Aliases for GSC Gene
External Ids for GSC Gene
- HGNC: 4612
- Entrez Gene: 145258
- Ensembl: ENSG00000133937
- OMIM: 138890
- UniProtKB: P56915
Previous GeneCards Identifiers for GSC Gene
- GC14U990025
- GC14M089051
- GC14M093224
- GC14M094304
- GC14M095234
- GC14M075414
Summaries for GSC Gene
-
This gene encodes a member of the bicoid subfamily of the paired (PRD) homeobox family of proteins. The encoded protein acts as a transcription factor and may be autoregulatory. A similar protein in mice plays a role in craniofacial and rib cage development during embryogenesis. [provided by RefSeq, Jul 2008]
GeneCards Summary for GSC Gene
GSC (Goosecoid Homeobox) is a Protein Coding gene. Diseases associated with GSC include Short Stature, Auditory Canal Atresia, Mandibular Hypoplasia, And Skeletal Abnormalities and Synostosis. Among its related pathways are Regulation of retinoblastoma protein and Embryonic and Induced Pluripotent Stem Cell Differentiation Pathways and Lineage-specific Markers. Gene Ontology (GO) annotations related to this gene include sequence-specific DNA binding and RNA polymerase II repressing transcription factor binding. An important paralog of this gene is GSC2.
UniProtKB/Swiss-Prot for GSC Gene
-
Regulates chordin (CHRD). May play a role in spatial programing within discrete embryonic fields or lineage compartments during organogenesis. In concert with NKX3-2, plays a role in defining the structural components of the middle ear; required for the development of the entire tympanic ring (By similarity). Probably involved in the regulatory networks that define neural crest cell fate specification and determine mesoderm cell lineages in mammals.
Additional gene information for GSC Gene
- Monarch Initiative
- Search for GSC at DataMed
- Search for GSC at HumanCyc
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GSC Gene
Genomics for GSC Gene
GeneHancer (GH) Regulatory Elements for GSC Gene
GeneHancer (GH) Identifier | GH Type | GH Score |
GH Sources | Gene Association Score | Total Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites |
Gene Targets |
---|---|---|---|---|---|---|---|---|---|---|
GH14I094768 | Promoter/Enhancer | 1.5 | EPDnew Ensembl ENCODE | 550.8 | +0.7 | 703 | 2.4 | SIN3A ZNF76 ZNF335 GLIS2 SMARCA5 ZNF202 SP3 HCFC1 CEBPB ZNF398 | GSC SCARNA13 SNHG10 DICER1 RPSAP4 | |
GH14I094771 | Enhancer | 0.4 | ENCODE | 550.8 | -1.0 | -1049 | 0.2 | SUZ12 EZH2 | GSC GC14M094800 | |
GH14I094777 | Enhancer | 0.4 | ENCODE | 550.8 | -1.3 | -1269 | 0.2 | SUZ12 EZH2 | GSC GC14M094800 | |
GH14I094772 | Enhancer | 0.3 | ENCODE | 550.8 | -1.9 | -1949 | 0.2 | EZH2 | GSC GC14M094800 | |
GH14I094770 | Enhancer | 0.3 | ENCODE | 550.8 | -0.7 | -749 | 0.2 | EZH2 | GSC GC14M094800 |
- Top Transcription factor binding sites by QIAGEN in the GSC gene promoter:
Regulatory Element Products
Genomic Locations for GSC Gene
- chr14:94,768,216-94,770,230
- (GRCh38/hg38)
- Size:
- 2,015 bases
- Orientation:
- Minus strand
- chr14:95,234,553-95,236,562
- (GRCh37/hg19)
Genomic View for GSC Gene
- Cytogenetic band:
-
- 14q32.13 by Ensembl
- 14q32.13 by Entrez Gene
- 14q32.13 by HGNC


RefSeq DNA sequence for GSC Gene
Proteins for GSC Gene
-
Protein details for GSC Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P56915-GSC_HUMAN
- Recommended name:
- Homeobox protein goosecoid
- Protein Accession:
- P56915
- Q86YR1
Protein attributes for GSC Gene
- Size:
- 257 amino acids
- Molecular mass:
- 28150 Da
- Quaternary structure:
- No Data Available
Protein Expression for GSC Gene
