediated detoxification I0.53
    Glutathione metabolism0.92
    Glutathione conjugation0.50
    Glutathione metabolism0.70
    2Biological oxidations
    Biological oxidations1.00
    metapathway biotransformation0.41
    Phase II conjugation0.52
    32-Naphthylamine and 2-Nitronaphtalene metabolism
    2-Naphthylamine and 2-Nitronaphtalene metabolism1.00
    2-Naphthylamine and 2-Nitronaphtalene metabolism0.95
    4Drug metabolism - cytochrome P450
    Drug metabolism - cytochrome P4501.00
    Metabolism of xenobiotics by cytochrome P4500.73
    5Metabolism
    Metabolism1.00

    Pathway sources
    See GeneCards unified pathways
    Show all pathways

    2 EMD Millipore Pathways for GSTA4
        2-Naphthylamine and 2-Nitronaphtalene metabolism
    Glutathione metabolism


    2 GeneGo (Thomson Reuters) Pathways for GSTA4
        2-Naphthylamine and 2-Nitronaphtalene metabolism
    Glutathione metabolism

    3 BioSystems Pathways for GSTA4 
        glutathione-mediated detoxification I
    metapathway biotransformation
    4-hydroxy-2-nonenal detoxification

    4        Reactome Pathways for GSTA4
        Metabolism
    Biological oxidations
    Glutathione conjugation
    Phase II conjugation


    3         Kegg Pathways  (Kegg details for GSTA4):
        Glutathione metabolism
    Metabolism of xenobiotics by cytochrome P450
    Drug metabolism - cytochrome P450


    GSTA4 for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for GSTA4

    STRING Interaction Network Preview (showing 5 interactants - click image to see 25)

    5/62 Interacting proteins for GSTA4 (O152172 ENSP000003599984) via UniProtKB, MINT, STRING, and/or I2D (see all 62)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    GSTA4O152172MINT-68483
    ADH1AENSP000002096684STRING: ENSP00000209668
    ADH1BENSP000003066064STRING: ENSP00000306606
    ADH4ENSP000002655124STRING: ENSP00000265512
    ADH5ENSP000002964124STRING: ENSP00000296412
    About this table

    Gene Ontology (GO): 3 biological process terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006749glutathione metabolic process IDA10329152
    GO:0006805xenobiotic metabolic process TAS--
    GO:0044281small molecule metabolic process TAS--


    GSTA4 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section

    GSTA4 for compounds           About GeneDecksing

    EMD Millipore small molecules for GSTA4:
    Small Molecule - inhibitor
    Browse drugs & compounds from Enzo Life Sciences

    Compounds for GSTA4 available from Tocris Bioscience    About this table
    CompoundAction CAS #
    Ellagic acidSelective inhibitor of CK2. Also inhibits glutathione S-transferase[476-66-4]

    10/13 HMDB Compounds for GSTA4 (see all 13)    About this table
    CompoundSynonyms CAS #PubMed Ids
    4-Hydroxynonenal4-hydroxynon-2-enal (see all 5)75899-68-215288119
    2-Hydroxyestrone-1-S-glutathione2,3-dihydroxy-1,3,5[10]-estratriene-17-one-1-S-glutathione;2-hydroxyestrone-1-S-glutathione ----
    2-Hydroxyestrone-4-S-glutathione2,3-dihydroxy-1,3,5[10]-estratriene-17-one-4-S-glutathione ----
    4-Hydroxyestrone-2-S-glutathione3,4-dihydroxy-1,3,5[10]-estratriene-17-one-2-S-glutathione ----
    Adrenochromeadrenochrome oxidised;adrenochrome O-quinone;N-methyl-5,6-dioxo-2,3,5,6-tetrahydro-3-hydroxyindole;N-methyl-5,6-dioxo-2,3,5,6-tetrahydro-3-indolol;AdChr 54-06-8--
    Estrone-2,3-quinonecatecholestrogen quinone 40551-33-5--
    Estrone-3,4-quinonecatecholestrogen quinone 633-34-1--
    Glutathione5-L-Glutamyl-L-cysteinylglycine (see all 32)70-18-8--
    Hydrochloric acidHydrogen chloride anhydrous [UN1050] [Poison gas] (see all 16)7647-01-0--
    Noradrenochromenoradrenochrome O-quinone;noradrenochrome oxidised;5,6-dioxo-2,3,5,6-tetrahydro-3-hydroxyindole;5,6-dioxo-2,3,5,6-tetrahydro-3-indolol;AdChr 490-89-1--

    1 DrugBank Compound for GSTA4    About this table
    CompoundSynonyms CAS #TypeActionsPubMed Ids
    Glutathione5-L-Glutamyl-L-cysteinylglycine (see all 5)70-18-8target--17553661

