Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GPR182 Gene

Aliases for GPR182 Gene

  • G Protein-Coupled Receptor 182 2 3
  • Adrenomedullin Receptor 2 3
  • ADMR 3 4
  • G-Protein Coupled Receptor 182 3
  • HrhAMR 3
  • Gamrh 3
  • 7TMR 3
  • AM-R 3
  • G10D 3
  • AMR 3

External Ids for GPR182 Gene

Previous HGNC Symbols for GPR182 Gene

  • ADMR

Previous GeneCards Identifiers for GPR182 Gene

  • GC12P055675
  • GC12P057388
  • GC12P054428

Summaries for GPR182 Gene

Entrez Gene Summary for GPR182 Gene

  • Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]

GeneCards Summary for GPR182 Gene

GPR182 (G Protein-Coupled Receptor 182) is a Protein Coding gene. Diseases associated with GPR182 include oligohydramnios. Among its related pathways are Myometrial Relaxation and Contraction Pathways and Sympathetic Nerve Pathway (Neuroeffector Junction). GO annotations related to this gene include G-protein coupled receptor activity and transmembrane signaling receptor activity. An important paralog of this gene is ACKR3.

UniProtKB/Swiss-Prot for GPR182 Gene

  • Orphan receptor

Gene Wiki entry for GPR182 Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GPR182 Gene

Genomics for GPR182 Gene

Regulatory Elements for GPR182 Gene

Genomic Location for GPR182 Gene

Start:
56,994,446 bp from pter
End:
56,996,685 bp from pter
Size:
2,240 bases
Orientation:
Plus strand

Genomic View for GPR182 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for GPR182 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GPR182 Gene

Proteins for GPR182 Gene

  • Protein details for GPR182 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O15218-GP182_HUMAN
    Recommended name:
    G-protein coupled receptor 182
    Protein Accession:
    O15218
    Secondary Accessions:

    Protein attributes for GPR182 Gene

    Size:
    404 amino acids
    Molecular mass:
    45323 Da
    Quaternary structure:
    No Data Available

neXtProt entry for GPR182 Gene

Proteomics data for GPR182 Gene at MOPED

Post-translational modifications for GPR182 Gene

  • Glycosylation at Asn28 and Asn37
  • Modification sites at PhosphoSitePlus

Other Protein References for GPR182 Gene

ENSEMBL proteins:
REFSEQ proteins:

Antibody Products

No data available for DME Specific Peptides for GPR182 Gene

Domains for GPR182 Gene

Gene Families for GPR182 Gene

HGNC:
  • GPCRAO :GPCR / Class A : Orphans
IUPHAR :

Protein Domains for GPR182 Gene

Suggested Antigen Peptide Sequences for GPR182 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O15218

UniProtKB/Swiss-Prot:

GP182_HUMAN :
  • O15218
Family:
  • Belongs to the G-protein coupled receptor 1 family.
genes like me logo Genes that share domains with GPR182: view

Function for GPR182 Gene

Molecular function for GPR182 Gene

UniProtKB/Swiss-Prot Function:
Orphan receptor

Gene Ontology (GO) - Molecular Function for GPR182 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004888 transmembrane signaling receptor activity TAS 9367907
GO:0004930 G-protein coupled receptor activity IEA --
genes like me logo Genes that share ontologies with GPR182: view
genes like me logo Genes that share phenotypes with GPR182: view

Animal Model Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for GPR182

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for GPR182 Gene

Localization for GPR182 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GPR182 Gene

Cell membrane; Multi-pass membrane protein.

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for GPR182 Gene COMPARTMENTS Subcellular localization image for GPR182 gene
Compartment Confidence
plasma membrane 5
extracellular 2
cytoskeleton 1
nucleus 1

Gene Ontology (GO) - Cellular Components for GPR182 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005886 plasma membrane IEA --
GO:0016021 integral component of membrane IEA --
genes like me logo Genes that share ontologies with GPR182: view

Pathways for GPR182 Gene

genes like me logo Genes that share pathways with GPR182: view

Pathways by source for GPR182 Gene

1 BioSystems pathway for GPR182 Gene
1 PharmGKB pathway for GPR182 Gene

PCR Array Products

  • Pathway & Disease-focused RT² Profiler PCR Arrays

Interacting Proteins for GPR182 Gene

Gene Ontology (GO) - Biological Process for GPR182 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0007166 cell surface receptor signaling pathway TAS 9367907
GO:0007186 G-protein coupled receptor signaling pathway IEA --
genes like me logo Genes that share ontologies with GPR182: view

Compounds for GPR182 Gene

(4) Novoseek inferred chemical compound relationships for GPR182 Gene

Compound -log(P) Hits PubMed IDs
bibn 4096 bs 79.1 2
adenylate 29.2 1
glyceraldehyde 3-phosphate 20 1
tyrosine 0 1
genes like me logo Genes that share compounds with GPR182: view

Transcripts for GPR182 Gene

mRNA/cDNA for GPR182 Gene

(18) Selected AceView cDNA sequences:
(5) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for GPR182 Gene

G protein-coupled receptor 182:
Representative Sequences:

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for GPR182

Primer Products

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for GPR182 Gene

No ASD Table

Relevant External Links for GPR182 Gene

GeneLoc Exon Structure for
GPR182
ECgene alternative splicing isoforms for
GPR182

Expression for GPR182 Gene

mRNA expression in normal human tissues for GPR182 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GPR182 Gene

This gene is overexpressed in Spleen (23.2), Liver (4.5), and Testis (4.2).