Post-translational modifications for GSC Gene
Other Protein References for GSC Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- R&D Systems Antibodies for GSC (Goosecoid)
- Novus Biologicals Antibodies for GSC
-
Abcam antibodies for GSC
- Invitrogen Antibodies for GSC
- GeneTex GSC antibody for GSC
-
Santa Cruz Biotechnology (SCBT) Antibodies for GSC
- Sino Biological Antibodies for GSC
Protein Products
-
OriGene Purified Proteins for GSC
- Search Origene for MassSpec and Protein Over-expression Lysates for GSC
- Origene Custom Protein Services for GSC
- Search GeneTex for Proteins for GSC
-
Abcam proteins for GSC
Assay Products
- R&D Systems Proteome Profiler Antibody Arrays and other biochemical assays for GSC (Goosecoid)
- antibodies-online: Search results for available GSC related products ranked by validation data
No data available for DME Specific Peptides for GSC Gene
Domains & Families for GSC Gene
Gene Families for GSC Gene
- HGNC:
- Human Protein Atlas (HPA):
-
- Disease related genes
- Predicted intracellular proteins
- Transcription factors
Protein Domains for GSC Gene
- InterPro:
- ProtoNet:
Suggested Antigen Peptide Sequences for GSC Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P56915- Family:
-
- Belongs to the paired homeobox family. Bicoid subfamily.
Function for GSC Gene
Molecular function for GSC Gene
- GENATLAS Biochemistry:
- Xenopus goosecoid homologous,homeo domain encoding gene,expressed during,and involved in,gastrulation process
- UniProtKB/Swiss-Prot Function:
- Regulates chordin (CHRD). May play a role in spatial programing within discrete embryonic fields or lineage compartments during organogenesis. In concert with NKX3-2, plays a role in defining the structural components of the middle ear; required for the development of the entire tympanic ring (By similarity). Probably involved in the regulatory networks that define neural crest cell fate specification and determine mesoderm cell lineages in mammals.
Phenotypes From GWAS Catalog for GSC Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000978 | RNA polymerase II proximal promoter sequence-specific DNA binding | IEA | -- |
GO:0001078 | transcriptional repressor activity, RNA polymerase II proximal promoter sequence-specific DNA binding | IEA | -- |
GO:0001085 | RNA polymerase II transcription factor binding | IEA,ISS | -- |
GO:0001103 | RNA polymerase II repressing transcription factor binding | IEA,ISS | -- |
GO:0003677 | DNA binding | IEA | -- |
Phenotypes for GSC Gene
- MGI mutant phenotypes for GSC:
-
inferred from 3 alleles
- nervous system phenotype
- respiratory system phenotype
- muscle phenotype
- cardiovascular system phenotype
- mortality/aging
- behavior/neurological phenotype
- growth/size/body region phenotype
- digestive/alimentary phenotype
- endocrine/exocrine gland phenotype
- vision/eye phenotype
- hearing/vestibular/ear phenotype
- integument phenotype
- embryo phenotype
- skeleton phenotype
- craniofacial phenotype
- limbs/digits/tail phenotype
- taste/olfaction phenotype
- GenomeRNAi human phenotypes for GSC:
-
- shRNA abundance <= 50%
- Decreased viability in esophageal squamous lineage
- Decreased viability ratio
- Decreased shRNA abundance (Z-score < -2)
- Decreased NF-kappaB reporter expression
- Increased shRNA abundance (Z-score > 2)
- Decreased viability
- Decreased infection with West Nile virus (WNV)
- Decreased West Nile virus (WNV) infection
- Decreased Dengue Infection
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
- Cyagen custom Knockout/knockin (KOKI) mouse models for GSC
