Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GLCCI1 Gene

Aliases for GLCCI1 Gene

  • Glucocorticoid Induced 1 2 3 5
  • Glucocorticoid Induced Transcript 1 2 3
  • Glucocorticoid-Induced Transcript 1 Protein 3
  • FAM117C 3
  • GIG18 3
  • TSSN1 3
  • GCTR 3

External Ids for GLCCI1 Gene

Previous GeneCards Identifiers for GLCCI1 Gene

  • GC07P007653
  • GC07P007423
  • GC07P007752
  • GC07P007781

Summaries for GLCCI1 Gene

Entrez Gene Summary for GLCCI1 Gene

  • This gene encodes a protein of unknown function. Expression of this gene is induced by glucocorticoids and may be an early marker for glucocorticoid-induced apoptosis. Single nucleotide polymorphisms in this gene are associated with a decreased response to inhaled glucocorticoids in asthmatic patients. [provided by RefSeq, Feb 2012]

GeneCards Summary for GLCCI1 Gene

GLCCI1 (Glucocorticoid Induced 1) is a Protein Coding gene. Diseases associated with GLCCI1 include Glucocorticoid Therapy, Response To and Ichthyosis, Congenital, Autosomal Recessive 11. An important paralog of this gene is FAM117B.

Gene Wiki entry for GLCCI1 Gene

No data available for CIViC summary , UniProtKB/Swiss-Prot , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GLCCI1 Gene

Genomics for GLCCI1 Gene

Regulatory Elements for GLCCI1 Gene

Enhancers for GLCCI1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH07G007943 1.4 FANTOM5 Ensembl ENCODE 15.6 -23.6 -23602 2.9 HDGF PKNOX1 TBL1XR1 BMI1 EGR1 CBX5 ELK1 RELB ETV6 IKZF2 ENSG00000234141 GLCCI1 LOC100505921 PIR33188
GH07G008124 1.8 FANTOM5 Ensembl ENCODE dbSUPER 9.5 +158.3 158341 5.3 HDGF TBP PKNOX1 FOXA2 TBL1XR1 WRNIP1 RAD21 ZBTB40 YY1 GATA2 GLCCI1 ENSG00000227719 GC07P008190
GH07G007867 1 Ensembl ENCODE 16.6 -100.3 -100294 1.7 HDAC1 SMARCE1 L3MBTL2 CEBPB REST CEBPG ZEB2 ARID1B EED ZSCAN5C GLCCI1 UMAD1 LOC100505921 RNU6-534P ENSG00000234718
GH07G008130 1.8 FANTOM5 Ensembl ENCODE dbSUPER 8.3 +164.2 164215 5.7 HDGF PKNOX1 ATF1 WRNIP1 ZFP64 YBX1 TCF12 ZNF766 GATA2 ZNF207 GLCCI1 ENSG00000227719 GC07P008190
GH07G007860 0.8 ENCODE 16.1 -107.2 -107176 1.3 FOXA2 RAD21 RARA YY1 GATA2 FOS CEBPB NR2F2 PRDM6 CEBPA GLCCI1 LOC100505921 RNU6-534P ENSG00000234718
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around GLCCI1 on UCSC Golden Path with GeneCards custom track

Promoters for GLCCI1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000324743 757 3401 HDGF PKNOX1 ZFP64 WRNIP1 ARID4B SIN3A ZNF2 YY1 SLC30A9 ZNF143

Genomic Location for GLCCI1 Gene

7,968,743 bp from pter
8,094,272 bp from pter
125,530 bases
Plus strand

Genomic View for GLCCI1 Gene

Genes around GLCCI1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GLCCI1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GLCCI1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GLCCI1 Gene

Proteins for GLCCI1 Gene

  • Protein details for GLCCI1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Glucocorticoid-induced transcript 1 protein
    Protein Accession:
    Secondary Accessions:
    • A4D103
    • Q96FD0

    Protein attributes for GLCCI1 Gene

    547 amino acids
    Molecular mass:
    58024 Da
    Quaternary structure:
    No Data Available

neXtProt entry for GLCCI1 Gene

Post-translational modifications for GLCCI1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GLCCI1 Gene

