Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



GNPTG Gene

protein-coding   GIFtS: 54
GCID: GC16P001401

N-Acetylglucosamine-1-Phosphate Transferase, Gamma Subunit

(Previous names: N-acetylglucosamine-1-phosphotransferase, gamma subunit,...)
(Previous symbols: GNPTAG, C16orf27)
Alzheimer's & Parkinson's Diseases Congress
  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
N-Acetylglucosamine-1-Phosphate Transferase, Gamma Subunit1 2     GlcNAc-Phosphotransferase Gamma-Subunit1
GNPTAG1 2 3 5     N-Acetylglucosamine-1-Phosphotransferase, Gamma Subunit1
C16orf271 2 3     LP25372
GlcNAc-1-Phosphotransferase Subunit Gamma2 3     RJD92
UDP-N-Acetylglucosamine-1-Phosphotransferase Subunit Gamma2 3     N-Acetylglucosamine-1-Phosphotransferase Subunit Gamma2
Chromosome 16 Open Reading Frame 271     

External Ids:    HGNC: 230261   Entrez Gene: 845722   Ensembl: ENSG000000905817   OMIM: 6078385   UniProtKB: Q9UJJ93   

Export aliases for GNPTG gene to outside databases

Previous GC identifers: GC16P001342 GC16P001343


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for GNPTG Gene:
This gene encodes the gamma sunbunit of the N-acetylglucosamine-1-phosphotransferase complex. This hexameric
complex, composed of alpha, beta and gamma subunits, catalyzes the first step in synthesis of a mannose
6-phosphate lysosomal recognition marker. This enzyme complex is necessary for targeting of lysosomal hydrolases
to the lysosome. Mutations in the gene encoding the gamma subunit have been associated with mucolipidosis IIIC,
also known as mucolipidosis III gamma.(provided by RefSeq, Feb 2010)

GeneCards Summary for GNPTG Gene:
GNPTG (N-acetylglucosamine-1-phosphate transferase, gamma subunit) is a protein-coding gene. Diseases associated with GNPTG include mucolipidosis iii gamma, and mucolipidosis iii alpha/beta.

UniProtKB/Swiss-Prot: GNPTG_HUMAN, Q9UJJ9
Function: May recognize the substrate of GlcNAc-1-phosphotransferase but also the lysosomal proteins with
mannose-6-phosphate residues




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000016.10  NC_018927.2  NT_010393.17  
Regulatory elements:
   Regulatory transcription factor binding sites in the GNPTG gene promoter:
         AREB6   HEN1   NF-1   MIF-1   Nkx2-5   LCR-F1   E47   Arnt   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidGNPTG promoter sequence
   Search Chromatin IP Primers for GNPTG

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat GNPTG


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16p13.3   Ensembl cytogenetic band:  16p13.3   HGNC cytogenetic band: 16p13.3

GNPTG Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
GNPTG gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16P001401:  view genomic region     (about GC identifiers)

Start:
1,401,900 bp from pter      End:
1,413,352 bp from pter
Size:
11,453 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: GNPTG_HUMAN, Q9UJJ9 (See protein sequence)
Recommended Name: N-acetylglucosamine-1-phosphotransferase subunit gamma precursor  
Size: 305 amino acids; 33974 Da
Subunit: Hexamer of two alpha, two beta and two gamma subunit; disulfide-linked. It is believed that the alpha
and/or the beta subunit of the enzyme contain the catalytic portion and that the gamma subunit functions in
recognition of the lysosomal enzymes
Sequence caution: Sequence=AAP34456.1; Type=Erroneous initiation;
Secondary accessions: B2R556 Q6XYD7 Q96L13

Explore the universe of human proteins at neXtProt for GNPTG: NX_Q9UJJ9

Explore proteomics data for GNPTG at MOPED

Post-translational modifications: 

  • Glycosylation2 at Asn88, Asn115, Thr271, Thr274, Thr276, Ser277, Thr286, Ser291
  • Modification sites at PhosphoSitePlus

  • See GNPTG Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_115909.1  
    ENSEMBL proteins: 
     ENSP00000204679   ENSP00000434413   ENSP00000460728   ENSP00000435349  

    GNPTG Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for GNPTG
    OriGene Protein Over-expression Lysate for GNPTG
    OriGene MassSpec for GNPTG
    OriGene Custom Protein Services for GNPTG
    GenScript Custom Purified and Recombinant Proteins Services for GNPTG
    Novus Biologicals GNPTG Protein
    Novus Biologicals GNPTG Lysates
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Browse Proteins at Cloud-Clone Corp.

