V3 here soon-try beta now


Gene Search (GeneCards Home)	\|	GeneCards Guide	\|	User Feedback	\|	Terms of Use	\|	Notice about third-party sites

GPR182 Gene

protein-coding GIFtS: 49

GC12P055675

G protein-coupled receptor 182
(Previous name: adrenomedullin receptor )
Symbol approved by the HUGO Gene Nomenclature Committee (HGNC) database
(Previous symbol: ADMR)

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc , and/or ⁷Ensembl, ⁸miRBase)
About This Section

Aliases
7TMR ^²
ADMR ^², ³
AM-R ^¹, ²
AMR ^²
G10D ^¹, ²
MGC34399 ^²
gamrh ^²
hrhAMR ^¹, ²

Descriptions
G protein-coupled receptor 182 ^²
adrenomedullin receptor ^¹, ²

External Ids
HGNC: 13708¹
Entrez Gene: 11318²
UniProtKB: O15218³
Ensembl: ENSG00000166856⁷

Search outside databases for aliases for GPR182 gene

(According to Entrez Gene, Wikipedia's Gene Wiki,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

EntrezGene summary for GPR182:

Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular

function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of

G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may

function as a receptor for adrenomedullin. [provided by RefSeq]

UniProtKB/Swiss-Prot: GP182_HUMAN, O15218

Function: Orphan receptor

Gene Wiki entry for GPR182

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 36),
and/or miRBase,
Genomic Views according to UCSC and Ensembl, Transcription factor binding sites according to SABiosciences)
About This Section

Genomic View:

UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 12q13.3 Ensembl cytogenetic band: 12q13.3 HGNC cytogenetic band: 12q13.3

GPR182 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)

GeneLoc gene densities for chromosome 12 GeneLoc Exon Structure

GeneLoc location for GC12P055675: (about GC identifiers)

Start:	55,674,497 bp from pter
End:	55,676,736 bp from pter
Size:	2,240 bases
Orientation:	plus strand

RefSeq DNA sequence:

NC_000012.10 NT_029419.11

(According to ¹UniProtKB, and/or Ensembl, Phosphorylation sites according to ²Phosphosite, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from Invitrogen, Millipore, Sigma-Aldrich, R&D Systems, Enzo Life Sciences, Abnova, OriGene and/or, Abcam,
Biochemical Assays by Invitrogen, Millipore, R&D Systems, Cell Signaling Technology, and/or Enzo Life Sciences, Ontologies according to Gene Ontology Consortium 01 Apr 2009 and Entrez Gene, Antibodies by Invitrogen, Millipore, Sigma-Aldrich, R&D Systems, Cell Signaling Technology, Abcam, Abnova, and/or Novus Biologicals)
About This Section

UniProtKB/Swiss-Prot: GP182_HUMAN, O15218 (See protein sequence)

Recommended Name: G-protein coupled receptor 182

Size: 404 amino acids; 45323 Da

Subcellular location: Cell membrane; Multi-pass membrane protein

Caution: Was originally (PubMed:9367907) thought to be a receptor for adrenomedullin

Post-translational modifications:

View phosphorylation sites using PhosphoSite²

REFSEQ proteins: NP_009195.1

ENSEMBL proteins:

ENSP00000300098

Human Recombinant Proteins

	Browse Drug Discovery Central at Invitrogen for human recombinant proteins
	Browse Purified and Recombinant Proteins at Millipore
	Browse Human Recombinant Proteins at Sigma-Aldrich
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Recombinant Proteins from Abcam (Adrenomedullin Receptor L1)
	Human Recombinant Proteins from Abnova (GPR182)

Browse Origene for full length recombinant human proteins expressed in human HEK293 cells

2 Gene Ontology (GO) cellular component terms (links to tree view):

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005886	plasma membrane	IEA	--
GO:0016021	integral to membrane	TAS	9367907

About this table

Antibodies for GPR182:

	Browse Antibodies Central at Invitrogen
	Browse Millipore's Extensive Line of Mono- and Polyclonal Antibodies
	Sigma-Aldrich Antibodies for GPR182
	Browse R&D Systems for Antibodies
	Antibodies from Abcam (Adrenomedullin Receptor L1), each with their Abpromise^SM
	Monoclonal and Polyclonal Antibodies from Abnova (GPR182)
	Novus Biologicals Antibodies for GPR182

Assays for GPR182:

	Browse Invitrogen for biochemical assays
	Browse Kits and Assays available from Millipore
	Browse R&D Systems for biochemical assays
	Browse biochemical assays available from Enzo Life Sciences

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

Graphical View of Domain Structure for InterPro Entry O15218

ProtoNet protein and cluster: O15218

1 Blocks protein family: IPB001350 G10D orphan receptor signature

UniProtKB/Swiss-Prot: GP182_HUMAN, O15218

Similarity: Belongs to the G-protein coupled receptor 1 family

(According to MGI Jun 06 2009, UniProtKB, IUBMB,and/or Genatlas,
shRNA from OriGene, Sigma-Aldrich, RNAi from Sigma-Aldrich,
RNAi Products, Clones, and Q-PCR Products from Invitrogen, Millipore, OriGene, and/or Abnova, siRNAs from Applied Biosystems, SYBR primers from OriGene, Cell-based Assays from Millipore, Ontologies according to Gene Ontology Consortium 01 Apr 2009 via Entrez Gene.)
About This Section

Inhib. RNA:		Invitrogen RNAi Products for gene knock-down (GPR182)
		Browse for Gene Knock-down Tools from Millipore
		Abnova Chimera RNAi Products for Gene knock-down (GPR182)

OriGene 29mer shRNA kit in GFP-retroviral vector: NM_007264

Applied Biosystems Silencer® siRNAs for GPR182

Sigma-Aldrich siRNA and siRNA Panels for GPR182

Sigma-Aldrich shRNA Panels and shRNA for GPR182

Explore Sigma-Aldrich super-pooled esiRNAs

Clones:		Invitrogen Clones for GPR182
		Browse Clones for the Expression of Recombinant Proteins Available from Millipore

OriGene GFP tagged cDNA clone in CMV expression vector: NM_007264
Myc/DDK tagged cDNA clone in CMV expression vector: NM_007264
untagged cDNA clone in CMV expression vector: NM_007264

Primers:

Browse Quantitative PCR Central at Invitrogen for Q-PCR LUX™ Primers

OriGene genome-wide validated SYBR primer pairs: NM_007264

UniProtKB/Swiss-Prot: GP182_HUMAN, O15218

Function: Orphan receptor

1 Gene Ontology (GO) molecular function term (links to tree view):

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0004930	G-protein coupled receptor activity	IEA	--

About this table

(Pathways according to Invitrogen (maps by GeneGo), Millipore, Cell Signaling Technology, Sigma-Aldrich, KEGG and/or UniProtKB,
Sets of similar genes according to GeneDecks, Proteins Network according to SABiosciences, Interactions according to ¹UniProtKB, ²MINT, and/or ³STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2009 via Entrez Gene.)
About This Section

5/10 Interacting proteins for GPR182 (ENSP00000300098³) via UniProtKB, MINT, and/or STRING (see all 10 )

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
APLN	ENSP00000305464³	STRING (score=.866)
P4HB	ENSP00000327801³	STRING (score=.866)
ADM	ENSP00000278175³	STRING (score=.821)
KIAA2022	ENSP00000362567³	STRING (score=.819)
CISD2	ENSP00000273986³	STRING (score=.734)

About this table

1 Gene Ontology (GO) biological process term (links to tree view):

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0007186	G-protein coupled receptor protein signaling pathway	IEA	--

About this table

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, Sigma-Aldrich, Tocris Bioscience, and/or Novoseek and Drugs according to Enzo Life Sciences and/or PharmGKB)
About This Section

Browse drugs & compounds from Enzo Life Sciences

Browse Small Molecules at Sigma-Aldrich

Browse Tocris compounds for GPR182
3 Novoseek chemical compound relationships for GPR182 gene

