Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GSC Gene

Aliases for GSC Gene

  • Goosecoid Homeobox 2 3 5
  • Homeobox Protein Goosecoid 3
  • SAMS 3

External Ids for GSC Gene

Previous GeneCards Identifiers for GSC Gene

  • GC14U990025
  • GC14M089051
  • GC14M093224
  • GC14M094304
  • GC14M095234
  • GC14M075414

Summaries for GSC Gene

Entrez Gene Summary for GSC Gene

  • This gene encodes a member of the bicoid subfamily of the paired (PRD) homeobox family of proteins. The encoded protein acts as a transcription factor and may be autoregulatory. A similar protein in mice plays a role in craniofacial and rib cage development during embryogenesis. [provided by RefSeq, Jul 2008]

GeneCards Summary for GSC Gene

GSC (Goosecoid Homeobox) is a Protein Coding gene. Diseases associated with GSC include Short Stature, Auditory Canal Atresia, Mandibular Hypoplasia, And Skeletal Abnormalities and Synostosis. Among its related pathways are Regulation of retinoblastoma protein and Embryonic and Induced Pluripotent Stem Cell Differentiation Pathways and Lineage-specific Markers. Gene Ontology (GO) annotations related to this gene include sequence-specific DNA binding and RNA polymerase II repressing transcription factor binding. An important paralog of this gene is GSC2.

UniProtKB/Swiss-Prot for GSC Gene

  • Regulates chordin (CHRD). May play a role in spatial programing within discrete embryonic fields or lineage compartments during organogenesis. In concert with NKX3-2, plays a role in defining the structural components of the middle ear; required for the development of the entire tympanic ring (By similarity). Probably involved in the regulatory networks that define neural crest cell fate specification and determine mesoderm cell lineages in mammals.

Gene Wiki entry for GSC Gene

Additional gene information for GSC Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GSC Gene

Genomics for GSC Gene

GeneHancer (GH) Regulatory Elements for GSC Gene

Promoters and enhancers for GSC Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH14I094768 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 550.8 +0.7 703 2.4 SIN3A ZNF76 ZNF335 GLIS2 SMARCA5 ZNF202 SP3 HCFC1 CEBPB ZNF398 GSC SCARNA13 SNHG10 DICER1 RPSAP4
GH14I094771 Enhancer 0.4 ENCODE 550.8 -1.0 -1049 0.2 SUZ12 EZH2 GSC GC14M094800
GH14I094777 Enhancer 0.4 ENCODE 550.8 -1.3 -1269 0.2 SUZ12 EZH2 GSC GC14M094800
GH14I094772 Enhancer 0.3 ENCODE 550.8 -1.9 -1949 0.2 EZH2 GSC GC14M094800
GH14I094770 Enhancer 0.3 ENCODE 550.8 -0.7 -749 0.2 EZH2 GSC GC14M094800
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around GSC on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the GSC gene promoter:

Genomic Locations for GSC Gene

Genomic Locations for GSC Gene
chr14:94,768,216-94,770,230
(GRCh38/hg38)
Size:
2,015 bases
Orientation:
Minus strand
chr14:95,234,553-95,236,562
(GRCh37/hg19)

Genomic View for GSC Gene

Genes around GSC on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GSC Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GSC Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GSC Gene

Proteins for GSC Gene

  • Protein details for GSC Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P56915-GSC_HUMAN
    Recommended name:
    Homeobox protein goosecoid
    Protein Accession:
    P56915
    Secondary Accessions:
    • Q86YR1

    Protein attributes for GSC Gene

    Size:
    257 amino acids
    Molecular mass:
    28150 Da
    Quaternary structure:
    No Data Available

    Three dimensional structures from OCA and Proteopedia for GSC Gene

neXtProt entry for GSC Gene

Post-translational modifications for GSC Gene

No Post-translational modifications

Other Protein References for GSC Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GSC Gene

Domains & Families for GSC Gene

Gene Families for GSC Gene

HGNC:
Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins
  • Transcription factors

Protein Domains for GSC Gene

Suggested Antigen Peptide Sequences for GSC Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

P56915

UniProtKB/Swiss-Prot:

GSC_HUMAN :
  • Belongs to the paired homeobox family. Bicoid subfamily.
Family:
  • Belongs to the paired homeobox family. Bicoid subfamily.
genes like me logo Genes that share domains with GSC: view

Function for GSC Gene

Molecular function for GSC Gene

GENATLAS Biochemistry:
Xenopus goosecoid homologous,homeo domain encoding gene,expressed during,and involved in,gastrulation process
UniProtKB/Swiss-Prot Function:
Regulates chordin (CHRD). May play a role in spatial programing within discrete embryonic fields or lineage compartments during organogenesis. In concert with NKX3-2, plays a role in defining the structural components of the middle ear; required for the development of the entire tympanic ring (By similarity). Probably involved in the regulatory networks that define neural crest cell fate specification and determine mesoderm cell lineages in mammals.