    GNPTG Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for GNPTG
    Novus Biologicals GNPTG Antibodies
    Search for Antibodies for GNPTG at Abcam
    Browse Antibodies at Cloud-Clone Corp.
    Search ThermoFisher Antibodies for GNPTG
    LSBio Antibodies in human, mouse, rat for GNPTG

    GNPTG Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for GNPTG
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for GNPTG
    Browse Enzo Life Sciences for kits & assays
    Browse ELISAs at Cloud-Clone Corp.
    Browse CLIAs at Cloud-Clone Corp.


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR009011 Man6P_isomerase_rcpt-bd_dom

    Graphical View of Domain Structure for InterPro Entry Q9UJJ9

    ProtoNet protein and cluster: Q9UJJ9

    1 Blocks protein domain: IPB012913 Glucosidase II beta subunit-like

    UniProtKB/Swiss-Prot: GNPTG_HUMAN, Q9UJJ9
    Similarity: Contains 1 PRKCSH domain


    GNPTG for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: GNPTG_HUMAN, Q9UJJ9
    Function: May recognize the substrate of GlcNAc-1-phosphotransferase but also the lysosomal proteins with
    mannose-6-phosphate residues

         Gene Ontology (GO): 1 molecular function term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0042803protein homodimerization activity ISS--
         
    GNPTG for ontologies           About GeneDecksing


    Phenotypes:
         1 MGI mutant phenotype (inferred from 1 allele(MGI details for Gnptg):
     cellular 

    GNPTG for phenotypes           About GeneDecksing

    Animal Models:
         MGI mouse knock-out Gnptgtm1Lex for GNPTG

       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for GNPTG
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for GNPTG

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for GNPTG
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for GNPTG

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat GNPTG using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate GNPTG:
    hsa-miR-374a* hsa-miR-299-5p hsa-miR-625* hsa-miR-1179 hsa-miR-491-3p hsa-miR-106a* hsa-miR-490-5p
    SwitchGear 3'UTR luciferase reporter plasmidGNPTG 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for GNPTG
    Predesigned siRNA for gene silencing in human, mouse, rat GNPTG

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for GNPTG

    Clone
    Products:
         
    OriGene clones in human, mouse for GNPTG (see all 6)
    OriGene ORF clones in mouse, rat for GNPTG
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: GNPTG (NM_032520)
    Sino Biological Human cDNA Clone for GNPTG
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for GNPTG
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat GNPTG

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for GNPTG
    Browse ESI BIO Cell Lines and PureStem Progenitors for GNPTG 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for GNPTG


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    GNPTG_HUMAN, Q9UJJ9: Secreted (By similarity). Golgi apparatus (By similarity)
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    extracellular2
    golgi apparatus2
    lysosome2
    vacuole2
    cytosol1
    endoplasmic reticulum1

    Gene Ontology (GO): Selected cellular component terms (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0000139Golgi membrane IEA--
    GO:0005576extracellular region ----
    GO:0005794Golgi apparatus ISS--
    GO:0016020membrane ----
    GO:0043231intracellular membrane-bounded organelle ----

    GNPTG for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for GNPTG About                                                                                                See pathways by source

    SuperPathContained pathways About
    1Lysosome
    Lysosome

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways




    1 Kegg Pathway  (Kegg details for GNPTG):
        Lysosome


    GNPTG for pathways           About GeneDecksing

        Pathway & Disease-focused RT2 Profiler PCR Array including GNPTG: 
              Glycosylation in human mouse rat

    Interactions:

        Search GeneGlobe Interaction Network for GNPTG

    STRING Interaction Network Preview (showing 5 interactants - click image to see 14)

    Selected Interacting proteins for GNPTG (Q9UJJ93 ENSP000002046794) via UniProtKB, MINT, STRING, and/or I2D (see all 15)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    UPF1Q929003, ENSP000002628034I2D: score=2 STRING: ENSP00000262803
    GNPTABQ3T9063, ENSP000002993144I2D: score=1 STRING: ENSP00000299314
    EFEMP2O959673I2D: score=1 
    NACAENSP000004038174STRING: ENSP00000403817
    BTF3ENSP000003699654STRING: ENSP00000369965
    About this table

    Gene Ontology (GO): 2 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0016256N-glycan processing to lysosome IEA--
    GO:0046835carbohydrate phosphorylation IDA19955174

    GNPTG for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for GNPTG

    2 Novoseek inferred chemical compound relationships for GNPTG gene    About this table
    Compound   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    mannose 6-phosphate 87.2 1 15532026 (1)
    n-acetylglucosamine 50.9 1 16835905 (1)



    GNPTG for compounds           About GeneDecksing



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for GNPTG gene: 
    NM_032520.4  

    Unigene Cluster for GNPTG:

    N-acetylglucosamine-1-phosphate transferase, gamma subunit
    Hs.241575  [show with all ESTs]
    Unigene Representative Sequence: AK126110
    9 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000204679(uc002clm.3) ENST00000526820 ENST00000527876 ENST00000529957
    ENST00000534197 ENST00000527137 ENST00000527168 ENST00000529110 ENST00000527076


    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat GNPTG using miScript Target Protectors
    7 qRT-PCR Assays for microRNAs that regulate GNPTG:
    hsa-miR-374a* hsa-miR-299-5p hsa-miR-625* hsa-miR-1179 hsa-miR-491-3p hsa-miR-106a* hsa-miR-490-5p
    SwitchGear 3'UTR luciferase reporter plasmidGNPTG 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for GNPTG
    Predesigned siRNA for gene silencing in human, mouse, rat GNPTG
    Clone
    Products:
         
    OriGene clones in human, mouse for GNPTG (see all 6)
    OriGene ORF clones in mouse, rat for GNPTG
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: GNPTG (NM_032520)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for GNPTG
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat GNPTG
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for GNPTG
    OriGene qSTAR qPCR primer pairs in human, mouse for GNPTG
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat GNPTG
      QuantiTect SYBR Green Assays in human, mouse, rat GNPTG
      QuantiFast Probe-based Assays in human, mouse, rat GNPTG

    Additional mRNA sequence: 

    AF302786.1 AK126110.1 AK312067.1 AY203933.1 BC014592.1 BC131525.1 

    10 DOTS entries:

    DT.100798639  DT.316570  DT.101979057  DT.95321776  DT.91772592  DT.100730054  DT.120662122  DT.95108105 
    DT.97778974  DT.120662091 

    Selected AceView cDNA sequences (see all 248):

    AI244946 AI201747 BF915129 CD671181 BM680459 AI382011 AI797519 BG741763 
    BM809281 AI762549 BP375124 CA418865 AA731862 AI797790 BM424068 CD367211 
    BF222389 AL047844 BM704576 BI870030 AA905637 BQ000899 CR597542 AI224610 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for GNPTG (see all 8)    About this scheme

    ExUns: 1a · 1b · 1c ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b · 6c ^ 7 ^ 8 ^ 9a · 9b · 9c ^ 10 ^ 11 ^ 12 ^ 13
    SP1:                                -     -     -     -     -                                   -                           
    SP2:                                -     -     -     -     -     -                             -                           
    SP3:                                -     -     -     -     -                                                               
    SP4:                                -     -     -     -     -     -                                                         
    SP5:                                -                                                                                       


    ECgene alternative splicing isoforms for GNPTG

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    GNPTG expression in normal human tissues (normalized intensities)      GNPTG embryonic expression: see
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: AATTCTGTAA
    GNPTG Expression
    About this image