-
-
ViGene Biosciences lentiviral particle packaged cDNA for GSC gene
-
ViGene Biosciences ready-to-package AAV shRNAs for GSC gene
- Search ViGene Biosciences for GSC
CRISPR Products
-
OriGene CRISPR knockouts for GSC
- genomics-online: gRNA clones - Search results for available GSC gene related products
- Applied Biological Materials CRISPR for GSC
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for GSC
- GenScript: Design CRISPR guide RNA sequences for GSC
miRNA for GSC Gene
- miRTarBase miRNAs that target GSC
Targeted motifs for GSC Gene
- Consensus sequence: RGGATTAR Submotif: canonical Cell Type: FrogEmbryos
miRNA Products
- Search ViGene Biosciences for GSC
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for GSC
- Browse OriGene Inhibitory RNA Products For GSC
- genomics-online: shRNA clones - Search results for available GSC gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for GSC gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for GSC
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for GSC
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for GSC
- genomics-online: cdna clones - Search results for available GSC gene related products
- orf clones - Search results for available GSC gene related products
- Applied Biological Materials Clones for GSC
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Cell Line Products
-
Horizon Cell Lines for GSC
-
ViGene Biosciences adenoviral particle packaged cDNA for GSC gene
-
ViGene Biosciences lentiviral particle packaged cDNA for GSC gene
-
ViGene Biosciences ready-to-package AAV shRNAs for GSC gene
No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for GSC Gene
Localization for GSC Gene
Subcellular locations from UniProtKB/Swiss-Prot for GSC Gene
- Nucleus.
- Nuclear bodies (2)
- Nucleus (2)
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0005634 | nucleus | IDA | -- |
GO:0005667 | transcription factor complex | IEA | -- |
GO:0016604 | nuclear body | IDA | -- |
Pathways & Interactions for GSC Gene
Pathways by source for GSC Gene
2 BioSystems pathways for GSC Gene
1 R&D Systems pathway for GSC Gene
Interacting Proteins for GSC Gene
GO ID | Qualified GO term | Evidence | PubMed IDs |
---|---|---|---|
GO:0000122 | negative regulation of transcription by RNA polymerase II | IEA | -- |
GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
GO:0007275 | multicellular organism development | IEA | -- |
GO:0007369 | gastrulation | NAS | 7916327 |
GO:0009653 | anatomical structure morphogenesis | IEA | -- |
No data available for SIGNOR curated interactions for GSC Gene
Transcripts for GSC Gene
mRNA/cDNA for GSC Gene
- (1) REFSEQ mRNAs :
- (2) Additional mRNA sequences :
- (11) Selected AceView cDNA sequences:
- (1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
CRISPR Products
-
OriGene CRISPR knockouts for GSC
- genomics-online: gRNA clones - Search results for available GSC gene related products
- Applied Biological Materials CRISPR for GSC
-
Vectors and viruses for KO, Activation, Repression, and more
-
Santa Cruz Biotechnology (SCBT) CRISPR for GSC
- GenScript: Design CRISPR guide RNA sequences for GSC
miRNA Products
- Search ViGene Biosciences for GSC
Inhibitory RNA Products
- Origene shrna, sirna, and RNAi products in human, mouse, rat for GSC
- Browse OriGene Inhibitory RNA Products For GSC
- genomics-online: shRNA clones - Search results for available GSC gene related products
-
ViGene Biosciences ready-to-package AAV shRNAs for GSC gene
Clone Products
