Free for academic non-profit institutions. Other users need a Commercial license

Aliases for GAS2 Gene

Aliases for GAS2 Gene

  • Growth Arrest Specific 2 2 3 5
  • GAS-2 3 4
  • Growth Arrest-Specific Protein 2 3

External Ids for GAS2 Gene

Previous GeneCards Identifiers for GAS2 Gene

  • GC11P024106
  • GC11P023491
  • GC11P022728
  • GC11P022653
  • GC11P022646
  • GC11P022371

Summaries for GAS2 Gene

Entrez Gene Summary for GAS2 Gene

  • The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2017]

GeneCards Summary for GAS2 Gene

GAS2 (Growth Arrest Specific 2) is a Protein Coding gene. Diseases associated with GAS2 include Gnathodiaphyseal Dysplasia. Among its related pathways are p70S6K Signaling and Akt Signaling. An important paralog of this gene is GAS2L3.

UniProtKB/Swiss-Prot for GAS2 Gene

  • May play a role in apoptosis by acting as a cell death substrate for caspases. Is cleaved during apoptosis and the cleaved form induces dramatic rearrangements of the actin cytoskeleton and potent changes in the shape of the affected cells. May be involved in the membrane ruffling process (By similarity).

Gene Wiki entry for GAS2 Gene

Additional gene information for GAS2 Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for GAS2 Gene

Genomics for GAS2 Gene

Regulatory Elements for GAS2 Gene

Enhancers for GAS2 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH11H022678 0.9 FANTOM5 dbSUPER 21.6 +51.6 51590 0.5 TAF1 HLF NBN ZNF207 MLLT1 SPI1 YY1 GAS2 FANCF RNA5SP338
GH11H022680 1.2 FANTOM5 dbSUPER 11.7 +55.2 55175 0.1 ELF3 TBP FOXA2 ARID4B DMAP1 THRB RAD21 RARA YY1 CREM GAS2 RNA5SP338 FANCF
GH11H022701 1.5 FANTOM5 Ensembl ENCODE 7.2 +77.2 77244 2.8 ELF3 FOXA2 INSM2 RAD21 RARA ZNF366 ZSCAN5C ZNF391 ATF7 IKZF2 GAS2 FANCF SLC17A6 RNA5SP338 GC11P022726
GH11H022665 1.4 Ensembl ENCODE dbSUPER 7 +42.4 42382 4.6 HDGF SIN3A ARID4B DMAP1 YY1 RUNX3 IKZF2 ZHX2 KAT8 CBX8 ENSG00000254768 SLC17A6 GAS2 RNA5SP338 FANCF
GH11H022674 1.2 ENCODE dbSUPER 7.6 +49.6 49577 2.4 FOXA2 ATF1 ARID4B DMAP1 THRB RAD21 YY1 SLC30A9 ATF7 RUNX3 GAS2 RNA5SP338 FANCF
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around GAS2 on UCSC Golden Path with GeneCards custom track

Promoters for GAS2 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000037900 -42 2001 PKNOX1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 FOS SP3 CEBPZ

Genomic Locations for GAS2 Gene

Genomic Locations for GAS2 Gene
chr11:22,625,642-22,813,055
(GRCh38/hg38)
Size:
187,414 bases
Orientation:
Plus strand
chr11:22,647,188-22,834,601
(GRCh37/hg19)

Genomic View for GAS2 Gene

Genes around GAS2 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
GAS2 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for GAS2 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for GAS2 Gene

Proteins for GAS2 Gene

  • Protein details for GAS2 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    O43903-GAS2_HUMAN
    Recommended name:
    Growth arrest-specific protein 2
    Protein Accession:
    O43903
    Secondary Accessions:
    • B2R9C8
    • D3DQZ0
    • Q6ICV8
    • Q7Z3X8

    Protein attributes for GAS2 Gene

    Size:
    313 amino acids
    Molecular mass:
    34945 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for GAS2 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for GAS2 Gene

Post-translational modifications for GAS2 Gene

  • Cleaved, during apoptosis, on a specific aspartic residue by caspases.
  • Phosphorylated on serine residues during the G0-G1 transition phase.
  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for GAS2 Gene

Domains & Families for GAS2 Gene

Gene Families for GAS2 Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for GAS2 Gene

Suggested Antigen Peptide Sequences for GAS2 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

O43903

UniProtKB/Swiss-Prot:

GAS2_HUMAN :
  • Belongs to the GAS2 family.
Family:
  • Belongs to the GAS2 family.
genes like me logo Genes that share domains with GAS2: view

Function for GAS2 Gene

Molecular function for GAS2 Gene

GENATLAS Biochemistry:
growth arrest specific gene 2,expressed in liver,lung and kidney,involved in the regulation of microfilament dynamico during both cell cycle and apoptosis,homolog to GAR22,? same family
UniProtKB/Swiss-Prot Function:
May play a role in apoptosis by acting as a cell death substrate for caspases. Is cleaved during apoptosis and the cleaved form induces dramatic rearrangements of the actin cytoskeleton and potent changes in the shape of the affected cells. May be involved in the membrane ruffling process (By similarity).