    GNPTG expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 9) fully expand
     
     Brain (Nervous System)    fully expand to see all 4 entries
             Cerebral Cortex
     
     Ovary (Reproductive System)    fully expand to see all 2 entries
             Ovarian Mesenchymal Stroma Cells Ovary Interstitium
             Oviduct
     
     Bone (Muscoskeletal System)
             Bone Marrow
     
     Trophoblast (Extraembryonic Tissues)
             Trophoblast Cells Trophoblast
     
     Testis (Reproductive System)
             Leydig Cells Testis Interstitium
    GNPTG Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    GNPTG Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.241575

    UniProtKB/Swiss-Prot: GNPTG_HUMAN, Q9UJJ9
    Tissue specificity: Widely expressed

        Pathway & Disease-focused RT2 Profiler PCR Array including GNPTG: 
              Glycosylation in human mouse rat

    Primer
    Products:
    OriGene qPCR primer pairs and template standards for GNPTG
    OriGene qSTAR qPCR primer pairs in human, mouse for GNPTG
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat GNPTG
    QuantiTect SYBR Green Assays in human, mouse, rat GNPTG
    QuantiFast Probe-based Assays in human, mouse, rat GNPTG
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for GNPTG

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of chordates.

    Orthologs for GNPTG gene from Selected species (see all 13)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Gnptg1 , 5 N-acetylglucosamine-1-phosphotransferase, gamma subunit1, 5 81.67(n)1
    80.71(a)1
      17 (12.53 cM)5
    2145051  NM_172529.31  NP_766117.21 
     252343175 
    chicken
    (Gallus gallus)
    Aves GNPTG1 N-acetylglucosamine-1-phosphate transferase, gamma more 65.94(n)
    68.36(a)
      416591  NM_001277566.1  NP_001264495.1 
    lizard
    (Anolis carolinensis)
    Reptilia GNPTG6
    N-acetylglucosamine-1-phosphate transferase, gamma...
    57(a)
    1 ↔ 1
    GL343612.1(266248-277322)
    African clawed frog
    (Xenopus laevis)
    Amphibia Xl.154342 Xenopus laevis transcribed sequence with moderate similarity more 75.38(n)    BX842736.1 
    zebrafish
    (Danio rerio)
    Actinopterygii wufc67g112 Transcribed sequence with weak similarity to protein more 72.16(n)    BM102925.1 


    ENSEMBL Gene Tree for GNPTG (if available)
    TreeFam Gene Tree for GNPTG (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for GNPTG gene
    1 SIMAP similar gene for GNPTG using alignment to 4 protein entries:     GNPTG_HUMAN (see all proteins):
    RJD9

    GNPTG for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for GNPTG (see all 494)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    VAR_0708164
    Mucolipidosis type III complementation group C (MLIIIC)4--see VAR_0708162 C Y mis40--------
    rs1378528851,2
    Cpathogenic11347450(+) TCCTCA/GGGTGA 2 S G mis10--------
    rs1378528841,2
    Cpathogenic11347549(+) GAGTGA/GGAGAT 2 * W stg10--------
    rs1933028521,2
    Cpathogenic11348029(+) CCCCA-/C/GGGTAA 2 Q HG fra10--------
    rs1933028601,2
    Cpathogenic11348526(+) CGAGAC/TGCCCA 2 T M mis10--------
    rs1411189291,2
    C--1335272(+) GAATC-/TGCGGGCGGGGGTCTGCGGG
    CGGGAGTGTGCGGGCGAGAGTG
    TGCGG
    1 -- int10--------
    rs1848866351,2
    --1335348(+) GCGGGC/TGGCGG 1 -- int10--------
    rs1901835651,2
    --1335351(+) GGTGGC/GGGTCT 1 -- int10--------
    rs1828208171,2
    --1335359(+) TCTGCA/GGGCAG 1 -- int10--------
    rs1391364811,2
    C--1335371(+) AGTCTC/GAGTGG 1 -- int10--------

    HapMap Linkage Disequilibrium report for GNPTG (1401900 - 1413352 bp)