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- VectorBuilder custom plasmid, inducible vectors for GSC
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for GSC
-
VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for GSC
- genomics-online: cdna clones - Search results for available GSC gene related products
- orf clones - Search results for available GSC gene related products
- Applied Biological Materials Clones for GSC
-
Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more
Expression for GSC Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Primitive Streak (Early Embryonic Tissues)
- Primitive Streak Cells Anterior Primitive Streak
- Primitive Streak Cells Primitive Streak
- Prechordal Plate Cells Prechordal Plate
- Mesendoderm Cells Anterior Primitive Streak
- Primitive Node Cells Primitive Node
-
Epiblast (Early Embryo)
- Primitive Streak Cells Anterior Primitive Streak
- Early-Gastrula Organizer Epiblast
- Prechordal Plate Cells Prechordal Plate
- Primitive Node Cells Primitive Node
- Epiblast Stem Cell line 7
-
Hypoblast (Extraembryonic Tissues)
- Parietal Endoderm Cells Hypoblast
- Visceral Endoderm Cells Visceral Endoderm
- Hypoblast Cells Hypoblast
- Hypoblast
-
Endoderm (Gastrulation Derivatives)
- Definitive Endoderm Cells Definitive Endoderm
- Mesendoderm Cells Anterior Primitive Streak
- Definitive endoderm-like cells(Schulz TC etal. 2012)
- Definitive endoderm-like cells(Hinton A et. al. 2010)
-
Neural Tube (Nervous System)
- Early Floor Plate Cells Mesencephalic Floor Plate
- Late Floor Plate Cells Mesencephalic Floor Plate
- Diencephalon
-
Limb (Muscoskeletal System)
- Mesenchymal Condensate Cells Zeugopod
- Autopod
- Limb Bud
- Head Mesenchyme (Muscoskeletal System)
- NULL (Uncategorized)
- Inner Cell Mass (Early Embryonic Tissues)
- Bone (Muscoskeletal System)
-
Brain (Nervous System)
- Early Floor Plate Cells Mesencephalic Floor Plate
-
Adipose (Muscoskeletal System)
- Stromal Vascular Preadipocyte Progenitor Cells Vascular Adipose
-
Yolk Sac (Extraembryonic Tissues)
- Visceral Endoderm Cells Visceral Endoderm
-
Mesoderm (Gastrulation Derivatives)
- Mesendoderm Cells Anterior Primitive Streak
-
Cartilage (Muscoskeletal System)
- Mesenchymal Condensate Cells Zeugopod
- Gut Tube (Gastrointestinal Tract)
- Heart (Cardiovascular System)
mRNA differential expression in normal tissues according to GTEx for GSC Gene
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for GSC Gene
NURSA nuclear receptor signaling pathways regulating expression of GSC Gene:
GSCSOURCE GeneReport for Unigene cluster for GSC Gene:
Hs.440438Evidence on tissue expression from TISSUES for GSC Gene
- Blood(4)
- Bone(4)
Phenotype-based relationships between genes and organs from Gene ORGANizer for GSC Gene
- ectoderm
- mesoderm
- digestive
- integumentary
- nervous
- reproductive
- skeletal muscle
- skeleton
- chin
- ear
- eye
- eyelid
- face
- head
- inner ear
- jaw
- lip
- mandible
- maxilla
- middle ear
- mouth
- outer ear
- skull
- scapula
- pelvis
- testicle
- ankle
- arm
- digit
- elbow
- femur
- finger
- foot
- forearm
- hand
- hip
- humerus
- knee
- lower limb
- radius
- shoulder
- thigh
- toe
- upper limb
- wrist
- skin
Primer Products
-
OriGene qPCR primer pairs and template standards for GSC
-
OriGene qPCR primer pairs for GSC
- genomics-online: primer clones - Search results for available GSC gene related products
No data available for mRNA Expression by UniProt/SwissProt for GSC Gene
Orthologs for GSC Gene
This gene was present in the common ancestor of animals.
