Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



FXYD7 Gene

protein-coding   GIFtS: 51
GCID: GC19P035634

FXYD Domain Containing Ion Transport Regulator 7

(Previous name: FXYD domain-containing ion transport regulator 7)
  Search for FXYD7
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 3

Aliases
FXYD Domain Containing Ion Transport Regulator 71 2
FXYD Domain-Containing Ion Transport Regulator 71 2

External Ids:    HGNC: 40341   Entrez Gene: 538222   Ensembl: ENSG000002219467   OMIM: 6066845   UniProtKB: P585493   
ORGUL members:         

Export aliases for FXYD7 gene to outside databases

Previous GC identifers: GC19P036251 GC19P036083 GC19P040310 GC19P040325 GC19P032142


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for FXYD7 Gene:
This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence.
This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence
domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The
approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane
topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the
C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase,
regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and
FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product,
FXYD7, is novel and has not been characterized as a protein. (RefSeq curation by Kathleen J. Sweadner, Ph.D.,
sweadner@helix.mgh.harvard.edu., Dec 2000)

GeneCards Summary for FXYD7 Gene:
FXYD7 (FXYD domain containing ion transport regulator 7) is a protein-coding gene. GO annotations related to this gene include ion channel activity and ATPase binding.




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000019.10  NC_018930.2  NT_011109.17  
Regulatory elements:
   Regulatory transcription factor binding sites in the FXYD7 gene promoter:
         AML1a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidFXYD7 promoter sequence
   Search Chromatin IP Primers for FXYD7

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat FXYD7


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19q13.12   Ensembl cytogenetic band:  19q13.12   HGNC cytogenetic band: 19q13.1

FXYD7 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FXYD7 gene location

GeneLoc information about chromosome 19         GeneLoc Exon Structure

GeneLoc location for GC19P035634:  view genomic region     (about GC identifiers)

Start:
35,634,154 bp from pter      End:
35,645,205 bp from pter
Size:
11,052 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, Cloud-Clone Corp., and/or eBioscience,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, Cloud-Clone Corp., and/or eBioscience, Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, Cloud-Clone Corp, and/or others.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: FXYD7_HUMAN, P58549 (See protein sequence)
Recommended Name: FXYD domain-containing ion transport regulator 7  
Size: 80 amino acids; 8524 Da

Explore the universe of human proteins at neXtProt for FXYD7: NX_P58549

Explore proteomics data for FXYD7 at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See FXYD7 Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_071289.1  
    ENSEMBL proteins: 
     ENSP00000466915   ENSP00000270310   ENSP00000465784  
    Reactome Protein details: P58549

    FXYD7 Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for FXYD7
    OriGene Protein Over-expression Lysate for FXYD7
    OriGene MassSpec for FXYD7
    OriGene Custom Protein Services for FXYD7
    GenScript Custom Purified and Recombinant Proteins Services for FXYD7
    Novus Biologicals FXYD7 Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for FXYD7

     
    Search eBioscience for Proteins for FXYD7 

    FXYD7 Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for FXYD7
    OriGene Custom Antibody Services for FXYD7
    Novus Biologicals FXYD7 Antibodies
    Abcam antibodies for FXYD7
    Cloud-Clone Corp. Antibodies for FXYD7
    Search ThermoFisher Antibodies for FXYD7
    LSBio Antibodies in human, mouse, rat for FXYD7

    FXYD7 Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for FXYD7
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for FXYD7
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for FXYD7
    Cloud-Clone Corp. CLIAs for FXYD7
    Search eBioscience for ELISAs for FXYD7 


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    1 InterPro protein domain:
     IPR000272 Ion-transport_regulator_FXYD

    Graphical View of Domain Structure for InterPro Entry P58549

    ProtoNet protein and cluster: P58549

    1 Blocks protein domain: IPB000272 FXYD protein

    UniProtKB/Swiss-Prot: FXYD7_HUMAN, P58549
    Similarity: Belongs to the FXYD family


    Find genes that share domains with FXYD7           About GenesLikeMe


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, Vector BioLabs and/or Addgene, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Flow cytometry from eBioscience, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

         Gene Ontology (GO): 2 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005216ion channel activity IEA--
    GO:0051117ATPase binding IEA--
         
    Find genes that share ontologies with FXYD7           About GenesLikeMe


    Phenotypes:
         3 GenomeRNAi human phenotypes for FXYD7:
     Decreased POU5F1-GFP protein e  Increased G2M DNA content, inc  Increased gamma-H2AX phosphory 