    Structural Variations
         Database of Genomic Variants (DGV) Selected variations for GNPTG (see all 21):    About this table    
    Variant IDTypeSubtypePubMed ID
    esv2660383CNV Deletion23128226
    esv2750327CNV Deletion23290073
    esv2750332CNV Deletion23290073
    esv2750331CNV Deletion23290073
    esv2750328CNV Deletion23290073
    esv2750330CNV Deletion23290073
    esv2750333CNV Deletion23290073
    esv2422427CNV Duplication17116639
    nsv904954CNV Loss21882294
    nsv904950CNV Loss21882294

    Human Gene Mutation Database (HGMD): GNPTG
    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing GNPTG
    DNA2.0 Custom Variant and Variant Library Synthesis for GNPTG

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 607838   
    OMIM disorders: 252605  
    UniProtKB/Swiss-Prot: GNPTG_HUMAN, Q9UJJ9
  • Mucolipidosis type III complementation group C (MLIIIC) [MIM:252605]: Autosomal recessive disease of
    lysosomal hydrolase trafficking. Unlike the related diseases, mucolipidosis II and IIIA, the enzyme affected in
    mucolipidosis IIIC (GlcNAc-phosphotransferase) retains full transferase activity on synthetic substrates but
    lacks activity on lysosomal hydrolases. Typical clinical findings include stiffness of the hands and shoulders,
    claw-hand deformity, scoliosis, short stature, coarse facies, and mild mental retardation. Radiographically,
    severe dysostosis multiplex of the hip is characteristic and frequently disabling. The clinical diagnosis can be
    confirmed by finding elevated serum lysosomal enzyme levels and/or decreased lysosomal enzyme levels in cultured
    fibroblasts. Note=The disease is caused by mutations affecting the gene represented in this entry

  • 18 diseases for GNPTG:    About MalaCards
    mucolipidosis iii gamma    mucolipidosis iii alpha/beta    mucolipidosis ii    mucolipidosis
    speech disorder    autosomal recessive disease    dysostosis    short stature
    tonsillitis    parkinson's disease    mental retardation    retinitis
    multiple myeloma    myeloma    cerebritis    thyroiditis
    endotheliitis    prostatitis

    2 diseases from the University of Copenhagen DISEASES database for GNPTG:
    Mucolipidosis     Speech disorder

    GNPTG for disorders           About GeneDecksing


    Congresses - knowledge worth sharing:
    Alzheimer's & Parkinson's Diseases Congress (ADPD) 18 - 22 March 2015

    2 Novoseek inferred disease relationships for GNPTG gene    About this table

    Disease   -log (P-Val)   Hits   PubMed IDs for Articles with Shared Sentences (# sentences)
    mucolipidosis iii 98.5 11 15532026 (2), 20034096 (1), 15060128 (1), 19370764 (1)
    i-cell disease 94.5 6 19659762 (2), 16116615 (2), 16835905 (1), 19938078 (1)