Organism | Taxonomy | Gene | Similarity | Type | Details |
---|---|---|---|---|---|
chimpanzee (Pan troglodytes) |
Mammalia | GSC 33 34 |
|
||
platypus (Ornithorhynchus anatinus) |
Mammalia | GSC 34 |
|
OneToOne | |
dog (Canis familiaris) |
Mammalia | GSC 33 34 |
|
||
cow (Bos Taurus) |
Mammalia | GSC 33 34 |
|
||
mouse (Mus musculus) |
Mammalia | Gsc 33 16 34 |
|
||
rat (Rattus norvegicus) |
Mammalia | Gsc 33 |
|
||
oppossum (Monodelphis domestica) |
Mammalia | GSC 34 |
|
OneToOne | |
chicken (Gallus gallus) |
Aves | GSC 33 34 |
|
||
lizard (Anolis carolinensis) |
Reptilia | GSC 34 |
|
OneToOne | |
tropical clawed frog (Silurana tropicalis) |
Amphibia | gsc 33 |
|
||
African clawed frog (Xenopus laevis) |
Amphibia | LOC397748 33 |
|
||
zebrafish (Danio rerio) |
Actinopterygii | gsc 33 34 |
|
||
fruit fly (Drosophila melanogaster) |
Insecta | Gsc 34 |
|
OneToMany | |
worm (Caenorhabditis elegans) |
Secernentea | ceh-45 34 |
|
OneToMany |
- Species where no ortholog for GSC was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
Paralogs for GSC Gene
Variants for GSC Gene
SNP ID | Clin | Chr 14 pos | Variation | AA Info | Type |
---|---|---|---|---|---|
rs587777288 | pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities | 94,769,804(-) | GCCGGGAGGCCCGCGCCGCCGGG/GCCGGG | coding_sequence_variant, frameshift | |
rs587777289 | pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities | 94,769,173(-) | G/A/T | coding_sequence_variant, missense_variant, stop_gained | |
rs587777290 | pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities | 94,769,660(-) | C/G | splice_donor_variant | |
rs1000043986 | -- | 94,770,369(-) | GGGGGG/GGGGG | upstream_transcript_variant | |
rs1000931931 | -- | 94,769,613(-) | G/C | intron_variant |
Variant ID | Type | Subtype | PubMed ID |
---|---|---|---|
esv3635390 | CNV | gain | 21293372 |
nsv470662 | CNV | gain | 18288195 |
Additional Variant Information for GSC Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GSC Gene
Disorders for GSC Gene

(4) MalaCards diseases for GSC Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards
Disorder | Aliases | PubMed IDs |
---|---|---|
short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities |
|
|
synostosis |
|
|
cornelia de lange syndrome |
|
|
velocardiofacial syndrome |
|
|
UniProtKB/Swiss-Prot
GSC_HUMAN- Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities (SAMS) [MIM:602471]: An autosomal recessive developmental disorder with features of a first and second branchial arch syndrome, and with unique rhizomelic skeletal anomalies. Craniofacial abnormalities can lead to conductive hearing loss, respiratory insufficiency, and feeding difficulties. Skeletal features include bilateral humeral hypoplasia, humeroscapular synostosis, pelvic abnormalities, and proximal defects of the femora. Affected individuals may also have some features of a neurocristopathy or abnormal mesoderm development, such as urogenital anomalies, that are distinct from other branchial arch syndromes. {ECO:0000269 PubMed:24290375}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Additional Disease Information for GSC
- Genetic Association Database
- (GAD)
- Human Genome Epidemiology Navigator
- (HuGE)
- ATLAS of Genetics and Cytogenetics in Oncology and Haematology
No data available for Genatlas for GSC Gene
Publications for GSC Gene
