Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GCSH Gene

Aliases for GCSH Gene

  • Glycine Cleavage System Protein H (Aminomethyl Carrier) 2 3
  • Lipoic Acid-Containing Protein 2 3 4
  • NKH 3 6
  • Glycine Cleavage System H Protein, Mitochondrial 3
  • Mitochondrial Glycine Cleavage System H-Protein 3
  • GCE 3

External Ids for GCSH Gene

Previous GeneCards Identifiers for GCSH Gene

  • GC16M072048
  • GC16M082076
  • GC16M080854
  • GC01M165211
  • GC16M080896
  • GC16M079673
  • GC16M081115
  • GC16M066872

Summaries for GCSH Gene

Entrez Gene Summary for GCSH Gene

  • Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for this gene. Also, several transcribed and non-transcribed pseudogenes of this gene exist throughout the genome.[provided by RefSeq, Jan 2010]

GeneCards Summary for GCSH Gene

GCSH (Glycine Cleavage System Protein H (Aminomethyl Carrier)) is a Protein Coding gene. Diseases associated with GCSH include gcsh-related glycine encephalopathy and atypical glycine encephalopathy. Among its related pathways are Glycine, serine and threonine metabolism and Glyoxylate and dicarboxylate metabolism. GO annotations related to this gene include enzyme binding and aminomethyltransferase activity.

UniProtKB/Swiss-Prot for GCSH Gene

  • The glycine cleavage system catalyzes the degradation of glycine. The H protein (GCSH) shuttles the methylamine group of glycine from the P protein (GLDC) to the T protein (GCST)

Gene Wiki entry for GCSH Gene

No data available for Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GCSH Gene

Genomics for GCSH Gene

Regulatory Elements for GCSH Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for GCSH Gene

81,081,947 bp from pter
81,096,403 bp from pter
14,457 bases
Minus strand

Genomic View for GCSH Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for GCSH Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GCSH Gene

Proteins for GCSH Gene

  • Protein details for GCSH Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Glycine cleavage system H protein, mitochondrial
    Protein Accession:
    Secondary Accessions:
    • Q9H1E9

    Protein attributes for GCSH Gene

    173 amino acids
    Molecular mass:
    18885 Da
    Name=(R)-lipoate; Xref=ChEBI:CHEBI:83088; Note=Binds 1 lipoyl cofactor covalently.;
    Quaternary structure:
    • Interacts with GLDC (By similarity). The glycine cleavage system is composed of four proteins: P (GLDC), T (GCST), L (DLD) and H (GCSH).

neXtProt entry for GCSH Gene

Proteomics data for GCSH Gene at MOPED

Post-translational modifications for GCSH Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GCSH Gene

Antibody Products

No data available for DME Specific Peptides for GCSH Gene

Domains for GCSH Gene

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 lipoyl-binding domain.
  • Belongs to the GcvH family.
  • Contains 1 lipoyl-binding domain.
  • Belongs to the GcvH family.
genes like me logo Genes that share domains with GCSH: view

No data available for Gene Families for GCSH Gene

Function for GCSH Gene

Molecular function for GCSH Gene

UniProtKB/Swiss-Prot Function:
The glycine cleavage system catalyzes the degradation of glycine. The H protein (GCSH) shuttles the methylamine group of glycine from the P protein (GLDC) to the T protein (GCST)

Gene Ontology (GO) - Molecular Function for GCSH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004047 aminomethyltransferase activity IEA --
GO:0019899 enzyme binding IEA --
genes like me logo Genes that share ontologies with GCSH: view

Animal Model Products

miRNA for GCSH Gene

miRTarBase miRNAs that target GCSH

No data available for Enzyme Numbers (IUBMB) , Phenotypes , Animal Models , Transcription Factor Targets and HOMER Transcription for GCSH Gene

Localization for GCSH Gene

Subcellular locations from UniProtKB/Swiss-Prot for GCSH Gene


Subcellular locations from

Jensen Localization Image for GCSH Gene COMPARTMENTS Subcellular localization image for GCSH gene
Compartment Confidence
mitochondrion 5
extracellular 1
nucleus 1

Gene Ontology (GO) - Cellular Components for GCSH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005739 mitochondrion IEA --
GO:0005960 glycine cleavage complex IEA --
genes like me logo Genes that share ontologies with GCSH: view