    Export disorders for GNPTG gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for GNPTG gene, integrated from 10 sources (see all 33):
    (articles sorted by number of sources associating them with GNPTG)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Molecular basis of variant pseudo-Hurler polydystrophy (mucolipidosis IIIC). (PubMed id 10712439)1, 2, 3 Raas-Rothschild A....Canfield W.M. (J. Clin. Invest. 2000)
    2. Large-scale cDNA transfection screening for genes related to cancer development and progression. (PubMed id 15498874)1, 2 Wan D....Gu J. (Proc. Natl. Acad. Sci. U.S.A. 2004)
    3. The sequence and analysis of duplication-rich human chromosome 16. (PubMed id 15616553)1, 2 Martin J.... Pennacchio L.A. (Nature 2004)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    5. Identification and molecular characterization of six novel mutations in the UDP-N-acetylglucosamine-1-phosphotransferase gamma subunit (GNPTG) gene in patients with mucolipidosis III gamma. (PubMed id 19370764)1, 9 Persichetti E....Beccari T. (Hum. Mutat. 2009)
    6. Molecular analysis of the GNPTAB and GNPTG genes in 13 patients with mucolipidosis type II or type III - identification of eight novel mutations. (PubMed id 19659762)1, 9 EncarnaAsALo M....Alves S. (Clin. Genet. 2009)
    7. Loss of N-acetylglucosamine-1-phosphotransferase gamma subunit due to intronic mutation in GNPTG causes mucolipidosis type III gamma: Implications for molecular and cellular diagnostics. (PubMed id 20034096)1, 9 Pohl S....Braulke T. (Am. J. Med. Genet. A 2010)
    8. Mutations in the lysosomal enzyme-targeting pathway and persistent stuttering. (PubMed id 20147709)1, 9 Kang C....Drayna D. (N. Engl. J. Med. 2010)
    9. Pathway Analysis of ChIP-Seq-Based NRF1 Target Genes Suggests a Logical Hypothesis of their Involvement in the Pathogenesis of Neurodegenerative Diseases. (PubMed id 24250222)1 Satoh J....Yamamoto Y. (Gene Regul Syst Bio 2013)
    10. A role for inherited metabolic deficits in persistent developmental stuttering. (PubMed id 22884963)1 Kang C. and Drayna D. (Mol. Genet. Metab. 2012)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Disorders
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 84572 HGNC: 23026 AceView: GNPTG Ensembl:ENSG00000090581 euGenes: HUgn84572
    ECgene: GNPTG Kegg: 84572 H-InvDB: GNPTG

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for GNPTG Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for GNPTG gene:
    Search GeneIP for patents involving GNPTG

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     Browse OriGene Antibodies   OriGene RNAi products in human, mouse, rat for GNPTG  
     OriGene qPCR primer pairs and template standards for GNPTG   OriGene Protein Over-expression Lysate for GNPTG  
     OriGene MassSpec something-or-other for GNPTG   OriGene clones in human, mouse for GNPTG  
     OriGene qSTAR qPCR primer pairs in human, mouse for GNPTG   OriGene Purified Protein for GNPTG  
     OriGene ORF clones in mouse, rat for GNPTG   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for GNPTG   OriGene Custom Protein Services for GNPTG  

     
     
     Block miRNA regulation of human, mouse, rat GNPTG using miScript Target Protectors SeqTarget long-range PCR primers for resequencing GNPTG
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat GNPTG Predesigned siRNA for gene silencing in human, mouse, rat GNPTG
     QuantiFast Probe-based Assays in human, mouse, rat GNPTG QuantiTect SYBR Green Assays in human, mouse, rat GNPTG
     PCR Arrays including human, mouse, rat GNPTG Search Chromatin IP Primers for GNPTG
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat GNPTG  Search GeneGlobe Interaction Network for GNPTG
     Regulatory tfbs in GNPTG promoter
     GenScript Custom Purified and Recombinant Proteins Services for GNPTG GenScript cDNA clones with any tag delivered in your preferred vector for GNPTG
     GenScript Custom Assay Services for GNPTG GenScript Custom overexpressing Cell Line Services for GNPTG
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for GNPTG
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for GNPTG
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     GNPTG antibodies
     GNPTG proteins
     GNPTG lysates
     Search for Antibodies for GNPTG at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for GNPTG
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Browse Proteins at Cloud-Clone Corp.
     Browse Antibodies at Cloud-Clone Corp.
     Browse ELISAs at Cloud-Clone Corp.
     Browse CLIAs at Cloud-Clone Corp.



     Browse ESI BIO Cell Lines and PureStem Progenitors for GNPTG
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for GNPTG
     SwitchGear 3'UTR luciferase reporter plasmids for GNPTG
     SwitchGear Promoter luciferase reporter plasmids for GNPTG
     Search ThermoFisher Antibodies for GNPTG
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat GNPTG
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for GNPTG
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for GNPTG
     LSBio Antibodies in human, mouse, rat for GNPTG
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      GNPTG gene at Home site.
    Version: 3.12.136 22 July 2014
    hostname: 356977-web1.xennexinc.com index build: 126 solr: 1.4