No data available for DME Specific Peptides for GLCCI1 Gene

Domains & Families for GLCCI1 Gene

Protein Domains for GLCCI1 Gene


Suggested Antigen Peptide Sequences for GLCCI1 Gene

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with GLCCI1: view

No data available for Gene Families and UniProtKB/Swiss-Prot for GLCCI1 Gene

Function for GLCCI1 Gene

genes like me logo Genes that share phenotypes with GLCCI1: view

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for GLCCI1 Gene

Localization for GLCCI1 Gene

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GLCCI1 gene
Compartment Confidence
nucleus 4
cytosol 2
golgi apparatus 2

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for GLCCI1 Gene

Pathways & Interactions for GLCCI1 Gene

SuperPathways for GLCCI1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for GLCCI1 Gene


No data available for Pathways by source and SIGNOR curated interactions for GLCCI1 Gene

Drugs & Compounds for GLCCI1 Gene

(6) Drugs for GLCCI1 Gene - From: PharmGKB

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Budesonide Approved Pharma Anti-inflammatory corticosteroid 432
Flunisolide Approved, Investigational Pharma 6
Fluticasone propionate Approved Pharma Selective high affinity glucocorticoid receptor agonist 0
Nedocromil Approved Pharma 5
Triamcinolone Approved, Vet_approved Pharma Agonist 510
genes like me logo Genes that share compounds with GLCCI1: view

Transcripts for GLCCI1 Gene

Unigene Clusters for GLCCI1 Gene

Glucocorticoid induced transcript 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for GLCCI1 Gene

ExUns: 1a · 1b ^ 2 ^ 3a · 3b · 3c ^ 4a · 4b ^ 5 ^ 6 ^ 7 ^ 8 ^ 9a · 9b ^ 10 ^ 11a · 11b ^ 12a · 12b
SP1: - - - - - - -
SP2: -
SP3: -
SP4: -
SP5: - - -

Relevant External Links for GLCCI1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GLCCI1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GLCCI1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for GLCCI1 Gene

This gene is overexpressed in Pancreatic juice (32.2), Peripheral blood mononuclear cells (9.1), Frontal cortex (8.2), and CD8 Tcells (6.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for GLCCI1 Gene

Protein tissue co-expression partners for GLCCI1 Gene

NURSA nuclear receptor signaling pathways regulating expression of GLCCI1 Gene:


SOURCE GeneReport for Unigene cluster for GLCCI1 Gene:


mRNA Expression by UniProt/SwissProt for GLCCI1 Gene:

Tissue specificity: Predominantly expressed in lung, spleen, thymus and testis and, at lower levels, in brain, bone marrow, peripheral leukocytes, skin and trachea.
genes like me logo Genes that share expression patterns with GLCCI1: view

Primer Products

No data available for mRNA differential expression in normal tissues , Evidence on tissue expression from TISSUES and Phenotype-based relationships between genes and organs from Gene ORGANizer for GLCCI1 Gene

Orthologs for GLCCI1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for GLCCI1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia GLCCI1 34 35
  • 98.53 (n)
(Canis familiaris)
Mammalia GLCCI1 34 35
  • 93.19 (n)
(Bos Taurus)
Mammalia GLCCI1 34 35
  • 91.73 (n)
(Rattus norvegicus)
Mammalia Glcci1 34
  • 91.03 (n)
(Mus musculus)
Mammalia Glcci1 34 16 35
  • 89.37 (n)
(Monodelphis domestica)
Mammalia GLCCI1 35
  • 81 (a)
(Gallus gallus)
Aves GLCCI1 34 35
  • 81.01 (n)
(Anolis carolinensis)
Reptilia GLCCI1 35
  • 70 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia glcci1 34
  • 70.44 (n)
(Danio rerio)
Actinopterygii glcci1 34 35
  • 66.09 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CSA.5186 35
  • 28 (a)
Species where no ortholog for GLCCI1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GLCCI1 Gene

Gene Tree for GLCCI1 (if available)
Gene Tree for GLCCI1 (if available)