Pathways for GCSH Gene

genes like me logo Genes that share pathways with GCSH: view

Pathways by source for GCSH Gene

Gene Ontology (GO) - Biological Process for GCSH Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006546 glycine catabolic process TAS 1671321
GO:0019464 glycine decarboxylation via glycine cleavage system IEA --
GO:0032259 methylation IEA --
genes like me logo Genes that share ontologies with GCSH: view

Drugs for GCSH Gene

(3) Drugbank Compounds for GCSH Gene

Compound Status Synonyms Cas Number PubChem ID Type Actions PubMed IDs
  • Aminoacetic acid
56-40-6 750 Target approved, nutraceutical
6-(Hydroxyethyldithio)-8-(Aminomethylthio)Octanoic Acid
6323459 Target experimental
Dihydrolipoic Acid
462-20-4 9834298 Target experimental

(9) HMDB Compounds for GCSH Gene

Compound Synonyms Cas Number PubMed IDs
(R)-lipoic acid
  • (+)-alpha-Lipoic acid
  • (6R)-5,10-methylenetetrahydrofolate
  • Ammonia anhydrous
Carbon dioxide
  • Carbon oxide
  • 2-Aminoacetate
genes like me logo Genes that share compounds with GCSH: view

Transcripts for GCSH Gene

Unigene Clusters for GCSH Gene

Glycine cleavage system protein H (aminomethyl carrier):
Representative Sequences:

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for GCSH

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for GCSH Gene

No ASD Table

Relevant External Links for GCSH Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GCSH Gene

mRNA expression in normal human tissues for GCSH Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues for GCSH Gene

This gene is overexpressed in Liver, secretome (23.9) and Brain (12.1).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for GCSH Gene

SOURCE GeneReport for Unigene cluster for GCSH Gene Hs.546256

genes like me logo Genes that share expressions with GCSH: view

Primer Products

In Situ Assay Products

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Expression partners for GCSH Gene

Orthologs for GCSH Gene

This gene was present in the common ancestor of eukaryotes.

Orthologs for GCSH Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia LOC101905887 35
  • 89.84 (n)
  • 89.63 (a)
-- 36
  • 85 (a)
-- 36
  • 87 (a)
-- 36
  • 79 (a)
-- 36
  • 87 (a)
-- 36
  • 80 (a)
  • 90 (a)
(Canis familiaris)
Mammalia GCSH 35
  • 89.6 (n)
  • 87.86 (a)
  • 88 (a)
(Mus musculus)
Mammalia Gcsh 35
  • 83.73 (n)
  • 81.76 (a)
Gcsh 16
Gcsh 36
  • 82 (a)
(Pan troglodytes)
Mammalia GCSH 35
  • 99.04 (n)
  • 100 (a)
  • 99 (a)
(Rattus norvegicus)
Mammalia Gcsh 35
  • 85.1 (n)
  • 86.47 (a)
(Ornithorhynchus anatinus)
Mammalia GCSH 36
  • 87 (a)
(Gallus gallus)
Aves GCSH 35
  • 76.89 (n)
  • 75.46 (a)
-- 36
  • 78 (a)
  • 75 (a)
(Anolis carolinensis)
Reptilia GCSH 36
  • 72 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia gcsh 35
  • 70.41 (n)
  • 68.05 (a)
(Danio rerio)
Actinopterygii gcsha 35
  • 68.4 (n)
  • 71.11 (a)
gcshb 36
  • 60 (a)
fruit fly
(Drosophila melanogaster)
Insecta ppl 37
  • 53 (a)
ppl 35
  • 55.07 (n)
  • 53.62 (a)
ppl 36
  • 47 (a)
African malaria mosquito
(Anopheles gambiae)
Insecta AgaP_AGAP006548 35
  • 55.77 (n)
  • 55.97 (a)
(Caenorhabditis elegans)
Secernentea F52A8.5 37
  • 52 (a)
F52A8.5 35
  • 55.88 (n)
  • 52.94 (a)
F52A8.5 36
  • 47 (a)
gcsh-1 36
  • 41 (a)
A. gosspyii yeast
(Ashbya gossypii)
Saccharomycetes AGOS_ADR396W 35
  • 46.61 (n)
  • 39.83 (a)
K. lactis yeast
(Kluyveromyces lactis)
Saccharomycetes KLLA0A03597g 35
  • 49.46 (n)
  • 43.23 (a)
baker's yeast
(Saccharomyces cerevisiae)
Saccharomycetes GCV3 35
  • 51.59 (n)
  • 48.7 (a)
GCV3 36
  • 35 (a)
GCV3 38
thale cress
(Arabidopsis thaliana)
eudicotyledons AT2G35120 35
  • 54.89 (n)
  • 50 (a)
(Oryza sativa)
Liliopsida Os02g0170100 35
  • 56.88 (n)
  • 49.21 (a)
bread mold
(Neurospora crassa)
Ascomycetes NCU08877 35
  • 47.74 (n)
  • 41.53 (a)
fission yeast
(Schizosaccharomyces pombe)
Schizosaccharomycetes gcv3 35
  • 55.1 (n)
  • 47.93 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 31 (a)
Species with no ortholog for GCSH:
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for GCSH Gene

