Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GATSL3 Gene

Aliases for GATSL3 Gene

  • GATS Protein-Like 3 2 3 5

External Ids for GATSL3 Gene

Previous GeneCards Identifiers for GATSL3 Gene

  • GC22M029018
  • GC22M029019
  • GC22M030682
  • GC22M013642

Summaries for GATSL3 Gene

GeneCards Summary for GATSL3 Gene

GATSL3 (GATS Protein-Like 3) is a Protein Coding gene. An important paralog of this gene is GATSL2.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GATSL3 Gene

Genomics for GATSL3 Gene

Regulatory Elements for GATSL3 Gene

Enhancers for GATSL3 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around GATSL3 on UCSC Golden Path with GeneCards custom track

Promoters for GATSL3 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around GATSL3 on UCSC Golden Path with GeneCards custom track

Genomic Location for GATSL3 Gene

30,285,117 bp from pter
30,289,627 bp from pter
4,511 bases
Minus strand

Genomic View for GATSL3 Gene

Genes around GATSL3 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GATSL3 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GATSL3 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GATSL3 Gene

Proteins for GATSL3 Gene

  • Protein details for GATSL3 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    GATS-like protein 3
    Protein Accession:
    Secondary Accessions:
    • O76052
    • Q96ND9
    • Q9UIE8

    Protein attributes for GATSL3 Gene

    329 amino acids
    Molecular mass:
    36275 Da
    Quaternary structure:
    No Data Available
    • Sequence=AAC23432.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=AAC23433.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305}; Sequence=BAB70963.1; Type=Erroneous termination; Positions=310; Note=Translated as Glu.; Evidence={ECO:0000305}; Sequence=EAW59868.1; Type=Erroneous gene model prediction; Evidence={ECO:0000305};

neXtProt entry for GATSL3 Gene

Proteomics data for GATSL3 Gene at MOPED

Post-translational modifications for GATSL3 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for GATSL3 Gene

No data available for DME Specific Peptides for GATSL3 Gene

Domains & Families for GATSL3 Gene

Protein Domains for GATSL3 Gene

Suggested Antigen Peptide Sequences for GATSL3 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the GATS family.
  • Belongs to the GATS family.
genes like me logo Genes that share domains with GATSL3: view

No data available for Gene Families for GATSL3 Gene

Function for GATSL3 Gene

Phenotypes for GATSL3 Gene

GenomeRNAi human phenotypes for GATSL3:
genes like me logo Genes that share phenotypes with GATSL3: view

Animal Model Products

CRISPR Products

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for GATSL3 Gene

Localization for GATSL3 Gene

Subcellular locations from

Jensen Localization Image for GATSL3 Gene COMPARTMENTS Subcellular localization image for GATSL3 gene
Compartment Confidence
nucleus 2

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for GATSL3 Gene

Pathways & Interactions for GATSL3 Gene

SuperPathways for GATSL3 Gene

No Data Available

Interacting Proteins for GATSL3 Gene

STRING Interaction Network Preview (showing 1 interactants - click image to see details)
Selected Interacting proteins: ENSP00000384183 Q8WTX7-GATL3_HUMAN for GATSL3 Gene via STRING UniProtKB

Gene Ontology (GO) - Biological Process for GATSL3 Gene


No data available for Pathways by source and SIGNOR curated interactions for GATSL3 Gene

Drugs & Compounds for GATSL3 Gene

No Compound Related Data Available

Transcripts for GATSL3 Gene

mRNA/cDNA for GATSL3 Gene

(1) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(14) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for GATSL3 Gene

GATS protein-like 3:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for GATSL3 Gene

No ASD Table

Relevant External Links for GATSL3 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for GATSL3 Gene

mRNA expression in normal human tissues for GATSL3 Gene

mRNA differential expression in normal tissues according to GTEx for GATSL3 Gene

This gene is overexpressed in Esophagus - Mucosa (x4.1).