Compound	Score	Articles	PubMed IDs for Articles with Shared Sentences (# sentences)
bibn 4096 bs	80.63	2	12970090 (1), 12183333 (1)
glyceraldehyde 3-phosphate	21.90	1	11905404 (1)
tyrosine	0.00	1	16267056 (1)

About this table

(GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 219 Homo sapiens; Jun 2 2009) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView,
non coding RNAs according to RNAdb,
ESTs according to GeneTide,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from Invitrogen, Millipore, and/or Abnova,
siRNAs from Applied Biosystems, Sigma-Aldrich,
shRNA from Sigma-Aldrich, OriGene,
Tagged/untagged cDNA clones from OriGene,
Expression Assays from Applied Biosystems)
About This Section

Inhib. RNA:		Invitrogen RNAi Products for gene knock-down (GPR182)
		Browse for Gene Knock-down Tools from Millipore
		Abnova Chimera RNAi Products for Gene knock-down (GPR182)

OriGene 29mer shRNA kit in GFP-retroviral vector: NM_007264

Sigma-Aldrich siRNA and siRNA Panels for GPR182

Sigma-Aldrich shRNA Panels and shRNA for GPR182

Explore Sigma-Aldrich super-pooled esiRNAs

Applied Biosystems Silencer® siRNAs:

NM_007264

REFSEQ mRNAs for GPR182 gene:

NM_007264.3

Applied Biosystems TaqMan ® Gene Expression Assays:

NM_007264

              OriGene GFP tagged cDNA clone in CMV expression vector: NM_007264
                                 Myc/DDK tagged cDNA clone in CMV expression vector: NM_007264
                                 untagged cDNA clone in CMV expression vector: NM_007264

Additional cDNA sequence:

BC034761.1 Y13583.1

2 DOTS entries:

DT.92416997 DT.121199001

18 AceView cDNA sequences:

BI759854 AI433867 NM_007264 BM919720 BC034761 AI379917 BI830122 BX114393

AI962628 BM091055 CD246170 AW135380 Y13583 BM091360 AA704594 AI243295

T90363 BP340154

Unigene Cluster for GPR182:

G protein-coupled receptor 182

Hs.483909 [show with all ESTs]

Unigene Representative Sequence: BC034761

GeneLoc Exon Structure

1 Ensembl transcript including schematic representation:

ENST00000300098

(Experimental results according to ¹GeneNote and GNF BioGPS,
probe sets-to-genes annotations according to ²GeneAnnot , ³GeneTide , Sets of similar genes according to GeneDecks, Electronic Northern calculations according to data from UniGene (Build 219 Homo sapiens), SAGE tags according to CGAP, plus additional links to SOURCE, and/or GNF BioGPS, and/or EXPOLDB, and/or UniProtKB,
Expression Assays from Applied Biosystems )
About This Section

GPR182 expression in normal and diseased human tissues

Applied Biosystems TaqMan ® Gene Expression Assays for GPR182

¹ / ²

4 probe-sets matching GPR182 gene

Affymetrix probe-set	Array	# genes	Sensitivity	Specificity	Correlation	Length	Gb_Accession	Consensus	Uniqueness	Score	Rank
Affymetrix probe-set	Array	GeneAnnot data			GeneNote data		GeneTide data
36429_at²	U95-A	1	1.00	1.00	1.00	1.00	--	--	--	--	--
214506_at²	U133-A	1	0.46	1.00	--	--	--	--	--	--	--
1552440_at²	U133Plus2	1	1.00	1.00	--	--	--	--	--	--	--
214506_at²	U133Plus2	1	0.46	1.00	--	--	--	--	--	--	--

GeneDecks GPR182 for binary patterns associated with the probe-sets selected above

About GeneDecksing

About this table

Data from

(Publications) and GNF BioGPS
About these images
About these images

CGAP SAGE TAG: --

SOURCE GeneReport for Unigene cluster: Hs.483909
UniProtKB/Swiss-Prot: GP182_HUMAN, O15218
Tissue specificity: Highly expressed in heart, skeletal muscle, immune system, adrenal gland and
liver

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD and/or ⁵MGI Jun 06 2009, with possible further links to Flybase and/or WormBase, Gene Trees according to Ensembl)
About This Section

