Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GPR182 Gene

Aliases for GPR182 Gene

  • G Protein-Coupled Receptor 182 2 3 5
  • Adrenomedullin Receptor 2 3
  • ADMR 3 4
  • HrhAMR 3
  • Gamrh 3
  • 7TMR 3
  • AM-R 3
  • G10D 3
  • AMR 3

External Ids for GPR182 Gene

Previous HGNC Symbols for GPR182 Gene

  • ADMR

Previous GeneCards Identifiers for GPR182 Gene

  • GC12P055675
  • GC12P057388
  • GC12P054428

Summaries for GPR182 Gene

Entrez Gene Summary for GPR182 Gene

  • Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]

GeneCards Summary for GPR182 Gene

GPR182 (G Protein-Coupled Receptor 182) is a Protein Coding gene. Diseases associated with GPR182 include gliosarcoma. Among its related pathways are Myometrial Relaxation and Contraction Pathways and Sympathetic Nerve Pathway (Neuroeffector Junction). GO annotations related to this gene include G-protein coupled receptor activity and transmembrane signaling receptor activity. An important paralog of this gene is ACKR3.

UniProtKB/Swiss-Prot for GPR182 Gene

  • Orphan receptor.

Gene Wiki entry for GPR182 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GPR182 Gene

Genomics for GPR182 Gene

Regulatory Elements for GPR182 Gene

Genomic Location for GPR182 Gene

Chromosome:
12
Start:
56,994,355 bp from pter
End:
57,000,007 bp from pter
Size:
5,653 bases
Orientation:
Plus strand

Genomic View for GPR182 Gene

Genes around GPR182 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GPR182 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GPR182 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GPR182 Gene

Proteins for GPR182 Gene

  • Protein details for GPR182 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15218-GP182_HUMAN
    Recommended name:
    G-protein coupled receptor 182
    Protein Accession:
    O15218

    Protein attributes for GPR182 Gene

    Size:
    404 amino acids
    Molecular mass:
    45323 Da
    Quaternary structure:
    No Data Available

neXtProt entry for GPR182 Gene

Proteomics data for GPR182 Gene at MOPED

Post-translational modifications for GPR182 Gene

  • Glycosylation at Asn 28 and Asn 37
  • Modification sites at PhosphoSitePlus

Other Protein References for GPR182 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for GPR182 Gene

Domains & Families for GPR182 Gene

Gene Families for GPR182 Gene

Protein Domains for GPR182 Gene

Suggested Antigen Peptide Sequences for GPR182 Gene

Graphical View of Domain Structure for InterPro Entry

O15218

UniProtKB/Swiss-Prot:

GP182_HUMAN :
  • Belongs to the G-protein coupled receptor 1 family.
Family:
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with GPR182: view

Function for GPR182 Gene

Molecular function for GPR182 Gene

UniProtKB/Swiss-Prot Function:
Orphan receptor.
genes like me logo Genes that share phenotypes with GPR182: view

Animal Models for GPR182 Gene

MGI Knock Outs for GPR182:

Animal Model Products

  • Taconic Biosciences Mouse Models for GPR182

No data available for Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for GPR182 Gene

Localization for GPR182 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GPR182 Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for GPR182 Gene COMPARTMENTS Subcellular localization image for GPR182 gene
Compartment Confidence
plasma membrane 5
chloroplast 1
extracellular 1

Gene Ontology (GO) - Cellular Components for GPR182 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005622 intracellular IBA --
genes like me logo Genes that share ontologies with GPR182: view

Pathways & Interactions for GPR182 Gene

genes like me logo Genes that share pathways with GPR182: view

Pathways by source for GPR182 Gene

1 BioSystems pathway for GPR182 Gene
1 PharmGKB pathway for GPR182 Gene

Interacting Proteins for GPR182 Gene

Gene Ontology (GO) - Biological Process for GPR182 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001666 response to hypoxia IEA --
genes like me logo Genes that share ontologies with GPR182: view

No data available for SIGNOR curated interactions for GPR182 Gene

Drugs & Compounds for GPR182 Gene

(1) Drugs for GPR182 Gene - From: Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials

(3) Additional Compounds for GPR182 Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with GPR182: view

Transcripts for GPR182 Gene

mRNA/cDNA for GPR182 Gene

Unigene Clusters for GPR182 Gene

G protein-coupled receptor 182:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for GPR182 Gene

No ASD Table

Relevant External Links for GPR182 Gene

GeneLoc Exon Structure for
GPR182
ECgene alternative splicing isoforms for
GPR182

Expression for GPR182 Gene

mRNA expression in normal human tissues for GPR182 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GPR182 Gene

This gene is overexpressed in Spleen (x23.2), Liver (x4.5), and Testis (x4.2).