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for FXYD7
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for FXYD7

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for FXYD7
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for FXYD7

    miRNA
    Products:
        
    Block miRNA regulation of human, mouse, rat FXYD7 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate FXYD7 (see all 11):
    hsa-miR-99a* hsa-miR-4286 hsa-miR-99b* hsa-miR-3155 hsa-miR-484 hsa-miR-3180-3p hsa-miR-342-5p hsa-miR-608
    SwitchGear 3'UTR luciferase reporter plasmidFXYD7 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for FXYD7
    Predesigned siRNA for gene silencing in human, mouse, rat FXYD7

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for FXYD7

    Clone
    Products:
         
    OriGene clones in human, mouse for FXYD7 (see all 7)
    OriGene ORF clones in mouse, rat for FXYD7
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: FXYD7 (NM_022006)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FXYD7
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FXYD7

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for FXYD7
    Browse ESI BIO Cell Lines and PureStem Progenitors for FXYD7 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FXYD7


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from UniProtKB/Swiss-Prot
    FXYD7_HUMAN, P58549: Membrane; Single-pass membrane protein (Potential)
    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    plasma membrane4
    cytosol1
    extracellular1
    mitochondrion1
    nucleus1
    peroxisome1

    Gene Ontology (GO): 3 cellular component terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005886plasma membrane TAS--
    GO:0016020membrane ----
    GO:0016021integral component of membrane IEA--

    Find genes that share ontologies with FXYD7           About GenesLikeMe


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for FXYD7 About    
    See pathways by source

    SuperPathContained pathways About
    1Ion channel transport
    Ion channel transport0.58
    2Transport of glucose and other sugars, bile salts and organic acids, metal ions and amine compounds
    Transmembrane transport of small molecules0.47
    3Ion transport by P-type ATPases
    Ion transport by P-type ATPases


    Find genes that share SuperPaths with FXYD7           About GenesLikeMe

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 Reactome Pathway for FXYD7
        Ion transport by P-type ATPases


        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for FXYD7
    Interactions:

        Search GeneGlobe Interaction Network for FXYD7

    STRING Interaction Network Preview (showing 2 interactants - click image to see more details)

    2 Interacting proteins for FXYD7 (P585493 ENSP000002703104) via UniProtKB, MINT, STRING, and/or I2D
    InteractantInteraction Details
    GeneCardExternal ID(s)
    ATP1A1P050233, ENSP000002955984I2D: score=1 STRING: ENSP00000295598
    ATP1B1P050263, ENSP000003567894I2D: score=1 STRING: ENSP00000356789
    About this table

    Gene Ontology (GO): 4 biological process terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0006811ion transport ----
    GO:0034220ion transmembrane transport TAS--
    GO:0043269regulation of ion transport IEA--
    GO:0055085transmembrane transport TAS--

    Find genes that share ontologies with FXYD7           About GenesLikeMe



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for FXYD7



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, and/or Addgene, Primers from OriGene, and/or QIAGEN, Flow cytometry from eBioscience )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for FXYD7 gene: 
    NM_022006.1  

    Unigene Cluster for FXYD7:

    FXYD domain containing ion transport regulator 7
    Hs.134729  [show with all ESTs]
    Unigene Representative Sequence: BM547987
    4 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000586063 ENST00000270310(uc002nye.1) ENST00000439441(uc010xsp.1)
    ENST00000588265
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat FXYD7 using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate FXYD7 (see all 11):
    hsa-miR-99a* hsa-miR-4286 hsa-miR-99b* hsa-miR-3155 hsa-miR-484 hsa-miR-3180-3p hsa-miR-342-5p hsa-miR-608
    SwitchGear 3'UTR luciferase reporter plasmidFXYD7 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for FXYD7
    Predesigned siRNA for gene silencing in human, mouse, rat FXYD7
    Clone
    Products:
         
    OriGene clones in human, mouse for FXYD7 (see all 7)
    OriGene ORF clones in mouse, rat for FXYD7
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: FXYD7 (NM_022006)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FXYD7
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FXYD7
    Primer
    Products:
        
    OriGene qSTAR qPCR primer pairs in human, mouse for FXYD7
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat FXYD7
      QuantiTect SYBR Green Assays in human, mouse, rat FXYD7
      QuantiFast Probe-based Assays in human, mouse, rat FXYD7

    Additional mRNA sequence: 

    AK057825.1 AK296405.1 BC018619.1 

    5 DOTS entries:

    DT.75101773  DT.97834545  DT.121466335  DT.95265212  DT.75122864 

    Selected AceView cDNA sequences (see all 111):