Protein differential expression in normal tissues for GPR182 Gene

This gene is overexpressed in Spleen (69.0).

Integrated Proteomics: protein expression from ProteomicsDB and MOPED for GPR182 Gene

SOURCE GeneReport for Unigene cluster for GPR182 Gene Hs.483909

mRNA Expression by UniProt/SwissProt for GPR182 Gene

O15218-GP182_HUMAN
Tissue specificity: Highly expressed in heart, skeletal muscle, immune system, adrenal gland and liver.
genes like me logo Genes that share expressions with GPR182: view

Expression partners for GPR182 Gene

In Situ Assay Products

Orthologs for GPR182 Gene

This gene was present in the common ancestor of chordates.

Orthologs for GPR182 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia GPR182 35
  • 85.28 (n)
  • 79.48 (a)
GPR182 36
  • 71 (a)
OneToOne
dog
(Canis familiaris)
Mammalia GPR182 35
  • 77.98 (n)
  • 69.76 (a)
GPR182 36
  • 63 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Gpr182 35
  • 80.74 (n)
  • 74.09 (a)
Gpr182 16
Gpr182 36
  • 74 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia GPR182 35
  • 97.02 (n)
  • 96.49 (a)
GPR182 36
  • 99 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Gpr182 35
  • 81.03 (n)
  • 74.87 (a)
oppossum
(Monodelphis domestica)
Mammalia GPR182 36
  • 71 (a)
OneToOne
chicken
(Gallus gallus)
Aves GPR182 35
  • 69.1 (n)
  • 61.52 (a)
GPR182 36
  • 60 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia GPR182 36
  • 58 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia LOC100498373 35
  • 60.56 (n)
  • 58.72 (a)
Str.12498 35
African clawed frog
(Xenopus laevis)
Amphibia MGC69068 35
zebrafish
(Danio rerio)
Actinopterygii gpr182 35
  • 54.58 (n)
  • 42.07 (a)
gpr182 36
  • 37 (a)
OneToOne
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 22 (a)
OneToMany
Species with no ortholog for GPR182:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GPR182 Gene

ENSEMBL:
Gene Tree for GPR182 (if available)
TreeFam:
Gene Tree for GPR182 (if available)

Paralogs for GPR182 Gene

Paralogs for GPR182 Gene

Selected SIMAP similar genes for GPR182 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with GPR182: view

Variants for GPR182 Gene

Sequence variations from dbSNP and Humsavar for GPR182 Gene

SNP ID Clin Chr 12 pos Sequence Context AA Info Type MAF
rs407636 -- 56,993,505(+) CTCCA(C/G)AATCC upstream-variant-2KB
rs423527 -- 56,993,509(-) CGTTG(G/T)ATTGT upstream-variant-2KB
rs2279373 -- 56,994,414(+) CACAC(C/T)GGGTC upstream-variant-2KB
rs36086987 -- 56,993,893(+) GGGCT(-/C)CAAGC upstream-variant-2KB
rs55804462 -- 56,992,999(+) TATAT(-/ATATATATATATATATATATATATATATATATATACAT)GGGAA upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for GPR182 Gene

Variant ID Type Subtype PubMed ID
nsv832428 CNV Gain 17160897

Relevant External Links for GPR182 Gene

HapMap Linkage Disequilibrium report
GPR182

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GPR182 Gene

Disorders for GPR182 Gene

MalaCards: The human disease database

MalaCards: The human disease database.

Search for GPR182 Gene in MalaCards »

(1) Diseases for GPR182 Gene including...

(8) Novoseek inferred disease relationships for GPR182 Gene

Disease -log(P) Hits PubMed IDs
hypertension renal 47.4 2
heart failure congestive 8.94 2
sepsis 7.1 1
tumors 3.47 3
cardiovascular diseases 0 1
genes like me logo Genes that share disorders with GPR182: view

No data available for OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Genatlas and External Links for GPR182 Gene

Publications for GPR182 Gene

  1. Molecular cloning of a novel human receptor gene with homology to the rat adrenomedullin receptor and high expression in heart and immune system. (PMID: 9367907) Haenze J. … Rascher W. (Biochem. Biophys. Res. Commun. 1997) 2 3 4 23
  2. Expression of the rat adrenomedullin receptor or a putative human adrenomedullin receptor does not correlate with adrenomedullin binding or functional response. (PMID: 9535752) Kennedy S.P. … Hill R.J. (Biochem. Biophys. Res. Commun. 1998) 2 3 4 23
  3. The cardiovascular response in sepsis: proposed mechanisms of the beneficial effect of adrenomedullin and its binding protein (review). (PMID: 11956648) Fowler D.E. … Wang P. (Int. J. Mol. Med. 2002) 3 23
  4. [Study of the expression and role of adrenomedullin and adrenomedullin receptor in patients with chronic obstructive pulmonary disease]. (PMID: 14720432) Xu P. … Song W.D. (Zhonghua Jie He He Hu Xi Za Zhi 2003) 3 23
  5. Localization and distribution of adrenomedullin receptor in the human placenta: changes with gestational age. (PMID: 17939601) Marinoni E. … Di Iorio R. (J Reprod Med 2007) 3 23

Products for GPR182 Gene

Sources for GPR182 Gene

Back to Top

Content