Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GSDMC Gene

Aliases for GSDMC Gene

  • Gasdermin C 2 3 5
  • Melanoma-Derived Leucine Zipper-Containing Extranuclear Factor 3 4
  • Melanoma-Derived Leucine Zipper, Extra-Nuclear Factor 2 3
  • MLZE 3 4

External Ids for GSDMC Gene

Previous HGNC Symbols for GSDMC Gene

  • MLZE

Previous GeneCards Identifiers for GSDMC Gene

  • GC08M130830
  • GC08M126079

Summaries for GSDMC Gene

GeneCards Summary for GSDMC Gene

GSDMC (Gasdermin C) is a Protein Coding gene. An important paralog of this gene is GSDMD.

UniProtKB/Swiss-Prot for GSDMC Gene

  • Upon activation, mediates pyroptosis.

No data available for Entrez Gene Summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GSDMC Gene

Genomics for GSDMC Gene

Regulatory Elements for GSDMC Gene

Promoters for GSDMC Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around GSDMC on UCSC Golden Path with GeneCards custom track

Genomic Location for GSDMC Gene

129,705,903 bp from pter
129,786,888 bp from pter
80,986 bases
Minus strand

Genomic View for GSDMC Gene

Genes around GSDMC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GSDMC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GSDMC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GSDMC Gene

Proteins for GSDMC Gene

  • Protein details for GSDMC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Protein Accession:
    Secondary Accessions:
    • Q5XKF3
    • Q6P494

    Protein attributes for GSDMC Gene

    508 amino acids
    Molecular mass:
    57692 Da
    Quaternary structure:
    No Data Available

neXtProt entry for GSDMC Gene

Proteomics data for GSDMC Gene at MOPED

Post-translational modifications for GSDMC Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GSDMC Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for GSDMC Gene

Domains & Families for GSDMC Gene

Protein Domains for GSDMC Gene


Suggested Antigen Peptide Sequences for GSDMC Gene

Graphical View of Domain Structure for InterPro Entry



  • Intramolecular interactions between N- and C-terminal domains may be important for autoinhibition in the absence of activation signal. The intrinsic pyroptosis-inducing activity is carried by the N-terminal domain.
  • Belongs to the gasdermin family.
  • Intramolecular interactions between N- and C-terminal domains may be important for autoinhibition in the absence of activation signal. The intrinsic pyroptosis-inducing activity is carried by the N-terminal domain.
  • Belongs to the gasdermin family.
genes like me logo Genes that share domains with GSDMC: view

No data available for Gene Families for GSDMC Gene

Function for GSDMC Gene

Molecular function for GSDMC Gene

UniProtKB/Swiss-Prot Function:
Upon activation, mediates pyroptosis.
genes like me logo Genes that share phenotypes with GSDMC: view

Animal Model Products

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GSDMC Gene

Localization for GSDMC Gene

Subcellular locations from UniProtKB/Swiss-Prot for GSDMC Gene


Subcellular locations from

Jensen Localization Image for GSDMC Gene COMPARTMENTS Subcellular localization image for GSDMC gene
Compartment Confidence
cytoskeleton 5
mitochondrion 5
cytosol 2
nucleus 2

No data available for Gene Ontology (GO) - Cellular Components for GSDMC Gene

Pathways & Interactions for GSDMC Gene

SuperPathways for GSDMC Gene

No Data Available

Interacting Proteins for GSDMC Gene

Gene Ontology (GO) - Biological Process for GSDMC Gene


No data available for Pathways by source and SIGNOR curated interactions for GSDMC Gene

Drugs & Compounds for GSDMC Gene

No Compound Related Data Available

Transcripts for GSDMC Gene

mRNA/cDNA for GSDMC Gene

Unigene Clusters for GSDMC Gene

Gasdermin C:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for GSDMC Gene

No ASD Table

Relevant External Links for GSDMC Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GSDMC Gene

mRNA expression in normal human tissues for GSDMC Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GSDMC Gene

This gene is overexpressed in Esophagus - Mucosa (x13.4), Skin - Not Sun Exposed (Suprapubic) (x10.4), Skin - Sun Exposed (Lower leg) (x9.7), Spleen (x6.5), and Vagina (x4.5).

Protein differential expression in normal tissues from HIPED for GSDMC Gene

This gene is overexpressed in NK cells (44.7) and Platelet (24.3).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GSDMC Gene

SOURCE GeneReport for Unigene cluster for GSDMC Gene Hs.133244

mRNA Expression by UniProt/SwissProt for GSDMC Gene

Tissue specificity: Expressed mainly in trachea and spleen (PubMed:11223543). In the esophagus, expressed in differentiating cells and probably in differentiated cells. Also detected in gastric epithelium (PubMed:19051310).
genes like me logo Genes that share expression patterns with GSDMC: view

Protein tissue co-expression partners for GSDMC Gene

- Elite partner

Primer Products

In Situ Assay Products

Orthologs for GSDMC Gene

This gene was present in the common ancestor of chordates.