Protein differential expression in normal tissues from HIPED for GPR182 Gene

This gene is overexpressed in Spleen (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GPR182 Gene



SOURCE GeneReport for Unigene cluster for GPR182 Gene Hs.483909

mRNA Expression by UniProt/SwissProt for GPR182 Gene

O15218-GP182_HUMAN
Tissue specificity: Highly expressed in heart, skeletal muscle, immune system, adrenal gland and liver.
genes like me logo Genes that share expression patterns with GPR182: view

Protein tissue co-expression partners for GPR182 Gene

Primer Products

In Situ Assay Products

Orthologs for GPR182 Gene

This gene was present in the common ancestor of chordates.

Orthologs for GPR182 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GPR182 35
  • 97.02 (n)
  • 96.49 (a)
GPR182 36
  • 99 (a)
OneToOne
cow
(Bos Taurus)
Mammalia GPR182 36
  • 71 (a)
OneToOne
GPR182 35
  • 85.28 (n)
  • 79.48 (a)
dog
(Canis familiaris)
Mammalia GPR182 35
  • 77.98 (n)
  • 69.76 (a)
GPR182 36
  • 63 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Gpr182 36
  • 74 (a)
OneToOne
Gpr182 16
Gpr182 35
  • 80.74 (n)
  • 74.09 (a)
oppossum
(Monodelphis domestica)
Mammalia GPR182 36
  • 71 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Gpr182 35
  • 81.03 (n)
  • 74.87 (a)
chicken
(Gallus gallus)
Aves GPR182 36
  • 60 (a)
OneToOne
GPR182 35
  • 69.1 (n)
  • 61.52 (a)
lizard
(Anolis carolinensis)
Reptilia GPR182 36
  • 58 (a)
OneToOne
African clawed frog
(Xenopus laevis)
Amphibia MGC69068 35
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100498373 35
  • 60.56 (n)
  • 58.72 (a)
Str.12498 35
zebrafish
(Danio rerio)
Actinopterygii gpr182 36
  • 37 (a)
OneToOne
gpr182 35
  • 54.58 (n)
  • 42.07 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 22 (a)
OneToMany
Species with no ortholog for GPR182:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GPR182 Gene

ENSEMBL:
Gene Tree for GPR182 (if available)
TreeFam:
Gene Tree for GPR182 (if available)

Paralogs for GPR182 Gene

Paralogs for GPR182 Gene

(8) SIMAP similar genes for GPR182 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with GPR182: view

Variants for GPR182 Gene

Sequence variations from dbSNP and Humsavar for GPR182 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type
VAR_033464 -
rs55804462 -- 56,992,999(+) TATAT(-/ATATATATATATATATATATATATATATATATATACAT)GGGAA upstream-variant-2KB
rs57059397 -- 56,992,753(+) GTTTA(A/C)GAAAA upstream-variant-2KB
rs57264356 -- 56,993,091(+) AAAAA(-/AA/CC)ACACA upstream-variant-2KB
rs61303242 -- 56,993,469(+) AGAGG(G/T)TGAAG upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for GPR182 Gene

Variant ID Type Subtype PubMed ID
nsv832428 CNV Gain 17160897

Variation tolerance for GPR182 Gene

Residual Variation Intolerance Score: 24.2% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 3.53; 55.67% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for GPR182 Gene

HapMap Linkage Disequilibrium report
GPR182

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GPR182 Gene

Disorders for GPR182 Gene

MalaCards: The human disease database

(1) MalaCards diseases for GPR182 Gene - From: DISEASES

Disorder Aliases PubMed IDs
gliosarcoma
  • glioblastoma with sarcomatous component
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for GPR182

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
GPR182
genes like me logo Genes that share disorders with GPR182: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GPR182 Gene

Publications for GPR182 Gene

  1. Expression of the rat adrenomedullin receptor or a putative human adrenomedullin receptor does not correlate with adrenomedullin binding or functional response. (PMID: 9535752) Kennedy S.P. … Hill R.J. (Biochem. Biophys. Res. Commun. 1998) 2 3 4 23 67
  2. Molecular cloning of a novel human receptor gene with homology to the rat adrenomedullin receptor and high expression in heart and immune system. (PMID: 9367907) Haenze J. … Rascher W. (Biochem. Biophys. Res. Commun. 1997) 2 3 23
  3. Localization and distribution of adrenomedullin receptor in the human placenta: changes with gestational age. (PMID: 17939601) Marinoni E. … Di Iorio R. (J Reprod Med 2007) 3 23
  4. [Study of the expression and role of adrenomedullin and adrenomedullin receptor in patients with chronic obstructive pulmonary disease]. (PMID: 14720432) Xu P. … Song W.D. (Zhonghua Jie He He Hu Xi Za Zhi 2003) 3 23
  5. The cardiovascular response in sepsis: proposed mechanisms of the beneficial effect of adrenomedullin and its binding protein (review). (PMID: 11956648) Fowler D.E. … Wang P. (Int. J. Mol. Med. 2002) 3 23

Products for GPR182 Gene

Sources for GPR182 Gene

Back to Top

Content