Phenotypes From GWAS Catalog for GSC Gene

Gene Ontology (GO) - Molecular Function for GSC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000978 RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0001078 transcriptional repressor activity, RNA polymerase II proximal promoter sequence-specific DNA binding IEA --
GO:0001085 RNA polymerase II transcription factor binding IEA,ISS --
GO:0001103 RNA polymerase II repressing transcription factor binding IEA,ISS --
GO:0003677 DNA binding IEA --
genes like me logo Genes that share ontologies with GSC: view
genes like me logo Genes that share phenotypes with GSC: view

Human Phenotype Ontology for GSC Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for GSC Gene

MGI Knock Outs for GSC:

Animal Model Products

CRISPR Products

miRNA for GSC Gene

miRTarBase miRNAs that target GSC
Targeted motifs for GSC Gene
HOMER Transcription Factor Regulatory Elements motif GSC
  • Consensus sequence: RGGATTAR Submotif: canonical Cell Type: FrogEmbryos

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for GSC

No data available for Enzyme Numbers (IUBMB) and Transcription Factor Targets for GSC Gene

Localization for GSC Gene

Subcellular locations from UniProtKB/Swiss-Prot for GSC Gene

Nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GSC gene
Compartment Confidence
nucleus 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Nuclear bodies (2)
  • Nucleus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for GSC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus IDA --
GO:0005667 transcription factor complex IEA --
GO:0016604 nuclear body IDA --
genes like me logo Genes that share ontologies with GSC: view

Pathways & Interactions for GSC Gene

genes like me logo Genes that share pathways with GSC: view

Gene Ontology (GO) - Biological Process for GSC Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription by RNA polymerase II IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0007275 multicellular organism development IEA --
GO:0007369 gastrulation NAS 7916327
GO:0009653 anatomical structure morphogenesis IEA --
genes like me logo Genes that share ontologies with GSC: view

No data available for SIGNOR curated interactions for GSC Gene

Drugs & Compounds for GSC Gene

No Compound Related Data Available

Transcripts for GSC Gene

mRNA/cDNA for GSC Gene

(1) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(11) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for GSC Gene

Goosecoid homeobox:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for GSC

Alternative Splicing Database (ASD) splice patterns (SP) for GSC Gene

No ASD Table

Relevant External Links for GSC Gene

GeneLoc Exon Structure for
GSC
ECgene alternative splicing isoforms for
GSC

Expression for GSC Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GSC Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GSC Gene

This gene is overexpressed in Breast - Mammary Tissue (x12.7), Adipose - Subcutaneous (x6.1), and Adipose - Visceral (Omentum) (x5.1).

Protein differential expression in normal tissues from HIPED for GSC Gene

This gene is overexpressed in Platelet (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for GSC Gene



Protein tissue co-expression partners for GSC Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of GSC Gene:

GSC

SOURCE GeneReport for Unigene cluster for GSC Gene:

Hs.440438

Evidence on tissue expression from TISSUES for GSC Gene

  • Blood(4)
  • Bone(4)

Phenotype-based relationships between genes and organs from Gene ORGANizer for GSC Gene

Germ Layers:
  • ectoderm
  • mesoderm
Systems:
  • digestive
  • integumentary
  • nervous
  • reproductive
  • skeletal muscle
  • skeleton
Organs:
Head and neck:
  • chin
  • ear
  • eye
  • eyelid
  • face
  • head
  • inner ear
  • jaw
  • lip
  • mandible
  • maxilla
  • middle ear
  • mouth
  • outer ear
  • skull
Thorax:
  • scapula
Pelvis:
  • pelvis
  • testicle
Limb:
  • ankle
  • arm
  • digit
  • elbow
  • femur
  • finger
  • foot
  • forearm
  • hand
  • hip
  • humerus
  • knee
  • lower limb
  • radius
  • shoulder
  • thigh
  • toe
  • upper limb
  • wrist
General:
  • skin
genes like me logo Genes that share expression patterns with GSC: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for GSC Gene

Orthologs for GSC Gene

This gene was present in the common ancestor of animals.