Orthologs for GSDMC Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia LOC508492 35
  • 69.91 (n)
  • 55.28 (a)
  • 51 (a)
(Canis familiaris)
Mammalia LOC609825 35
  • 72.93 (n)
  • 58.76 (a)
  • 54 (a)
(Mus musculus)
Mammalia Gsdmc 35
  • 66.37 (n)
  • 52.09 (a)
Gsdmc4 16
Gsdmc 36
  • 47 (a)
Gsdmc2 36
  • 46 (a)
Gsdmc3 36
  • 46 (a)
Gsdmc4 36
  • 45 (a)
Gsdmcl1 36
  • 30 (a)
Gsdmcl2 36
  • 30 (a)
(Pan troglodytes)
Mammalia GSDMC 35
  • 99.48 (n)
  • 98.82 (a)
  • 97 (a)
(Rattus norvegicus)
Mammalia Gsdmc 35
  • 67.46 (n)
  • 53.26 (a)
(Monodelphis domestica)
Mammalia -- 36
  • 37 (a)
-- 36
  • 40 (a)
-- 36
  • 33 (a)
-- 36
  • 36 (a)
-- 36
  • 35 (a)
(Ornithorhynchus anatinus)
Mammalia -- 36
  • 38 (a)
(Gallus gallus)
Aves GSDMA 36
  • 22 (a)
(Anolis carolinensis)
Reptilia -- 36
  • 20 (a)
Species with no ortholog for GSDMC:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for GSDMC Gene

Gene Tree for GSDMC (if available)
Gene Tree for GSDMC (if available)

Paralogs for GSDMC Gene

Paralogs for GSDMC Gene

genes like me logo Genes that share paralogs with GSDMC: view

Variants for GSDMC Gene

Sequence variations from dbSNP and Humsavar for GSDMC Gene

SNP ID Clin Chr 08 pos Sequence Context AA Info Type
rs10090835 - 129,777,521(+) GACAG(A/G)TGTCA nc-transcript-variant, upstream-variant-2KB, reference, missense
rs16904151 - 129,765,749(+) CTCTC(C/T)TCCGG nc-transcript-variant, reference, synonymous-codon, missense
rs4144738 - 129,748,604(+) GCTCC(A/G)TCCTA intron-variant, downstream-variant-500B, reference, missense, utr-variant-3-prime
rs967974 -- 129,777,832(+) TCTCC(A/G)CCTCA intron-variant, upstream-variant-2KB
rs1305049 -- 129,744,049(+) AATAC(-/TCCCTCTTTCCTAGAACTCTGCCCTAAAA)ATGTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for GSDMC Gene

Variant ID Type Subtype PubMed ID
nsv510986 CNV Complex 20534489
nsv509278 CNV Insertion 20534489
nsv6395 CNV Insertion 18451855
nsv39 CNV Insertion 15895083

Variation tolerance for GSDMC Gene

Residual Variation Intolerance Score: 93.8% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.90; 59.26% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for GSDMC Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GSDMC Gene

Disorders for GSDMC Gene

Relevant External Links for GSDMC

Genetic Association Database (GAD)
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for GSDMC Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GSDMC Gene

Publications for GSDMC Gene

  1. Members of a novel gene family, Gsdm, are expressed exclusively in the epithelium of the skin and gastrointestinal tract in a highly tissue-specific manner. (PMID: 17350798) Tamura M. … Shiroishi T. (Genomics 2007) 2 3 4 67
  2. A novel common variant in DCST2 is associated with length in early life and height in adulthood. (PMID: 25281659) van der Valk R.J. … Jaddoe V.W. (Hum. Mol. Genet. 2015) 3
  3. Meta-analysis of genome-wide association studies of adult height in East Asians identifies 17 novel loci. (PMID: 25429064) He M. … Qi L. (Hum. Mol. Genet. 2015) 3
  4. Genome-wide association study of retinopathy in individuals without diabetes. (PMID: 23393555) Jensen R.A. … Wong T.Y. (PLoS ONE 2013) 3
  5. Identification of nine novel loci associated with white blood cell subtypes in a Japanese population. (PMID: 21738478) Okada Y. … Kamatani N. (PLoS Genet. 2011) 3

Products for GSDMC Gene

Sources for GSDMC Gene

Back to Top
