Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GNAT3 Gene

Aliases for GNAT3 Gene

  • G Protein Subunit Alpha Transducin 3 2 3 5
  • Guanine Nucleotide Binding Protein, Alpha Transducing 3 2 3
  • Gustducin Alpha-3 Chain 3 4
  • Guanine Nucleotide-Binding Protein G(T) Subunit Alpha-3 3
  • Gustducin, Alpha Polypeptide 3
  • Gustatory G Protein 3
  • GDCA 3

External Ids for GNAT3 Gene

Previous GeneCards Identifiers for GNAT3 Gene

  • GC07M079700
  • GC07M079732
  • GC07M079925
  • GC07M080087
  • GC07M074691

Summaries for GNAT3 Gene

Entrez Gene Summary for GNAT3 Gene

  • Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome. [provided by RefSeq, Dec 2015]

GeneCards Summary for GNAT3 Gene

GNAT3 (G Protein Subunit Alpha Transducin 3) is a Protein Coding gene. Among its related pathways are Incretin synthesis, secretion, and inactivation and Chaperonin-mediated protein folding. GO annotations related to this gene include GTP binding and signal transducer activity. An important paralog of this gene is GNAT2.

UniProtKB/Swiss-Prot for GNAT3 Gene

  • Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction. Transduction by this alpha subunit involves coupling of specific cell-surface receptors with a cGMP-phosphodiesterase; Activation of phosphodiesterase lowers intracellular levels of cAMP and cGMP which may open a cyclic nucleotide-suppressible cation channel leading to influx of calcium, ultimately leading to release of neurotransmitter. Indeed, denatonium and strychnine induce transient reduction in cAMP and cGMP in taste tissue, whereas this decrease is inhibited by GNAT3 antibody. Gustducin heterotrimer transduces response to bitter and sweet compounds via regulation of phosphodiesterase for alpha subunit, as well as via activation of phospholipase C for beta and gamma subunits, with ultimate increase inositol trisphosphate and increase of intracellular Calcium. GNAT3 can functionally couple to taste receptors to transmit intracellular signal: receptor heterodimer TAS1R2/TAS1R3 senses sweetness and TAS1R1/TAS1R3 transduces umami taste, whereas the T2R family GPCRs act as bitter sensors. Functions also as lumenal sugar sensors in the gut to control the expression of the Na+-glucose transporter SGLT1 in response to dietaty sugar, as well as the secretion of Glucagon-like peptide-1, GLP-1 and glucose-dependent insulinotropic polypeptide, GIP. Thus, may modulate the gut capacity to absorb sugars, with implications in malabsorption syndromes and diet-related disorders including diabetes and obesity.

Tocris Summary for GNAT3 Gene

  • Heterotrimeric G proteins are membrane bound GTPases that are linked to 7-TM receptors. Each G protein contains an alpha-, beta- and gamma-subunit and is bound to GDP in the 'off' state. Ligand binding causes a receptor conformational change, detaching the G protein and switching it 'on'.

Gene Wiki entry for GNAT3 Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GNAT3 Gene

Genomics for GNAT3 Gene

Regulatory Elements for GNAT3 Gene

Enhancers for GNAT3 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH07G080880 1.5 Ensembl ENCODE dbSUPER 4.9 -355.4 -355413 5.5 PKNOX1 ARNT SIN3A FEZF1 ZNF2 FOS SP3 ZHX2 TSHZ1 ZNF592 SEMA3C GNAT3 GC07P080753
GH07G080479 0.9 Ensembl ENCODE 6.9 +47.1 47119 3.3 STAT1 MAZ RFX1 TEAD4 CEBPB KLF4 DPF2 EP300 MBD2 CTBP1 CD36 GNAT3 ENSG00000232667
GH07G080872 1 ENCODE dbSUPER 5.2 -346.0 -345981 1.9 PKNOX1 FEZF1 ZNF697 HIC1 CTBP1 GATA3 ZNF366 KLF7 TCF7L2 ZNF687 SEMA3C GNAT3 GC07P080753
GH07G080856 1 ENCODE dbSUPER 4.8 -330.6 -330578 3.4 SIN3A GATA3 SCRT2 FOS MIXL1 ZNF263 ZNF362 MTA2 CEBPB ZHX2 GNAT3 CD36 SEMA3C GC07P080753
GH07G080900 0.8 ENCODE dbSUPER 5.1 -374.0 -374020 3.2 ZNF664 JUND JUN JUNB ZNF600 FOS ATF2 SEMA3C GNAT3 GC07P080753
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around GNAT3 on UCSC Golden Path with GeneCards custom track