    3 Novoseek chemical compound relationships for GSTA4 gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    4-hydroxynonenal 86.3 39 20085333 (6), 18782442 (3), 19482077 (1), 9461507 (1) (see all 10)
    gsts 84.8 3 12833161 (1), 16054170 (1), 18664505 (1)
    lipid 45.9 10 9461507 (1), 12230403 (1), 17561509 (1), 20085333 (1) (see all 8)

    Search CenterWatch for drugs/clinical trials and news about GSTA4 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for GSTA4 gene: 
    NM_001512.3  

    Unigene Cluster for GSTA4:

    Glutathione S-transferase alpha 4
    Hs.485557  [show with all ESTs]
    Unigene Representative Sequence: BC071631
    7 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000486559 ENST00000477599 ENST00000370963(uc003pbf.3) ENST00000370960
    ENST00000370959 ENST00000457564 ENST00000541324(uc003pbd.3)

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: GSTA4
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat GSTA4
    5 QIAGEN miScript miRNA Assays for microRNAs that regulate GSTA4:
    hsa-miR-29a hsa-miR-29c hsa-miR-767-5p hsa-miR-450b-3p hsa-miR-29b
    SwitchGear 3'UTR luciferase reporter plasmidGSTA4 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for GSTA4 (see all 7)
    OriGene shRNA RFP: GSTA4
    OriGene siRNA: GSTA4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat GSTA4
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for GSTA4 (see all 3)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for GSTA4 (see all 2)
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: GSTA4 (NM_001512)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for GSTA4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat GSTA4 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for GSTA4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat GSTA4
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat GSTA4
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat GSTA4

    Additional cDNA sequence: 

    AF020918.1 AF025887.1 AF125271.1 AF125272.1 AF125273.1 AK074541.1 AK125212.1 AK315369.1 
    BC015523.2 BC063439.1 BC071631.1 Y13047.1 

    18 DOTS entries:

    DT.456142  DT.447913  DT.95208217  DT.102844276  DT.121406104  DT.447912  DT.100795806  DT.121406239 
    DT.121406141  DT.87015516  DT.95271705  DT.95271709  DT.95333186  DT.100795800  DT.121406134  DT.92439624 
    DT.100738501  DT.100795808 

    24/271 AceView cDNA sequences (see all 271):

    CA314433 CA424585 AF125272 CR597241 BF436349 BE796228 CR594939 BM700452 
    BI827183 Y13047 CR599141 AI583968 CA393326 AA418695 AA759194 AA354972 
    BP371356 BI754166 W42533 AA298566 AI554147 AA777851 BM698104 AV710933 

    GeneLoc Exon Structure

    5/18 Alternative Splicing Database (ASD) splice patterns (SP) for GSTA4 (see all 18)    About this scheme

    ExUns: 1a · 1b · 1c · 1d · 1e ^ 2 ^ 3a · 3b · 3c · 3d ^ 4a · 4b ^ 5a · 5b · 5c · 5d · 5e · 5f · 5g ^ 6a · 6b · 6c · 6d ^ 7 ^ 8a · 8b ^
    SP1:                                -     -     -           -     -           -                             -     -     -                 -     -               
    SP2:                                -     -     -           -     -           -     -     -     -     -     -     -     -                 -     -               
    SP3:                                -     -     -           -     -           -                       -     -     -     -     -           -     -               
    SP4:                                                                          -                             -     -     -                 -     -               
    SP5:                                                                          -           -     -     -     -     -     -                 -     -               

    ExUns: 9a · 9b · 9c · 9d · 9e · 9f
    SP1:                                    
    SP2:                                    
    SP3:                                    
    SP4:                                    
    SP5:                                    


    ECgene alternative splicing isoforms for GSTA4

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    GSTA4 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TCCTGTAGCC

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image

    GSTA4 expression in embryonic tissues and stem cells
    Expression by the Database of Embryonic development, Stem cell research, and Regenerative medicine    About this table
    7 LifeMap In Vivo Development Anatomical Compartments/Cells 
    Tissue Anatomical Compartment CellCategory (developmental path)
    Extraembryonic MesodermExtraembryonic Blood IslandsPrimitive ErythrocytesBlood
    EyeInner Nuclear LayerMature Rod Bipolar CellsBipolar, Retina
    BoneCaudal Endochondral BonesBone
    BrainChoroid PlexusBrain
    BrainFourth VentricleBrain
    Neural TubeMetencephalonNeural Tube
    Spinal CordPresumptive Spinal CordSpinal Cord
    Expression: Positive    Negative     Selective marker
    Experimental details: Curated     Microarrays     In-situ hybridization
    Stem Cell Differentiation: 2 LifeMap Cells 
    NameCategory
    Mesendoderm-like cells (Generation of mesend...)
    Mature follicles (In-vitro growth and ...)