- Molecular cloning of the human homeobox gene goosecoid (GSC) and mapping of the gene to human chromosome 14q32.1. (PMID: 7916327) Blum M … Sparkes RS (Genomics 1994) 2 3 4 22 58
- Environmental and genetic factors associated with congenital microtia: a case-control study in Jiangsu, China, 2004 to 2007. (PMID: 19935299) Zhang QG … Shen H (Plastic and reconstructive surgery 2009) 3 22 44 58
- SAMS, a syndrome of short stature, auditory-canal atresia, mandibular hypoplasia, and skeletal abnormalities is a unique neurocristopathy caused by mutations in Goosecoid. (PMID: 24290375) Parry DA … Johnson CA (American journal of human genetics 2013) 3 4 58
- A genome-wide association study identifies a novel major locus for glycemic control in type 1 diabetes, as measured by both A1C and glucose. (PMID: 19875614) Paterson AD … Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications Research Group (Diabetes 2010) 3 44 58
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58
Products for GSC Gene
- R&D Systems Antibodies for GSC (Goosecoid)
- Browse R&D Systems for Human Recombinant Proteins
- R&D Systems Proteome Profiler Antibody Arrays and other biochemical assays for GSC (Goosecoid)
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody Services
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for GSC
- Search Origene for MassSpec and Protein Over-expression Lysates for GSC
- Origene Custom Protein Services for GSC
- Origene shrna, sirna, and RNAi products in human, mouse, rat for GSC
- Browse OriGene Inhibitory RNA Products For GSC
- OriGene qPCR primer pairs and template standards for GSC
- OriGene qPCR primer pairs for GSC
- OriGene CRISPR knockouts for GSC
- OriGene ORF clones in human for GSC
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For GSC
- GenScript: Next-day shipping of latest version cDNA ORF clones for GSC in any vector
- GenScript Custom Purified and Recombinant Proteins Services for GSC
- GenScript Custom Assay Services for GSC
- GenScript Custom overexpressing Cell Line Services for GSC
- GenScript: Design CRISPR guide RNA sequences for GSC
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for GSC
- Browse Sino Biological cDNA Clones
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Recombinant Proteins
- Sino Biological Antibodies for GSC
- Browse Sino Biological Assays
- Browse Sino Biological ELISA Kits
- Browse Sino Biological ELISA Pair Sets
- Browse Sino Biological CRO Services
- Browse Sino Biological Control Vectors
- Sino Biological Transfection Reagent
- Sino Biological Anti-His Tag Antibody
- Novus Biologicals Antibodies for GSC
- Novus Biologicals proteins and lysates for GSC
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- Abcam antibodies for GSC
- Abcam proteins for GSC
- Find your target
- Browse Primary Antibodies
- Browse Conjugated Primary Antibodies
- Browse Secondary Antibodies
- Browse ELISA Kits
- Browse Matched Antibody Pairs
- Browse Proteins and Peptides
- Search Knockout (KO) Validated Antibodies
- Browse Monoclonal Antibodies
- Browse Recombinant Antibodies
- Browse Antibodies at Cloud-Clone Corp.
- Browse Proteins at Cloud-Clone Corp.
- Browse Assay Kits at Cloud-Clone Corp.
- Browse Knockouts at Cloud-Clone Corp.
- Browse Knockins at Cloud-Clone Corp.
- Cloud-Clone Corp. disease models service
- Browse cDNA clones at Cloud-Clone Corp.
- Browse primers at Cloud-Clone Corp.