Paralogs for GLCCI1 Gene

Paralogs for GLCCI1 Gene

(2) SIMAP similar genes for GLCCI1 Gene using alignment to 8 proteins:

genes like me logo Genes that share paralogs with GLCCI1: view

Variants for GLCCI1 Gene

Polymorphic Variants from UniProtKB/Swiss-Prot for GLCCI1 Gene

Polymorphisms dbSNP:rs37972 and dbSNP:rs37973, located in GLCCI1 promoter region, are associated with a decreased response to glucorticoid treatment [MIM:614400] in asthma patients (PubMed:21991891), as well as in chronic obstructive pulmonary disease patients (PubMed:22187997). The mean increase in forced expiratory volume in 1 second in glucorticoid treated subjects who are homozygous for the mutant (G) rs37973 allele is only about one-third of that seen in similarly treated subjects who are homozygous for the wild-type allele (A) (PubMed:21991891). These polymorphisms affect GLCCI1 transcription level.

Sequence variations from dbSNP and Humsavar for GLCCI1 Gene

SNP ID Clin Chr 07 pos Sequence Context AA Info Type
rs37973 drug-response 7,968,245(+) GTTCA(A/G)TGCAG intron-variant, upstream-variant-2KB
rs1000031220 -- 8,004,278(+) ACATC(A/G)GTCTA intron-variant
rs1000042849 -- 8,006,072(+) AGATT(A/T)CAGGC intron-variant
rs1000051214 -- 8,085,301(+) CTTAG(-/TTTAGATGGTAACAAAGAGAC)TTTAG intron-variant
rs1000078680 -- 8,039,866(+) GTAGC(A/G)GGCTC intron-variant

Structural Variations from Database of Genomic Variants (DGV) for GLCCI1 Gene

Variant ID Type Subtype PubMed ID
dgv6249n100 CNV gain 25217958
esv1009766 CNV deletion 20482838
esv2659380 CNV deletion 23128226
esv2752177 CNV gain 17911159
esv2761144 CNV gain+loss 21179565
esv3303324 CNV mobile element insertion 20981092
esv3309722 CNV mobile element insertion 20981092
esv3356892 CNV insertion 20981092
esv3394159 CNV insertion 20981092
esv3571615 CNV loss 25503493
esv3612101 CNV loss 21293372
nsv1030180 CNV loss 25217958
nsv1128299 CNV deletion 24896259
nsv518779 CNV loss 19592680
nsv519058 CNV loss 19592680
nsv5633 CNV insertion 18451855

Variation tolerance for GLCCI1 Gene

Residual Variation Intolerance Score: 15.5% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 1.80; 33.87% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for GLCCI1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

Disorders for GLCCI1 Gene

MalaCards: The human disease database

(3) MalaCards diseases for GLCCI1 Gene - From: OMIM, ClinVar, DISEASES, and GeneCards

Disorder Aliases PubMed IDs
glucocorticoid therapy, response to
ichthyosis, congenital, autosomal recessive 11
  • autosomal recessive congenital ichthyosis 11
  • asthma, protection against
- elite association - COSMIC cancer census association via MalaCards

Relevant External Links for GLCCI1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with GLCCI1: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GLCCI1 Gene

Publications for GLCCI1 Gene

  1. Genomewide association between GLCCI1 and response to glucocorticoid therapy in asthma. (PMID: 21991891) Tantisira K.G. … Weiss S.T. (N. Engl. J. Med. 2011) 3 4 64
  2. Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. (PMID: 17081983) Olsen J.V. … Mann M. (Cell 2006) 3 4 64
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 64
  4. Two genes, three messengers: hybrid transcript between a gene expressed at specific stages of T-cell and sperm maturation and an unrelated adjacent gene. (PMID: 12557054) Miazek A. … Malissen B. (Immunogenetics 2003) 3 4 64
  5. Human chromosome 7: DNA sequence and biology. (PMID: 12690205) Scherer S.W. … Tsui L.-C. (Science 2003) 3 4 64

Products for GLCCI1 Gene

Sources for GLCCI1 Gene

Loading form....