    See GSTA4 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for GSTA4

    SOURCE GeneReport for Unigene cluster: Hs.485557

    UniProtKB/Swiss-Prot: GSTA4_HUMAN, O15217
    Tissue specificity: Expressed at a high level in brain, placenta, and skeletal muscle and much lower in lung and liver

        SABiosciences Expression via Pathway-Focused PCR Arrays including GSTA4: 
              Drug Metabolism: Phase II Enzymes in human mouse rat
              Drug Metabolism in human mouse rat

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for GSTA4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat GSTA4
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat GSTA4
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat GSTA4
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for GSTA4

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of chordates.

    Orthologs for GSTA4 gene from 2/13 species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    chicken
    (Gallus gallus)
    Aves Q9W6J2_CHICK6
    glutathione S-transferase A3
    62(a)
    1 ↔ 1
    3(91190846-91198880)
    zebrafish
    (Danio rerio)
    Actinopterygii gstal6
    zgc:1739616
    (see all 3)
    zgc:173961
    (see all 3)
    53(a)
    53(a)
    (see all 3)
    many ↔ many
    many ↔ many
    (see all 3)
    13(715869-724232)
    13(701311-704057)


    ENSEMBL Gene Tree for GSTA4 (if available)
    TreeFam Gene Tree for GSTA4 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for GSTA4 gene
    GSTA52  GSTA32  GSTA12  GSTM12  GSTM32  GSTA22  GSTP12  GSTM42  
    HPGDS2  GSTM52  GSTM22  
    5 SIMAP similar genes for GSTA4 using alignment to 3 protein entries:     GSTA4_HUMAN (see all proteins):
    GSTA2    GSTA3    GSTA5    GSTA1    GSTalpha locus

    GSTA4 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/419 NCBI SNPs in GSTA4 are shown (see all 419    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 6 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs112679731,2
    C,--52842295(+) TCTCA-/AACTCCTGACC
    TCAGGTGATCTAC
    AACTC
    1 -- ds50011Minor allele frequency- AACTCCTGACCTCAGGTGATCTAC:0.00NA 2
    rs668454271,2
    C--52842295(+) TCTCA-/AACTCCTGACC
    TCAGGTGATCTAC
    AACTC
    1 -- ds50010--------
    rs6437291,2
    C,H--52842302(+) CTCCTC/GACCTC 1 -- ds50010--------
    rs6441001,2
    C,--52842371(+) GGGAGC/ACCCTG 1 -- ds50018Minor allele frequency- A:0.34WA NA EA 368
    rs1897791781,2
    --52842572(+) GGAAGC/GGTACA 1 -- ds50010--------
    rs37988091,2
    C,F,--52842688(-) TTGCAC/TGGTTC 1 -- ds50012Minor allele frequency- T:0.01EA WA 1426
    rs1813677311,2
    --52842717(+) AAAAAC/TTAATT 1 -- ds50010--------
    rs4057291,2
    C,F,A,H,--52842781(-) TCAGTG/ATTAGC 1 -- ut3142Minor allele frequency- A:0.37MN NS EA NA WA 5816
    rs455478371,2
    C,--52842784(-) CAATCA/GGTGTT 1 -- ut315Minor allele frequency- G:0.00NS 190
    rs74961,2
    C,F,A,H,--52842839(-) GTCTAG/ATAAAT 1 -- ut31 ese342Minor allele frequency- A:0.17MN EA NA NS WA CSA 6166

    HapMap Linkage Disequilibrium report for GSTA4 (52842746 - 52860178 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for GSTA4
         1 CNV: 2631

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing GSTA4
    DNA2.0 Custom Variant and Variant Library Synthesis for GSTA4

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    GSTA4 for disorders           About GeneDecksing

    OMIM gene information: 605450    OMIM disorders: --

    20/32 diseases for GSTA4 (see all 32):    About MalaCards
    parkinson's disease    alzheimer's disease    atherosclerosis    cataract
    dissecting aortic aneurysm    malignant pleural mesothelioma    aortic aneurysm    urinary bladder cancer
    toxic encephalopathy    barrett's adenocarcinoma    schistosomiasis    neurodegenerative disease
    brain disease    lung cancer    hepatitis b    skin cancer
    hermaphroditism    noma    oral cancer    pulmonary disease

    2 Novoseek disease relationships for GSTA4 gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    atherosclerosis 14.8 1 15064094 (1)
    parkinson disease 6.78 1 16054170 (1)