Genomic Location for GNAT3 Gene

80,457,292 bp from pter
80,527,915 bp from pter
70,624 bases
Minus strand

Genomic View for GNAT3 Gene

Genes around GNAT3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GNAT3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GNAT3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GNAT3 Gene

Proteins for GNAT3 Gene

  • Protein details for GNAT3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Guanine nucleotide-binding protein G(t) subunit alpha-3
    Protein Accession:
    Secondary Accessions:
    • A4D1B2
    • A4D1B3
    • B9EJG5

    Protein attributes for GNAT3 Gene

    354 amino acids
    Molecular mass:
    40357 Da
    Quaternary structure:
    • G proteins are composed of 3 units; alpha, beta and gamma, respectively GNAT3, GNB1 and GNG13 for Gustducin heterotrimer for bitter taste transduction. The alpha chain contains the guanine nucleotide binding site. Gustducin heterotrimer may also be composed of GNAT3, GNB3 and GNG13.
    • Sequence=EAL24192.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=EAL24193.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

neXtProt entry for GNAT3 Gene

Post-translational modifications for GNAT3 Gene

  • Potential N-myristoylation may anchor alpha-subunit to the inner surface of plasma membrane.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GNAT3 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for GNAT3 Gene

Domains & Families for GNAT3 Gene

Gene Families for GNAT3 Gene

Protein Domains for GNAT3 Gene

Suggested Antigen Peptide Sequences for GNAT3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the G-alpha family. G(i/o/t/z) subfamily.
  • Belongs to the G-alpha family. G(i/o/t/z) subfamily.
genes like me logo Genes that share domains with GNAT3: view

Function for GNAT3 Gene

Molecular function for GNAT3 Gene

UniProtKB/Swiss-Prot Function:
Guanine nucleotide-binding protein (G protein) alpha subunit playing a prominent role in bitter and sweet taste transduction as well as in umami (monosodium glutamate, monopotassium glutamate, and inosine monophosphate) taste transduction. Transduction by this alpha subunit involves coupling of specific cell-surface receptors with a cGMP-phosphodiesterase; Activation of phosphodiesterase lowers intracellular levels of cAMP and cGMP which may open a cyclic nucleotide-suppressible cation channel leading to influx of calcium, ultimately leading to release of neurotransmitter. Indeed, denatonium and strychnine induce transient reduction in cAMP and cGMP in taste tissue, whereas this decrease is inhibited by GNAT3 antibody. Gustducin heterotrimer transduces response to bitter and sweet compounds via regulation of phosphodiesterase for alpha subunit, as well as via activation of phospholipase C for beta and gamma subunits, with ultimate increase inositol trisphosphate and increase of intracellular Calcium. GNAT3 can functionally couple to taste receptors to transmit intracellular signal: receptor heterodimer TAS1R2/TAS1R3 senses sweetness and TAS1R1/TAS1R3 transduces umami taste, whereas the T2R family GPCRs act as bitter sensors. Functions also as lumenal sugar sensors in the gut to control the expression of the Na+-glucose transporter SGLT1 in response to dietaty sugar, as well as the secretion of Glucagon-like peptide-1, GLP-1 and glucose-dependent insulinotropic polypeptide, GIP. Thus, may modulate the gut capacity to absorb sugars, with implications in malabsorption syndromes and diet-related disorders including diabetes and obesity.