Orthologs for GSC Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GSC 33 34
  • 99.61 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia GSC 34
  • 96 (a)
OneToOne
dog
(Canis familiaris)
Mammalia GSC 33 34
  • 94.95 (n)
cow
(Bos Taurus)
Mammalia GSC 33 34
  • 94.01 (n)
mouse
(Mus musculus)
Mammalia Gsc 33 16 34
  • 92.71 (n)
rat
(Rattus norvegicus)
Mammalia Gsc 33
  • 92.71 (n)
oppossum
(Monodelphis domestica)
Mammalia GSC 34
  • 86 (a)
OneToOne
chicken
(Gallus gallus)
Aves GSC 33 34
  • 81.9 (n)
lizard
(Anolis carolinensis)
Reptilia GSC 34
  • 81 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia gsc 33
  • 71.33 (n)
African clawed frog
(Xenopus laevis)
Amphibia LOC397748 33
zebrafish
(Danio rerio)
Actinopterygii gsc 33 34
  • 69.33 (n)
fruit fly
(Drosophila melanogaster)
Insecta Gsc 34
  • 19 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea ceh-45 34
  • 31 (a)
OneToMany
Species where no ortholog for GSC was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for GSC Gene

ENSEMBL:
Gene Tree for GSC (if available)
TreeFam:
Gene Tree for GSC (if available)

Paralogs for GSC Gene

Paralogs for GSC Gene

(2) SIMAP similar genes for GSC Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with GSC: view

Variants for GSC Gene

Sequence variations from dbSNP and Humsavar for GSC Gene

SNP ID Clin Chr 14 pos Variation AA Info Type
rs587777288 pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities 94,769,804(-) GCCGGGAGGCCCGCGCCGCCGGG/GCCGGG coding_sequence_variant, frameshift
rs587777289 pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities 94,769,173(-) G/A/T coding_sequence_variant, missense_variant, stop_gained
rs587777290 pathogenic, Short stature, auditory canal atresia, mandibular hypoplasia, and skeletal abnormalities 94,769,660(-) C/G splice_donor_variant
rs1000043986 -- 94,770,369(-) GGGGGG/GGGGG upstream_transcript_variant
rs1000931931 -- 94,769,613(-) G/C intron_variant

Structural Variations from Database of Genomic Variants (DGV) for GSC Gene

Variant ID Type Subtype PubMed ID
esv3635390 CNV gain 21293372
nsv470662 CNV gain 18288195

Variation tolerance for GSC Gene

Gene Damage Index Score: 2.62; 45.33% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for GSC Gene

Human Gene Mutation Database (HGMD)
GSC
SNPedia medical, phenotypic, and genealogical associations of SNPs for
GSC

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GSC Gene

Disorders for GSC Gene

MalaCards: The human disease database

(4) MalaCards diseases for GSC Gene - From: HGMD, OMIM, ClinVar, GTR, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards
Search GSC in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

GSC_HUMAN
  • Short stature, auditory canal atresia, mandibular hypoplasia, skeletal abnormalities (SAMS) [MIM:602471]: An autosomal recessive developmental disorder with features of a first and second branchial arch syndrome, and with unique rhizomelic skeletal anomalies. Craniofacial abnormalities can lead to conductive hearing loss, respiratory insufficiency, and feeding difficulties. Skeletal features include bilateral humeral hypoplasia, humeroscapular synostosis, pelvic abnormalities, and proximal defects of the femora. Affected individuals may also have some features of a neurocristopathy or abnormal mesoderm development, such as urogenital anomalies, that are distinct from other branchial arch syndromes. {ECO:0000269 PubMed:24290375}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for GSC

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with GSC: view

No data available for Genatlas for GSC Gene

Publications for GSC Gene

  1. Molecular cloning of the human homeobox gene goosecoid (GSC) and mapping of the gene to human chromosome 14q32.1. (PMID: 7916327) Blum M … Sparkes RS (Genomics 1994) 2 3 4 22 58
  2. Environmental and genetic factors associated with congenital microtia: a case-control study in Jiangsu, China, 2004 to 2007. (PMID: 19935299) Zhang QG … Shen H (Plastic and reconstructive surgery 2009) 3 22 44 58
  3. SAMS, a syndrome of short stature, auditory-canal atresia, mandibular hypoplasia, and skeletal abnormalities is a unique neurocristopathy caused by mutations in Goosecoid. (PMID: 24290375) Parry DA … Johnson CA (American journal of human genetics 2013) 3 4 58
  4. A genome-wide association study identifies a novel major locus for glycemic control in type 1 diabetes, as measured by both A1C and glucose. (PMID: 19875614) Paterson AD … Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications Research Group (Diabetes 2010) 3 44 58
  5. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 58

Products for GSC Gene

Sources for GSC Gene

Content
Loading form....