    Genetic Association Database (GAD): GSTA4
    Human Genome Epidemiology (HuGE) Navigator: GSTA4 (24 documents)

    Export disorders for GSTA4 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for GSTA4 gene, integrated from 9 sources (see all 69):
    (articles sorted by number of sources associating them with GSTA4)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of cDNAs encoding two human alpha class glutathione transferases (GSTA3 and GSTA4) and the heterologous expression of GSTA4-4. (PubMed id 9480897)1, 2, 3, 9 Board P.G. (1998)
    2. Substrate specificity combined with stereopromiscuity in glutathione transferase A4-4-dependent metabolism of 4-hydroxynonenal. (PubMed id 20085333)1, 2, 9 Balogh L.M....Atkins W.M. (2010)
    3. Human glutathione transferase A4-4 crystal structures and mutagenesis reveal the basis of high catalytic efficiency with toxic lipid peroxidation products. (PubMed id 10329152)1, 2, 9 Bruns C.M.... Tainer J.A. (1999)
    4. Human glutathione transferase A4-4: an alpha class enzyme with high catalytic efficiency in the conjugation of 4-hydroxynonenal and other genotoxic products of lipid peroxidation. (PubMed id 9461507)1, 2, 9 Hubatsch I.... Mannervik B. (1998)
    5. Molecular implications of the human glutathione transferase A-4 gene (hGSTA4) polymorphisms in neurodegenerative diseases. (PubMed id 16054170)1, 4, 9 Coppede F....Migliore L. (2005)
    6. Transfection of HepG2 cells with hGSTA4 provides protection against 4-hydroxynonenal-mediated oxidative injury. (PubMed id 17553661)1, 7 Gallagher E.P....Gardner J.L. (2007)
    7. A comprehensive analysis of phase I and phase II metabolism gene polymorphisms and risk of colorectal cancer. (PubMed id 16006997)1, 4 Landi S....Canzian F. (2005)
    8. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    9. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    10. The DNA sequence and analysis of human chromosome 6. (PubMed id 14574404)1, 2 Mungall A.J.... Beck S. (2003)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 2941 HGNC: 4629 AceView: GSTA4 Ensembl:ENSG00000170899 euGenes: HUgn2941
    ECgene: GSTA4 Kegg: 2941 H-InvDB: GSTA4

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for GSTA4 Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for GSTA4 Genetics and Cytogenetics in Oncology and Haematology
    NIEHS-SNPshttp://egp.gs.washington.edu/data/gsta4/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for GSTA4 gene:
    Search GeneIP for patents involving GSTA4

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     Browse Purified and Recombinant Proteins at EMD Millipore
     Browse Kits and Assays available from EMD Millipore
     Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
     Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
     EMD Millipore small molecules (inhibitor) for GSTA4
     Browse for Gene Knock-down Tools from EMD Millipore
     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     OriGene Antibodies for GSTA4   OriGene shRNA RFP for GSTA4  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for GSTA4   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for GSTA4  
     OriGene Protein Over-expression Lysate for GSTA4   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for GSTA4   OriGene 3'-UTR Clone for GSTA4  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for GSTA4   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for GSTA4  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     OriGene Purified Protein for GSTA4   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for GSTA4   OriGene Custom Protein Services for GSTA4  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat GSTA4
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing GSTA4
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat GSTA4
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat GSTA4
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat GSTA4
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat GSTA4
     GenScript Custom Purified and Recombinant Proteins Services for GSTA4 GenScript cDNA clones with any tag delivered in your preferred vector for GSTA4
     GenScript Custom Assay Services for GSTA4 GenScript Custom Superior Antibodies Services for GSTA4
     GenScript Custom overexpressing Cell Line Services for GSTA4 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in GSTA4 promoter
     Search Chromatin IP Primers for GSTA4
     RT2 qPCR Primer Assay in human, mouse / rat GSTA4
     Search GNC Networks for GSTA4
     SABiosciences PCR Arrays including human, mouse / rat GSTA4
     Tocris compounds for GSTA4
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     GSTA4 antibodies
     GSTA4 proteins
     GSTA4 lysates
     Antibodies for GSTA4
     See all of Abcam's Antibodies, Kits and Proteins for GSTA4
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Recombinant Protein for GSTA4




     Browse ELISAs, CLIAs, Proteins, and Antibodies at Uscn
     Search LifeMap BioReagents cell lines for GSTA4
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for GSTA4
     SwitchGear 3'UTR luciferase reporter plasmids for GSTA4
     SwitchGear Promoter luciferase reporter plasmids for GSTA4
     Search ThermoFisher Antibodies for GSTA4
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat GSTA4
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      GSTA4 gene at Home site.
    hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4