Gene Ontology (GO) - Molecular Function for GNAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001664 G-protein coupled receptor binding IBA --
GO:0003924 GTPase activity IBA,TAS --
GO:0004871 signal transducer activity IBA --
GO:0005525 GTP binding TAS,IEA --
GO:0019001 guanyl nucleotide binding IEA --
genes like me logo Genes that share ontologies with GNAT3: view

Phenotypes for GNAT3 Gene

genes like me logo Genes that share phenotypes with GNAT3: view

Animal Models for GNAT3 Gene

MGI Knock Outs for GNAT3:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , miRNA , Transcription Factor Targets and HOMER Transcription for GNAT3 Gene

Localization for GNAT3 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GNAT3 Gene

Cytoplasm. Note=Dual ditribution pattern; plasmalemmal pattern with apical region localization and cytosolic pattern with localization throughout the cytoplasm.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GNAT3 gene
Compartment Confidence
plasma membrane 5
cytoskeleton 3
cytosol 3
mitochondrion 2
extracellular 1
peroxisome 1
nucleus 1
golgi apparatus 1

Gene Ontology (GO) - Cellular Components for GNAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001669 acrosomal vesicle IEA --
GO:0001750 photoreceptor outer segment IBA --
GO:0001917 photoreceptor inner segment IBA --
GO:0005737 cytoplasm IEA --
GO:0005834 heterotrimeric G-protein complex IBA --
genes like me logo Genes that share ontologies with GNAT3: view

Pathways & Interactions for GNAT3 Gene

genes like me logo Genes that share pathways with GNAT3: view

Gene Ontology (GO) - Biological Process for GNAT3 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001580 detection of chemical stimulus involved in sensory perception of bitter taste IBA --
GO:0006457 protein folding TAS --
GO:0007165 signal transduction IEA --
GO:0007186 G-protein coupled receptor signaling pathway IEA --
GO:0007188 adenylate cyclase-modulating G-protein coupled receptor signaling pathway IBA,IEA --
genes like me logo Genes that share ontologies with GNAT3: view

No data available for SIGNOR curated interactions for GNAT3 Gene

Drugs & Compounds for GNAT3 Gene

(2) Drugs for GNAT3 Gene - From: HMDB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
cyclic amp Experimental Pharma 0
calcium Nutra 0

(5) Additional Compounds for GNAT3 Gene - From: Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
8-Bromo-cGMP, sodium salt
G-Protein antagonist peptide
Pertussis Toxin

(5) Tocris Compounds for GNAT3 Gene

Compound Action Cas Number
8-Bromo-cGMP, sodium salt cGMP analog; activates PKG 51116-01-9
CMPD101 Potent and selective GRK2/3 inhibitor 865608-11-3
Gallein Inhibitor of betagamma signaling 2103-64-2
G-Protein antagonist peptide Inhibits G protein activation by GPCRs 143675-79-0
Pertussis Toxin Catalyzes ADP-ribosylation of Gi, Go and Gt 70323-44-3
genes like me logo Genes that share compounds with GNAT3: view

Transcripts for GNAT3 Gene

mRNA/cDNA for GNAT3 Gene

(2) REFSEQ mRNAs :
(2) Additional mRNA sequences :
(1) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for GNAT3 Gene

Guanine nucleotide binding protein, alpha transducing 3:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for GNAT3 Gene

No ASD Table

Relevant External Links for GNAT3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GNAT3 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GNAT3 Gene

mRNA differential expression in normal tissues according to GTEx for GNAT3 Gene

This gene is overexpressed in Small Intestine - Terminal Ileum (x13.7), Adipose - Visceral (Omentum) (x12.5), Testis (x10.6), and Thyroid (x6.1).

Protein differential expression in normal tissues from HIPED for GNAT3 Gene

This gene is overexpressed in Urinary Bladder (50.2) and Brain (12.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for GNAT3 Gene

Protein tissue co-expression partners for GNAT3 Gene

NURSA nuclear receptor signaling pathways regulating expression of GNAT3 Gene:


SOURCE GeneReport for Unigene cluster for GNAT3 Gene:


mRNA Expression by UniProt/SwissProt for GNAT3 Gene:

Tissue specificity: Expressed in taste buds (sensory organs of clustered epithelial cells) of the circumvallate and foliate papillae of the tongue at protein level. Expressed in enteroendocrine L cells of the gut. Detected also in spermatozoa.
genes like me logo Genes that share expression patterns with GNAT3: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GNAT3 Gene