    BM695523 AW297893 AW262746 BM662308 AJ573644 T84313 BM671752 BC032800 
    NM_005031 CD171939 AI199648 BQ638990 BQ956193 CR598444 F33358 AW006222 
    BM663606 AI086449 BM856555 BQ445963 AI809210 CR596488 BC018619 AI084856 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    FXYD7 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TCTTGAGCTT
    FXYD7 Expression
    About this image


    FXYD7 expression in embryonic tissues and stem cells    About this table
    Data from LifeMap, the Embryonic Development and Stem Cells Database
     selected tissues (see all 5) fully expand
     
     Brain (Nervous System)    fully expand to see all 28 entries
             Thalamus
             Globus Pallidus   
     
     Limb (Muscoskeletal System)
             Mesenchymal Condensate Cells Zeugopod
     
     Bone (Muscoskeletal System)
             Mesenchymal Condensate Cells Zeugopod
     
     Epiblast (Early Embryonic Tissues)
             Epiblast Cells Epiblast
     
     Cartilage (Muscoskeletal System)
             Mesenchymal Condensate Cells Zeugopod
    FXYD7 Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    FXYD7 Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.134729
        Custom PCR Arrays for FXYD7
    Primer
    Products:
    OriGene qSTAR qPCR primer pairs in human, mouse for FXYD7
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat FXYD7
    QuantiTect SYBR Green Assays in human, mouse, rat FXYD7
    QuantiFast Probe-based Assays in human, mouse, rat FXYD7
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FXYD7

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of human and mouse.

    Orthologs for FXYD7 gene from Selected species (see all 4)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Fxyd71 , 5 FXYD domain-containing ion transport regulator 71, 5 85.42(n)1
    86.25(a)1
      7 (19.29 cM)5
    577801  NM_022007.11  NP_071290.11 
     310425155 


    ENSEMBL Gene Tree for FXYD7 (if available)
    TreeFam Gene Tree for FXYD7 (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for FXYD7 gene
    5 SIMAP similar genes for FXYD7 using alignment to 3 protein entries:     FXYD7_HUMAN (see all proteins):
    FXYD1    FXYD2    FXYD6    FXYD3    FXYD5

    Find genes that share paralogs with FXYD7           About GenesLikeMe



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for FXYD7 (see all 207)    About this table                                 

    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 19 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1512694961,2
    C--35632166(+) TCTCT-/CTGGCCCCGCCTCTCCCTGGCC
    CCGCCTCTCCCTAGCCCCCCTCTCC
    CTGGC
    1 -- us2k10--------
    rs1438145121,2
    C--35634500(+) TGGCA-/GGTCCC 1 -- int10--------
    rs1172840321,2
    F--35634521(+) ATGCTC/TGGACA 1 -- int11Minor allele frequency- T:0.01EA 120
    rs1448029191,2
    C--35634565(+) CCGTGG/TTGGTA 1 -- int10--------
    rs1401688431,2
    --35634696(+) TTCTTC/TCCAGT 1 -- int10--------
    rs1854269141,2
    C--35634945(+) ACAGAA/GATGCA 1 -- int10--------
    rs1423581261,2
    C--35634950(+) GATGC-/AGAGAGA 1 -- int10--------
    rs1465340071,2
    C--35634962(+) AGAGA-/GAAAAA 1 -- int10--------
    rs1441455281,2
    C--35635126(+) TATGTA/GTGGGA 1 -- int10--------
    rs1472427411,2
    C--35635208(+) ACACCC/TAGCTG 1 -- int10--------

    HapMap Linkage Disequilibrium report for FXYD7 (35634154 - 35645205 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 2 variations for FXYD7:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv911617CNV Loss21882294
    dgv3849n71CNV Loss21882294

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing FXYD7
    DNA2.0 Custom Variant and Variant Library Synthesis for FXYD7

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 606684    OMIM disorders: --


    Find genes that share disorders with FXYD7           About GenesLikeMe

    Genetic Association Database (GAD): FXYD7
    Human Genome Epidemiology (HuGE) Navigator: FXYD7 (3 documents)