Phenotypes From GWAS Catalog for GAS2 Gene

Gene Ontology (GO) - Molecular Function for GAS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0008017 microtubule binding IEA --
genes like me logo Genes that share ontologies with GAS2: view
genes like me logo Genes that share phenotypes with GAS2: view

Animal Model Products

miRNA for GAS2 Gene

miRTarBase miRNAs that target GAS2

Clone Products

No data available for Enzyme Numbers (IUBMB) , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for GAS2 Gene

Localization for GAS2 Gene

Subcellular locations from UniProtKB/Swiss-Prot for GAS2 Gene

Cytoplasm, cytoskeleton. Membrane; Peripheral membrane protein. Note=Component of the microfilament system. Colocalizes with actin fibers at the cell border and along the stress fibers in growth-arrested fibroblasts. Mainly membrane-associated. When hyperphosphorylated, accumulates at membrane ruffles (By similarity). {ECO:0000250}.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for GAS2 gene
Compartment Confidence
cytoskeleton 5
cytosol 5

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoli (2)
  • Nucleus (2)
  • Plasma membrane (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for GAS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005829 cytosol TAS --
GO:0005856 cytoskeleton IEA --
GO:0005884 actin filament TAS 1607387
GO:0016020 membrane IEA --
genes like me logo Genes that share ontologies with GAS2: view

Pathways & Interactions for GAS2 Gene

genes like me logo Genes that share pathways with GAS2: view

SIGNOR curated interactions for GAS2 Gene

Is activated by:

Gene Ontology (GO) - Biological Process for GAS2 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0006915 apoptotic process IEA,TAS --
GO:0007049 cell cycle IEA --
GO:0007050 cell cycle arrest IEA --
GO:0008360 regulation of cell shape IEA --
genes like me logo Genes that share ontologies with GAS2: view

Drugs & Compounds for GAS2 Gene

No Compound Related Data Available

Transcripts for GAS2 Gene

Unigene Clusters for GAS2 Gene

Growth arrest-specific 2:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for GAS2 Gene

ExUns: 1 ^ 2 ^ 3a · 3b ^ 4 ^ 5 ^ 6a · 6b ^ 7 ^ 8 ^ 9 ^ 10 ^ 11 ^ 12a · 12b
SP1: - - -
SP2: - - - -
SP3: - - -
SP4: - - -
SP5:
SP6:

Relevant External Links for GAS2 Gene

GeneLoc Exon Structure for
GAS2
ECgene alternative splicing isoforms for
GAS2

Expression for GAS2 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for GAS2 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for GAS2 Gene

This gene is overexpressed in Liver (x7.1) and Brain - Spinal cord (cervical c-1) (x5.2).

Protein differential expression in normal tissues from HIPED for GAS2 Gene

This gene is overexpressed in Liver (25.8), Fetal Liver (19.0), and Pancreas (18.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for GAS2 Gene



Protein tissue co-expression partners for GAS2 Gene

NURSA nuclear receptor signaling pathways regulating expression of GAS2 Gene:

GAS2

SOURCE GeneReport for Unigene cluster for GAS2 Gene:

Hs.711297

mRNA Expression by UniProt/SwissProt for GAS2 Gene:

O43903-GAS2_HUMAN
Tissue specificity: Ubiquitously expressed with highest levels in liver, lung, and kidney. Not found in spleen.

Evidence on tissue expression from TISSUES for GAS2 Gene

  • Liver(4.3)
  • Nervous system(4.3)
  • Kidney(4.2)
  • Muscle(4.2)
genes like me logo Genes that share expression patterns with GAS2: view

No data available for Phenotype-based relationships between genes and organs from Gene ORGANizer for GAS2 Gene

Orthologs for GAS2 Gene

This gene was present in the common ancestor of animals.