- Cloud-Clone Corp. primary cells service
- Invitrogen Antibodies for GSC
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Cyagen custom Knockout/knockin (KOKI) mouse models for GSC
- VectorBuilder custom plasmid, inducible vectors for GSC
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for GSC
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
- Addgene plasmids for GSC
- antibodies-online: Search results for 88 available GSC Antibodies ranked by validation data
- Compare Top GSC Antibodies
- antibodies-online: Search results for available GSC related products ranked by validation data
- antibodies-online: Search results for 10 available GSC Proteins ranked by validation data
- Compare Top GSC Proteins
- Quality Products:
- GeneTex GSC antibody for GSC
- Search GeneTex for Proteins for GSC
- ViGene Biosciences adenoviral particle packaged cDNA for GSC gene
- ViGene Biosciences lentiviral particle packaged cDNA for GSC gene
- ViGene Biosciences ready-to-package AAV shRNAs for GSC gene
- Search ViGene Biosciences for GSC
- Santa Cruz Biotechnology (SCBT) Antibodies for GSC
- Search Santa Cruz Biotechnology (SCBT) for GSC siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for GSC
- Horizon Cell Lines for GSC
- genomics-online: cdna clones - Search results for available GSC gene related products
- orf clones - Search results for available GSC gene related products
- genomics-online: gRNA clones - Search results for available GSC gene related products
- genomics-online: primer clones - Search results for available GSC gene related products
- genomics-online: shRNA clones - Search results for available GSC gene related products
Sources for GSC Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) ASD
- (29) ECgene
- (30) GeneAnnot
- (31) CGAP SAGE
- (32) SOURCE
- (33) HomoloGene
- (34) PanEnsembl
- (35) euGenes
- (36) SGD
- (37) FlyBase
- (38) WormBase
- (39) Pseudogene
- (40) DGV
- (41) dbSNP
- (42) GenAtlas
- (43) HGMD
- (44) GAD
- (45) BGMUT
- (46) HuGE
- (47) Atlas
- (48) Cell Signaling Technology
- (49) GenBank
- (50) H-invDB
- (51) HORDE
- (52) HUGE
- (53) IMGT
- (54) Leiden
- (55) miRBase
- (56) DME
- (57) OriGene
- (58) PubMed
- (59) R&D Systems
- (60) TGDB
- (61) Tocris
- (62) Abcam
- (63) Novus Biologicals
- (64) ProSpec
- (65) Sino Biological
- (66) GenScript
- (67) Qiagen
- (68) Cloud-Clone Corp.
- (69) OCA
- (70) Proteopedia
- (71) MOPED
- (72) neXtProt
- (73) Reactome
- (74) GeneGo (Thomson Reuters)
- (75) fRNAdb
- (76) DISEASES
- (77) SIMAP
- (78) GenomeRNAi
- (79) LifeMap
- (80) miRTarBase
- (81) MalaCards
- (82) Invitrogen
- (83) BitterDB
- (84) Vector BioLabs
- (85) ESI-BIO
- (86) RefSeq
- (87) BioSystems
- (88) MaxQB
- (89) IUPHAR
- (90) BioGPS
- (91) Illumina
- (92) COMPARTMENTS
- (93) HOMER
- (94) PaxDb
- (95) ApexBio
- (96) Addgene
- (97) antibodies-online
- (98) CYP
- (99) NONCODE
- (100) SwitchGear Genomics
- (101) TreeFam
- (102) PathCards
- (103) GeneReviews
- (104) GeneTex
- (105) Taconic Biosciences
- (106) GTEx
- (107) ProteomicsDB
- (108) SCBT
- (109) DGIdb
- (110) ClinicalTrials
- (111) FDA Approved Drugs
- (112) RVIS
- (113) SIGNOR
- (114) diseasecard
- (115) NIH Rare Diseases
- (116) Orphanet
- (117) UMLS
- (118) GTR
- (119) Disease Ontology
- (120) Genetics Home Reference
- (121) MeSH
- (122) MedlinePlus
- (123) CDC
- (124) NINDS
- (125) NCBI Bookshelf
- (126) ClinVar
- (127) Gene Damage Index
- (128) ViGene Biosciences
- (129) HPO
- (130) UDN
- (131) VISTA
- (132) FANTOM5
- (133) ENCODE
- (134) ProSci
- (135) Horizon
- (136) NURSA
- (137) IID
- (138) Cyagen
- (139) VectorBuilder
- (140) SNPedia
- (141) BRCA Exchange
- (142) St John's Lab
- (143) CIViC
- (144) ProteoGenix
- (145) dbSUPER
- (146) TISSUES
- (147) Gene ORGANizer
- (148) abm
- (149) CrownBio
- (150) Human Protein Atlas
- (151) GWAS Catalog
- (152) Monarch Initiative
- (153) DataMed
- (154) HumanCyc
- (155) genomics-online
- (156) UCNEbase
- (157) EPDnew