Orthologs for GPR182 gene from 5/7 species (see all 7 )

Organism	Gene	Locus	Description	Human Similarity	NCBI accessions
dog (Canis familiaris)	GPR182¹	--	G protein-coupled receptor 182	78.28(n) 70.21(a)	481120 XM_538241.1 XP_538241.1
cow (Bos taurus)	GPR182¹	--	G protein-coupled receptor 182	85.64(n) 80.16(a)	509554 XM_586542.3 XP_586542.2
rat (Rattus norvegicus)	Gpr182¹	--	G protein-coupled receptor 182	81.03(n) 74.87(a)	29307 NM_053302.2 NP_445754.2
mouse (Mus musculus)	Gpr182^{1, 5}	10 (72.00 cM)⁵	G protein-coupled receptor 182^{1, 5}	80.74(n)¹ 74.09(a)¹	11536¹ NM_007412.2¹ NP_031438.2¹ AF001229⁵ AK031480⁵ (see all 12)
zebrafish (Danio rerio)	gpr182¹	--	G protein-coupled receptor 182	53.03(n) 41.79(a)	323641 NM_001020478.1 NP_001018314.1

About this table Species with no ortholog for GPR182

ENSEMBL Gene Tree for GPR182

(Paralogs according to ¹HomoloGene
and ²Ensembl, Pseudogenes according to ³Pseudogene.org)
About This Section

Paralogs for GPR182 gene

GPR25² CXCR7² GPR15²

(According to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, and UniProtKB, Linkage Disequilibrium by HapMap, Genotyping Reagents from Applied Biosystems)
About This Section

10/16 NCBI SNPs in GPR182 are shown (see all 16 )
(Click for Applied Biosystems TaqMan ® Genotyping Assay) (see all 27)

AB	SNP ID	Valid	Chr 12 pos	Sequence	Recs	AA Chg	Type	More	Recs	Allele freq	Pop	Total sample	More
AB	Genomic Data				Transcription Data				Allele Frequencies
				--	--	--		--	--				--
	rs2279373^1,2	F,H	55674465(+)	`CACACC/TGGGTC`	1	--	ng5¹		4		EU EA WA	416
--	rs72443473^1,2	--	55673017(+)	`TGTGG-/GTTGTGT`	1	--	ng5¹		0	--	--	--	--
--	rs67982607^1,2	--	55673051(+)	`ATATG-/ATATATATATATATATAT ATATATATATATATATACATGGAAT`	1	--	ng5¹		0	--	--	--	--
--	rs67476535^1,2	--	55674377(+)	`CTGAGG/TCTGAG`	1	--	ng5¹		0	--	--	--	--
--	rs73332681^1,2	--	55673094(+)	`ATGCAG/TGCTCC`	1	--	ng5¹		0	--	--	--	--
--	rs73131120^1,2	--	55674253(+)	`ACATAC/TGTAAA`	1	--	ng5¹		0	--	--	--	--
--	rs72323713^1,2	--	55673030(+)	`TGTGT-/TATATATATATA TATATATATATATAATATA`	1	--	ng5¹		0	--	--	--	--
--	rs61303242^1,2	--	55673520(+)	`AGAGGG/TTGAAG`	1	--	ng5¹		0	--	--	--	--
--	rs57059397^1,2	--	55672804(+)	`GTTTAA/CGAAAA`	1	--	ng5¹		0	--	--	--	--
--	rs72277206^1,2	--	55673030(+)	`GTGTG-/TATATAT`	1	--	ng5¹		0	--	--	--	--

About this table

HapMap Linkage Disequilibrium images for GPR182 (up to first 250kb)

(in which this Gene is Involved, According to OMIM, UniProtKB, Novoseek, PharmGKB, Genatlas, GeneTests, Blood group antigen gene mutations by BGMUT, HGMD, GAD, HuGE Navigator, BCGD, and/or TGDB.)
About This Section