    Export disorders for FXYD7 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for FXYD7 gene, integrated from 10 sources (see all 15):
    (articles sorted by number of sources associating them with FXYD7)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Variation at the NFATC2 locus increases the risk of thiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipril and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)1, 4 Bailey S.D....Anand S. (Diabetes Care 2010)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    3. Intracellular trafficking of FXYD1 (phospholemman) and FXYD7 proteins in Xenopus oocytes and mammalian cells. (PubMed id 22535957)1 Moshitzky S....Garty H. (J. Biol. Chem. 2012)
    4. Interactome mapping suggests new mechanistic details underlying Alzheimer's disease. (PubMed id 21163940)1 Soler-LA^pez M....Aloy P. (Genome Res. 2011)
    5. Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip. (PubMed id 19913121)1 Talmud P.J.... . (Am. J. Hum. Genet. 2009)
    6. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
    7. FXYD7 is a brain-specific regulator of Na,K-ATPase alpha 1-beta isozymes. (PubMed id 12093728)1 BAcguin P....Geering K. (EMBO J. 2002)
    8. The FXYD gene family of small ion transport regulators or channels: cDNA sequence, protein signature sequence, and expression. (PubMed id 10950925)1 Sweadner K.J. and Rael E. (Genomics 2000)
    9. Regulation of interferon-induced protein kinase PKR: modulation of P58IPK inhibitory function by a novel protein, P52rIPK. (PubMed id 9447982)1 Gale M.J. Jr.... Katze M.G. (Mol. Cell. Biol. 1998)
    10. FXYD7, mapping of functional sites involved in endoplasmic reticulum export, association with and regulation of Na,K-ATPase. (PubMed id 15133029)9 Crambert G....Geering K. (J. Biol. Chem. 2004)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 53822 HGNC: 4034 AceView: FXYD1andFXYD7 Ensembl:ENSG00000221946 euGenes: HUgn53822
    ECgene: FXYD7 H-InvDB: FXYD7

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for FXYD7 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for FXYD7 gene:
    Search GeneIP for patents involving FXYD7

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, eBioscience, and/or others, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Addgene, Cell lines from GenScript, and ESI BIO, Flow cytometery from eBioscience, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for FXYD7   OriGene RNAi products in human, mouse, rat for FXYD7  
     Browse OriGene qPCR primer pairs and template standards   OriGene Protein Over-expression Lysate for FXYD7  
     OriGene MassSpec something-or-other for FXYD7   OriGene clones in human, mouse for FXYD7  
     OriGene qSTAR qPCR primer pairs in human, mouse for FXYD7   OriGene Purified Protein for FXYD7  
     OriGene ORF clones in mouse, rat for FXYD7   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for FXYD7   OriGene Custom Protein Services for FXYD7  

     
     
     Block miRNA regulation of human, mouse, rat FXYD7 using miScript Target Protectors SeqTarget long-range PCR primers for resequencing FXYD7
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat FXYD7 Predesigned siRNA for gene silencing in human, mouse, rat FXYD7
     QuantiFast Probe-based Assays in human, mouse, rat FXYD7 QuantiTect SYBR Green Assays in human, mouse, rat FXYD7
     Custom PCR Arrays for FXYD7 Search Chromatin IP Primers for FXYD7
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat FXYD7  Search GeneGlobe Interaction Network for FXYD7
     Regulatory tfbs in FXYD7 promoter
     GenScript Custom Purified and Recombinant Proteins Services for FXYD7 GenScript cDNA clones with any tag delivered in your preferred vector for FXYD7
     GenScript Custom Assay Services for FXYD7 GenScript Custom overexpressing Cell Line Services for FXYD7
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for FXYD7
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     Browse Sino Biological cDNA Clones
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     FXYD7 antibodies
     FXYD7 lysates
     Antibodies for FXYD7
     See all of Abcam's Antibodies, Kits and Proteins for FXYD7
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for FXYD7
     Antibodies for FXYD7
     ELISAs for FXYD7
     CLIAs for FXYD7



     Browse ESI BIO Cell Lines and PureStem Progenitors for FXYD7
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FXYD7
     SwitchGear 3'UTR luciferase reporter plasmids for FXYD7
     SwitchGear Promoter luciferase reporter plasmids for FXYD7
     Search ThermoFisher Antibodies for FXYD7
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FXYD7
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for FXYD7
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for FXYD7
     LSBio Antibodies in human, mouse, rat for FXYD7
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
     Search Addgene for plasmids for FXYD7
      Search eBioscience for proteins for FXYD7
      Search eBioscience for elisas for FXYD7
      eBioscience FlowRNA Probe Sets
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014 , 21 Aug 2014 , 8 Sep 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      FXYD7 gene at Home site.
    Version: 3.12.202 14 Sep 2014
    hostname: 356977-web1.xennexinc.com index build: 128 solr: 1.4