Orthologs for GNAT3 Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for GNAT3 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia GNAT3 34 35
  • 99.72 (n)
(Monodelphis domestica)
Mammalia GNAT3 35
  • 94 (a)
(Bos Taurus)
Mammalia GNAT3 34 35
  • 93.03 (n)
(Canis familiaris)
Mammalia GNAT3 34 35
  • 92.18 (n)
(Rattus norvegicus)
Mammalia Gnat3 34
  • 88.42 (n)
(Mus musculus)
Mammalia Gnat3 16 35 34
  • 88.04 (n)
(Ornithorhynchus anatinus)
Mammalia GNAT3 35
  • 88 (a)
(Gallus gallus)
Aves GNAT3 34 35
  • 78.63 (n)
(Anolis carolinensis)
Reptilia GNAT3 35
  • 85 (a)
(Danio rerio)
Actinopterygii gnao1b 35
  • 60 (a)
fruit fly
(Drosophila melanogaster)
Insecta G-oalpha47A 35
  • 58 (a)
(Caenorhabditis elegans)
Secernentea goa-1 35
  • 56 (a)
thale cress
(Arabidopsis thaliana)
eudicotyledons GP ALPHA 1 34
  • 51.34 (n)
(Oryza sativa)
Liliopsida Os05g0333200 34
  • 52.96 (n)
Species where no ortholog for GNAT3 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for GNAT3 Gene

Gene Tree for GNAT3 (if available)
Gene Tree for GNAT3 (if available)

Paralogs for GNAT3 Gene

Paralogs for GNAT3 Gene

(19) SIMAP similar genes for GNAT3 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with GNAT3: view

Variants for GNAT3 Gene

Sequence variations from dbSNP and Humsavar for GNAT3 Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type
rs1000054545 -- 80,491,301(+) AGAGG(A/C/T)CAGAT intron-variant
rs1000097961 -- 80,475,946(+) TATTG(C/G)AAAAA intron-variant
rs1000133611 -- 80,479,705(+) GACCC(C/T)GTCTC intron-variant
rs1000208146 -- 80,482,466(+) TTCTT(-/ATTTTCTTTTTCTTTTTTCTTTC)TTTTT intron-variant
rs1000215055 -- 80,467,428(+) CAAAT(C/T)AGATC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for GNAT3 Gene

Variant ID Type Subtype PubMed ID
dgv1305e214 CNV loss 21293372
esv2734733 CNV deletion 23290073
esv2734734 CNV deletion 23290073
esv2734735 CNV deletion 23290073
esv2734736 CNV deletion 23290073
esv3363 CNV loss 18987735
esv3613860 CNV loss 21293372
esv3613861 CNV loss 21293372
nsv365325 CNV deletion 16902084
nsv464604 CNV loss 19166990
nsv607680 CNV loss 21841781
nsv607681 CNV loss 21841781
nsv831042 CNV gain 17160897
nsv831043 CNV loss 17160897

Variation tolerance for GNAT3 Gene

Residual Variation Intolerance Score: 63.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.11; 38.46% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for GNAT3 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GNAT3 Gene

Disorders for GNAT3 Gene

Relevant External Links for GNAT3

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for GNAT3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GNAT3 Gene

Publications for GNAT3 Gene

  1. Gut-expressed gustducin and taste receptors regulate secretion of glucagon-like peptide-1. (PMID: 17724330) Jang H.-J. … Egan J.M. (Proc. Natl. Acad. Sci. U.S.A. 2007) 3 4 22 64
  2. Colocalization of the alpha-subunit of gustducin with PYY and GLP-1 in L cells of human colon. (PMID: 16728727) Rozengurt N. … Rozengurt E. (Am. J. Physiol. 2006) 3 4 22 64
  3. Taste genes associated with dental caries. (PMID: 20858777) Wendell S. … Marazita M.L. (J. Dent. Res. 2010) 3 46 64
  4. Expression of the G-protein alpha-subunit gustducin in mammalian spermatozoa. (PMID: 17021831) Fehr J. … Boekhoff I. (J. Comp. Physiol. A 2007) 3 4 64
  5. T1R3 and gustducin in gut sense sugars to regulate expression of Na+- glucose cotransporter 1. (PMID: 17724332) Margolskee R.F. … Shirazi-Beechey S.P. (Proc. Natl. Acad. Sci. U.S.A. 2007) 3 4 64

Products for GNAT3 Gene

Sources for GNAT3 Gene

Loading form....