OMIM: 605307

8 Novoseek disease relationships for GPR182 gene

Disease	Score	Articles	PubMed IDs for Articles with Shared Sentences (# sentences)
hypertension renal	48.89	2	9120666 (1), 8951571 (1)
heart failure congestive	10.69	2	9120666 (1), 8951571 (1)
sepsis	9.33	1	11997081 (1)
tumors	3.77	3	9016306 (1), 17363587 (1), 15245870 (1)
pulmonary disease chronic obstructive	1.26	5	14720432 (2), 12877796 (1)
heart failure	0.00	1	12630824 (1)
cardiovascular diseases	0.00	1	15273827 (1)
renal failure	0.00	2	9120666 (1), 8951571 (1)

About this table

(Possibly Related Articles in Doctor's Guide)
About This Section

(in PubMed. Associations of this gene to articles via ¹Novoseek, ²HGNC, ³Entrez Gene, ⁴UniProtKB/Swiss-Prot, ⁵UniProtKB/TrEMBL, ⁶GAD, and/or ⁷PharmGKB)
About This Section

10/91 PubMed articles for GPR182 gene (see all 91 ):

Expression of the rat adrenomedullin receptor or a putative human adrenomedullin receptor does not correlate with adrenomedullin binding or functional response. (PubMed id 9535752)^{1, 2, 3, 4} Kennedy S.P....Hill R.J. (1998)
Molecular cloning of a novel human receptor gene with homology to the rat adrenomedullin receptor and high expression in heart and immune system. (PubMed id 9367907)^{1, 2, 3, 4} Haenze J.... Rascher W. (1997)
The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)^{3, 4} Gerhard D.S....Malek J. (2004)
Localization and distribution of adrenomedullin receptor in the human placenta: changes with gestational age. (PubMed id 17939601)^{1, 3} Marinoni E....Di Iorio R. (2007)
[Study of the expression and role of adrenomedullin and adrenomedullin receptor in patients with chronic obstructive pulmonary disease] (PubMed id 14720432)^{1, 3} Xu P....Song W.D. (2003)
Adrenomedullin receptor expression in human lung and in pulmonary tumors. (PubMed id 9016306)^{1, 3} Martinez A....Cuttitta F. (1997)
The cardiovascular response in sepsis: proposed mechanisms of the beneficial effect of adrenomedullin and its binding protein (review). (PubMed id 11956648)^{1, 3} Fowler D.E. and Wang P. (2002)
Genomic organization and regulation of a human 7-helix transmembrane receptor which is expressed in pulmonary epithelial cells and induced in hypoxia. (PubMed id 11883938)^{1, 3} Haenze J.... Fischer A. (2002)
Receptors for adrenomedullin in human vascular endothelial cells. (PubMed id 7621913)^{1, 3} Kato J....Eto T. (1995)
Expression of adrenomedullin and its receptor by chondrocyte phenotype cells. (PubMed id 12646214)³ Chosa E....Tajima N. (2003)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, and/or H-InvDB)
About This Section

Entrez Gene: 11318	HGNC: 13708	AceView: ADMR	Ensembl:ENSG00000166856	euGenes: HUgn11318
ECgene: GPR182	H-InvDB: GPR182

(According to HUGE)
About This Section

(According to ATLAS, HORDE, IMGT, MTDB, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Licensable Technologies for GPR182
(Available from WIS Yeda, Salk, Tufts)

About This Section

(Reagents available from Applied Biosystems, Antibodies and assays by Cell Signaling Technology, Abcam, Novus Biologicals,
Sigma-Aldrich, R&D Systems, Millipore, Abnova, and/or Invitrogen, Clones available from OriGene,and/or Invitrogen, Drugs and/or compounds by Sigma-Aldrich,
Enzo Life Sciences, and/or Tocris Bioscience)
About This Section

Products for GPR182:

TaqMan ® Gene Expression Assays

TaqMan ® Genotyping Assays

Free SNP selection tool

Invitrogen iPath Pathways	Invitrogen BLOCK-iT™ RNAi
Invitrogen Antibodies	Invitrogen Assays
Invitrogen Clones	Invitrogen Q-PCR Products
Invitrogen Human Recombinant Kinases	Invitrogen Custom Antibody and Peptide Service
Invitrogen Proteins / Assays / Screening Services	Search Invitrogen catalog for GPR182-related products