Orthologs for GAS2 Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia GAS2 33 34
  • 99.79 (n)
dog
(Canis familiaris)
Mammalia GAS2 33 34
  • 95.1 (n)
oppossum
(Monodelphis domestica)
Mammalia GAS2 34
  • 95 (a)
OneToOne
cow
(Bos Taurus)
Mammalia GAS2 33 34
  • 93.82 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia GAS2 34
  • 90 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Gas2 33 16 34
  • 89.35 (n)
rat
(Rattus norvegicus)
Mammalia Gas2 33
  • 88.82 (n)
chicken
(Gallus gallus)
Aves GAS2 33 34
  • 81.73 (n)
lizard
(Anolis carolinensis)
Reptilia GAS2 34
  • 92 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia gas2 33
  • 74.68 (n)
zebrafish
(Danio rerio)
Actinopterygii GAS2 34
  • 75 (a)
OneToOne
gas2b 33
  • 63.35 (n)
Dr.28064 33
rainbow trout
(Oncorhynchus mykiss)
Actinopterygii Omy.5535 33
worm
(Caenorhabditis elegans)
Secernentea D2096.11 34
  • 9 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea CSA.4664 34
  • 50 (a)
OneToMany
Species where no ortholog for GAS2 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for GAS2 Gene

ENSEMBL:
Gene Tree for GAS2 (if available)
TreeFam:
Gene Tree for GAS2 (if available)

Paralogs for GAS2 Gene

Paralogs for GAS2 Gene

(3) SIMAP similar genes for GAS2 Gene using alignment to 6 proteins:

genes like me logo Genes that share paralogs with GAS2: view

Variants for GAS2 Gene

Sequence variations from dbSNP and Humsavar for GAS2 Gene

SNP ID Clin Chr 11 pos Sequence Context AA Info Type
rs104894221 Pathogenic 22,625,795(-) TTCTG(C/G/T)AGCAC upstream-variant-2KB, reference, missense, stop-gained
rs104894222 Pathogenic 22,625,484(-) CGTTA(C/G)CACCT upstream-variant-2KB, reference, stop-gained
rs587778340 Pathogenic 22,625,326(-) ACTCT(-/CT)GATGA upstream-variant-2KB, reference, frameshift-variant
rs730880277 Pathogenic 22,625,559(-) TCCAG(-/TTCCGGGATTAGCGAACTTCCAG)GCCCT upstream-variant-2KB, reference, frameshift-variant
rs730880278 Pathogenic 22,625,416(-) TCTTT(-/CCCGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAG)CCTGG upstream-variant-2KB, reference, frameshift-variant

Structural Variations from Database of Genomic Variants (DGV) for GAS2 Gene

Variant ID Type Subtype PubMed ID
esv3625621 CNV loss 21293372
esv3625622 CNV loss 21293372
esv3625623 CNV gain 21293372
nsv1046773 CNV loss 25217958
nsv523451 CNV loss 19592680
nsv510246 OTHER sequence alteration 20534489

Variation tolerance for GAS2 Gene

Residual Variation Intolerance Score: 45.4% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.51; 43.94% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for GAS2 Gene

SNPedia medical, phenotypic, and genealogical associations of SNPs for
GAS2

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for GAS2 Gene

Disorders for GAS2 Gene

MalaCards: The human disease database

(1) MalaCards diseases for GAS2 Gene - From: GeneCards

Disorder Aliases PubMed IDs
gnathodiaphyseal dysplasia
  • levin syndrome 2
- elite association - COSMIC cancer census association via MalaCards
Search GAS2 in MalaCards View complete list of genes associated with diseases

Relevant External Links for GAS2

Genetic Association Database (GAD)
GAS2
Human Genome Epidemiology (HuGE) Navigator
GAS2
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
GAS2
genes like me logo Genes that share disorders with GAS2: view

No data available for UniProtKB/Swiss-Prot and Genatlas for GAS2 Gene

Publications for GAS2 Gene

  1. cDNA characterization and chromosome mapping of the human GAS2 gene. (PMID: 9521882) Collavin L … Schneider C (Genomics 1998) 2 3 4 22 60
  2. Genome-wide association scan for survival on dialysis in African-Americans with type 2 diabetes. (PMID: 21546767) Murea M … Freedman BI (American journal of nephrology 2011) 3 45 60
  3. An approach based on a genome-wide association study reveals candidate loci for narcolepsy. (PMID: 20677014) Shimada M … Tokunaga K (Human genetics 2010) 3 45 60
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard DS … MGC Project Team (Genome research 2004) 3 4 60
  5. Caspase-3 and caspase-7 but not caspase-6 cleave Gas2 in vitro: implications for microfilament reorganization during apoptosis. (PMID: 10564664) Sgorbissa A … Brancolini C (Journal of cell science 1999) 3 22 60

Products for GAS2 Gene

Sources for GAS2 Gene

Content
Loading form....