Protein differential expression in normal tissues from HIPED for GATSL3 Gene

This gene is overexpressed in Retina (20.9), Testis (13.3), Esophagus (7.4), and Ovary (6.1).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for GATSL3 Gene

SOURCE GeneReport for Unigene cluster for GATSL3 Gene Hs.444950

genes like me logo Genes that share expression patterns with GATSL3: view

Primer Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA Expression by UniProt/SwissProt and Protein tissue co-expression partners for GATSL3 Gene

Orthologs for GATSL3 Gene

This gene was present in the common ancestor of chordates.

Orthologs for GATSL3 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia GATSL3 35
  • 91.49 (n)
  • 95.74 (a)
  • 95 (a)
(Canis familiaris)
Mammalia GATSL3 35
  • 90.27 (n)
  • 95.44 (a)
  • 95 (a)
(Mus musculus)
Mammalia Gatsl3 35
  • 86.48 (n)
  • 92.38 (a)
Gatsl3 16
Gatsl3 36
  • 90 (a)
(Pan troglodytes)
Mammalia GATSL3 35
  • 99.7 (n)
  • 100 (a)
(Rattus norvegicus)
Mammalia Gatsl3 35
  • 86.18 (n)
  • 92.68 (a)
(Monodelphis domestica)
Mammalia GATSL3 36
  • 86 (a)
(Ornithorhynchus anatinus)
Mammalia GATSL3 36
  • 94 (a)
(Gallus gallus)
Aves GATSL3 35
  • 77.47 (n)
  • 79.69 (a)
  • 67 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia gatsl3 35
  • 67.59 (n)
  • 70.99 (a)
(Danio rerio)
Actinopterygii gatsl3 35
  • 66.97 (n)
  • 68.6 (a)
Species with no ortholog for GATSL3:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • lizard (Anolis carolinensis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for GATSL3 Gene

Gene Tree for GATSL3 (if available)
Gene Tree for GATSL3 (if available)

Paralogs for GATSL3 Gene

Paralogs for GATSL3 Gene

(4) SIMAP similar genes for GATSL3 Gene using alignment to 6 proteins:

genes like me logo Genes that share paralogs with GATSL3: view

Variants for GATSL3 Gene

Sequence variations from dbSNP and Humsavar for GATSL3 Gene

SNP ID Clin Chr 22 pos Sequence Context AA Info Type
rs2240421 -- 30,287,455(+) GGGCG(A/C)TCTTG reference, missense
rs77637191 -- 30,285,516(+) CCCAG(C/G/T)AGAAC utr-variant-3-prime
rs35151307 -- 30,285,809(+) CCCTC(-/CTGCCCCAGCCCTTGGTGCTCCCC)TGCCC intron-variant
rs9606713 -- 30,284,700(+) GCTTT(G/T)GGGCC downstream-variant-500B
rs9608865 -- 30,286,778(+) CAGAG(C/T)GTAGG intron-variant

Structural Variations from Database of Genomic Variants (DGV) for GATSL3 Gene

Variant ID Type Subtype PubMed ID
nsv829171 CNV Loss 20364138
dgv4954n71 CNV Loss 21882294
nsv914970 CNV Loss 21882294
nsv834174 CNV Gain+Loss 17160897
dgv4955n71 CNV Loss 21882294
esv2676362 CNV Deletion 23128226
nsv522605 CNV Loss 19592680

Variation tolerance for GATSL3 Gene

Residual Variation Intolerance Score: 48.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.16; 61.58% of all genes are more intolerant (likely to be disease-causing)

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Relevant External Links for GATSL3 Gene

Disorders for GATSL3 Gene

Relevant External Links for GATSL3

Atlas of Genetics and Cytogenetics in Oncology and Haematology:

No disorders were found for GATSL3 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for GATSL3 Gene

Publications for GATSL3 Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4 67
  2. The BioPlex Network: A Systematic Exploration of the Human Interactome. (PMID: 26186194) Huttlin E.L. … Gygi S.P. (Cell 2015) 3
  3. Novel rheumatoid arthritis susceptibility locus at 22q12 identified in an extended UK genome-wide association study. (PMID: 24449572) Orozco G. … Eyre S. ( 2014) 3
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  5. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. (PMID: 16344560) Kimura K. … Sugano S. (Genome Res. 2006) 3

Products for GATSL3 Gene

Sources for GATSL3 Gene