	Millipore Custom Antibody & Bulk Services
	Millipore Preclinical / Clinical Development Services
	Millipore Immunoassay Services
	Millipore Target Screening & Profiling Services

	Predesigned and custom siRNAs for GPR182		Antibodies for GPR182
	Explore super-pooled esiRNAs		Browse proteins at Sigma-Aldrich
	Lentivirus-delivered shRNAs for GPR182		Browse small molecules at Sigma-Aldrich
	"Your Favorite Gene" Pathways		feedback

	Antibodies		Primer Pairs
	Cell Culture Products		ELISAs
	Flow Cytometry Kits		Protease Activity Assays & Reagents
	Cell Selection/Detection Kits & Reagents		ELISA/Assay Development Kits & Reagents
	Multiplex/Array Assay Kits & Reagents		ELISpot Kits & Development Modules
	Recombinant & Natural Proteins

	Recombinant Proteins (GPR182)
	Antibodies (GPR182)
	Chimera RNAi (GPR182)
	Custom Service for Mouse Mab
	Custom Service for Rabbit Pab from Full-length Protein

Search for Antibodies & Assays

	Recombinant Proteins (Adrenomedullin Receptor L1)
	Antibodies (Adrenomedullin Receptor L1)

Search OriGene for GPR182

Search Tocris compounds for GPR182

Search www.enzolifesicences.com for proteins, assays, substrates, inhibitors & antibodies

Antibodies for GPR182

GeneCards Homepage - Last full update: 2 Jul 2009 Incremental update: 13 Oct 2009

Random Gene From GIFtS :

about GIFtS

Gene Index: 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Developed at the Crown Human Genome Center & Weizmann Institute of Science

The GeneCards Human Gene Database: Copyright © 1996-2009, Weizmann Institute of Science. All Rights Reserved.
GPR182 Gene at Home site.
Version 2.41.1
server5.xennexinc.com

GPR182 Gene

protein-coding GIFtS: 49

Aliases &
Descriptions
for GPR182

Summaries
for GPR182

Genomic Location
for GPR182

Proteins
for GPR182

Protein Domains/
Families
for GPR182

Gene Function
for GPR182

Pathways & Interactions
for GPR182

Drugs & Compounds
for GPR182

Transcripts
for GPR182

Expression
for GPR182

Orthologs
for GPR182

Paralogs
for GPR182

SNPs/Variants
for GPR182

Disorders & Mutations
for GPR182

Medical News
for GPR182

Publications
for GPR182

Search for GPR182

Genome Databases showing GPR182

Other Databases showing GPR182

Specialized Databases showing GPR182

Licensable Technologies
for GPR182

Services
for GPR182

Gene Index: 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

GPR182 Gene

protein-coding GIFtS: 49

Aliases & Descriptionsfor GPR182

Summariesfor GPR182

Genomic Locationfor GPR182

Proteinsfor GPR182

Protein Domains/Familiesfor GPR182

Gene Functionfor GPR182

Pathways & Interactionsfor GPR182

Drugs & Compoundsfor GPR182

Transcriptsfor GPR182

Expression for GPR182

Orthologsfor GPR182

Paralogsfor GPR182

SNPs/Variantsfor GPR182

Disorders & Mutationsfor GPR182

Medical Newsfor GPR182

Publicationsfor GPR182

Search for GPR182

Genome Databases showing GPR182

Other Databases showing GPR182

Specialized Databases showing GPR182

Licensable Technologiesfor GPR182

Servicesfor GPR182

Gene Index: 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

Aliases &
Descriptions
for GPR182

Summaries
for GPR182

Genomic Location
for GPR182

Proteins
for GPR182

Protein Domains/
Families
for GPR182

Gene Function
for GPR182

Pathways & Interactions
for GPR182

Drugs & Compounds
for GPR182

Transcripts
for GPR182

Expression
for GPR182

Orthologs
for GPR182

Paralogs
for GPR182

SNPs/Variants
for GPR182

Disorders & Mutations
for GPR182

Medical News
for GPR182

Publications
for GPR182

Licensable Technologies
for GPR182

Services
for GPR182