Gene Tree for GCSH (if available)
Gene Tree for GCSH (if available)

Paralogs for GCSH Gene

genes like me logo Genes that share paralogs with GCSH: view

No data available for Paralogs for GCSH Gene

Variants for GCSH Gene

Sequence variations from dbSNP and Humsavar for GCSH Gene

SNP ID Clin Chr 16 pos Sequence Context AA Info Type MAF
rs62054483 -- 81,087,600(+) ACTCA(C/T)CTTGT splice-donor-variant, intron-variant
rs66776307 -- 81,095,630(+) CCCTC(-/CCTCGGCCTCCCAAAGTGCTGGGATTA)CGGCA intron-variant
rs146883402 -- 81,097,383(+) ATTCC(C/T)TGTTT upstream-variant-2KB
rs146841108 -- 81,095,765(+) TGCAC(G/T)CAGAT intron-variant
rs146601390 -- 81,098,309(+) CCAGC(C/G)TGGGT upstream-variant-2KB

Structural Variations from Database of Genomic Variants (DGV) for GCSH Gene

Variant ID Type Subtype PubMed ID
esv2422360 CNV Duplication 17116639
esv2751615 CNV Gain 17911159
esv1003113 CNV Deletion 20482838
esv2490578 CNV Deletion 19546169
esv2127465 CNV Deletion 18987734
esv2714774 CNV Deletion 23290073
esv6143 CNV Loss 19470904
esv1126856 CNV Deletion 17803354
nsv907005 CNV Loss 21882294

Relevant External Links for GCSH Gene

HapMap Linkage Disequilibrium report
Human Gene Mutation Database (HGMD)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GCSH Gene

Disorders for GCSH Gene

(1) OMIM Diseases for GCSH Gene (238330)


  • Non-ketotic hyperglycinemia (NKH) [MIM:605899]: Autosomal recessive disease characterized by accumulation of a large amount of glycine in body fluid and by severe neurological symptoms. Note=The disease is caused by mutations affecting the gene represented in this entry.

(2) University of Copenhagen DISEASES for GCSH Gene

(1) Novoseek inferred disease relationships for GCSH Gene

Disease -log(P) Hits PubMed IDs
hyperglycinemia nonketotic 95.6 2

Relevant External Links for GCSH

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
genes like me logo Genes that share disorders with GCSH: view

No data available for Genatlas for GCSH Gene

Publications for GCSH Gene

  1. Comprehensive mutation analysis of GLDC, AMT, and GCSH in nonketotic hyperglycinemia. (PMID: 16450403) Kure S. … Matsubara Y. (Hum. Mutat. 2006) 3 23 48
  2. The glycine cleavage system: structure of a cDNA encoding human H- protein, and partial characterization of its gene in patients with hyperglycinemias. (PMID: 1671321) Koyata H. … Hiraga K. (Am. J. Hum. Genet. 1991) 2 3 4
  3. The primary structure of human H-protein of the glycine cleavage system deduced by cDNA cloning. (PMID: 2025283) Fujiwara K. … Motokawa Y. (Biochem. Biophys. Res. Commun. 1991) 2 3 4
  4. Fine mapping and association studies of a high-density lipoprotein cholesterol linkage region on chromosome 16 in French-Canadian subjects. (PMID: 19844255) Dastani Z. … Genest J. (Eur. J. Hum. Genet. 2010) 3 48
  5. Heterozygous GLDC and GCSH gene mutations in transient neonatal hyperglycinemia. (PMID: 12402263) Kure S. … Matsubara Y. (Ann. Neurol. 2002) 3 23

Products for GCSH Gene

Sources for GCSH Gene

Back to Top
