Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
- GeneCards Team
- Our Publications
- Citing GeneCards
- Licensing Agreement
- Weizmann Institute
- LifeMap Sciences Inc
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

FUT6 Gene

protein-coding GIFtS: 63
GCID: GC19M005830

Fucosyltransferase 6 (Alpha (1,3) Fucosyltransferase)

Microbiology & Infectious Diseases Congress

9 related diseases
at

MalaCards

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, ¹⁰fRNAdb, ¹²H-InvDB, ¹³NCBI, ¹⁴NONCODE, and/or ¹⁵RNAdb)
About This Section

Aliases
Fucosyltransferase 6 (Alpha (1,3) Fucosyltransferase)¹ ²		3)-fucosyltransferase¹
Galactoside 3-L-Fucosyltransferase¹ ² ³		alpha-(1¹
Fucosyltransferase VI² ³		FT1A²
FCT3A² ³		Alpha-(1,3)-Fucosyltransferase 6²
Fuc-TVI² ³		Fucosyltransferase 6³
FucT-VI² ³		EC 2.4.1⁸
EC 2.4.1.65³ ⁸

External Ids:	HGNC: 4017¹	Entrez Gene: 2528²	Ensembl: ENSG00000156413⁷	OMIM: 136836⁵	UniProtKB: P51993³

Export aliases for FUT6 gene to outside databases

Previous GC identifers: GC19M005922 GC19M005771 GC19M005781 GC19M005759 GC19M005590

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for FUT6 Gene:

The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of

sialyl-Lewis X, an E-selectin ligand. Mutations in this gene are a cause of fucosyltransferase-6 deficiency. Two

transcript variants encoding the same protein have been found for this gene. (provided by RefSeq, Jul 2008)

GeneCards Summary for FUT6 Gene:

FUT6 (fucosyltransferase 6 (alpha (1,3) fucosyltransferase)) is a protein-coding gene. Diseases associated with FUT6 include cytomegalovirus infection, and herpes simplex, and among its related super-pathways are Metabolism. GO annotations related to this gene include 3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity and fucosyltransferase activity. An important paralog of this gene is FUT5.

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Function: Enzyme involved in the biosynthesis of the E-Selectin ligand, sialyl-Lewis X. Catalyzes the transfer of

fucose from GDP-beta-fucose to alpha-2,3 sialylated substrates

Gene Wiki entry for FUT6 Gene

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 73), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000019.9 NT_011255.14 NC_018930.2

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the FUT6 gene promoter:
c-Fos HOXA9 HOXA9B AP-1 C/EBPalpha Meis-1b Pax-3 CP2 c-Jun Meis-1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): FUT6 promoter sequence

Search SABiosciences Chromatin IP Primers for FUT6

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FUT6

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p13.3 Ensembl cytogenetic band: 19p13.3 HGNC cytogenetic band: 19p13.3

FUT6 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FUT6 gene location

GeneLoc information about chromosome 19 GeneLoc Exon Structure

GeneLoc location for GC19M005830: view genomic region (about GC identifiers)

Start:	5,830,621 bp from pter	End:	5,839,742 bp from pter
Size:	9,122 bases	Orientation:	minus strand

(According to UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE ¹MOPED, ²PaxDb, and ³MAXQB RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Ontologies according to Gene Ontology Consortium 01 Oct 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993 (See protein sequence)

Recommended Name: Alpha-(1,3)-fucosyltransferase

Size: 359 amino acids; 41860 Da

Subcellular location: Golgi apparatus, Golgi stack membrane; Single-pass type II membrane protein.

Note=Membrane-bound form in trans cisternae of Golgi

Sequence caution: Sequence=AAC50191.1; Type=Miscellaneous discrepancy; Note=Probable cloning artifact;

Secondary accessions: A6NEX0 D6W637 Q9UND8

Alternative splicing: 2 isoforms: P51993-1 P51993-2

Explore the universe of human proteins at neXtProt for FUT6: NX_P51993

Explore proteomics data for FUT6 at MOPED

Post-translational modifications:

View modification sites using PhosphoSitePlus

View neXtProt modification sites for NX_P51993

4/19 DME Specific Peptides for FUT6 (P51993) (see all 19)

VPVVLGP

CFFSYLR

FIHVDDF

ADCNITA

FUT6 Protein expression data from MOPED¹, PaxDb² and MAXQB³ : About this image

REFSEQ proteins (2 alternative transcripts):

NP_000141.1 NP_001035791.1

ENSEMBL proteins:

ENSP00000431708 ENSP00000432954 ENSP00000286955 ENSP00000466016 ENSP00000436547

ENSP00000432161 ENSP00000436413 ENSP00000431880 ENSP00000433811 ENSP00000313398

Human Recombinant Protein Products for FUT6:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate for FUT6 OriGene Custom MassSpec OriGene Custom Protein Services for FUT6
	GenScript Custom Purified and Recombinant Proteins Services for FUT6
	Novus Biologicals FUT6 Protein Novus Biologicals FUT6 Lysates
	Browse Sino Biological Recombinant Proteins Browse Sino Biological Cell Lysates
	Browse ProSpec Recombinant Proteins
	Cloud-Clone Corp. Proteins for FUT6

Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005794	Golgi apparatus	TAS	11698403
GO:0016020	membrane	--	--
GO:0016021	integral to membrane	IEA	--
GO:0032580	Golgi cisterna membrane	IEA	--

FUT6 for ontologies About GeneDecksing

FUT6 Antibody Products:

	EMD Millipore Mono- and Polyclonal Antibodies for the study of FUT6
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for FUT6
	GenScript Custom Superior Antibodies Services for FUT6
	Novus Biologicals FUT6 Antibodies
	Abcam antibodies for FUT6
	Cloud-Clone Corp. Antibodies for FUT6
	ThermoFisher Antibody for FUT6
	LSBio Antibodies in human, mouse, rat for FUT6

Assay Products for FUT6:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Assay Services for FUT6
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for FUT6
	Browse Enzo Life Sciences for kits & assays
	Cloud-Clone Corp. ELISAs for FUT6 Cloud-Clone Corp. CLIAs for FUT6

(According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

HGNC Gene Families:

FUT: Fucosyltransferases

1 InterPro protein domain:

IPR001503 Glyco_trans_10

Graphical View of Domain Structure for InterPro Entry P51993

ProtoNet protein and cluster: P51993

1 Blocks protein domain: IPB001503 Glycosyl transferase

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Similarity: Belongs to the glycosyltransferase 10 family

FUT6 for domains About GeneDecksing

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, Vector BioLabs, and Sirion Biotech, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene.)
About This Section

Molecular Function:

UniProtKB/Swiss-Prot Summary: FUT6_HUMAN, P51993

Function: Enzyme involved in the biosynthesis of the E-Selectin ligand, sialyl-Lewis X. Catalyzes the transfer of

fucose from GDP-beta-fucose to alpha-2,3 sialylated substrates

Catalytic activity: GDP-beta-L-fucose + beta-D-galactosyl-(1->3)-N-acetyl-D-glucosaminyl-R = GDP +

beta-D-galactosyl-(1->3)-(alpha-L-fucosyl-(1->4))-N-acetyl-beta-D-glucosaminyl-R

Genatlas biochemistry entry for FUT6:

fucosyltransferase,alpha-(1,3),6 (FucT-VI),plasma type,responsible for the alpha 3-fucosylation of glycoproteins

produced in liver as suggested by the total absence of alpha 3 fucosylated-alpha 1-glycoproteins in patients with

a FUT6 missense mutation,with a high allelic diversity,ethnic specific

Enzyme Numbers (IUBMB): EC 2.4.1.65¹ ² EC 2.4.1²

Gene Ontology (GO): 3 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0008417	fucosyltransferase activity	TAS	8175676
GO:0017060	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity	IEA	--
GO:0046920	alpha-(1->3)-fucosyltransferase activity	TAS	11698403

FUT6 for ontologies About GeneDecksing

Phenotypes:
1 GenomeRNAi human phenotype for FUT6:

Increased S DNA content

Animal Models:

inGenious Targeting Laboratory - Custom generated mouse model solutions for FUT6

inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for FUT6

genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for FUT6

genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for FUT6

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FUT6
		1 QIAGEN miScript miRNA Assays for microRNA that regulate FUT6:
		hsa-miR-875-3p
		SwitchGear 3'UTR luciferase reporter plasmid: FUT6 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for FUT6
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUT6

Gene Editing Products:			DNA2.0 Custom Protein Engineering Service for FUT6
			Sirion Biotech Customized adenovirus for overexpression of FUT6

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene clones in human, mouse for FUT6 (see all 10) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): FUT6 (NM_000150)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUT6
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUT6
		Sirion Biotech Customized lentivirus for stable overexpression of FUT6 Customized lentivirus expression plasmids for stable overexpression of FUT6

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for FUT6
		Search LifeMap BioReagents cell lines for FUT6

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUT6

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Oct 2013 via Entrez Gene).
About This Section

SuperPaths for FUT6 About

See pathways by source

SuperPath

Contained pathways About

Metabolism

Metabolic pathways

0.40

Glycosphingolipid biosynthesis - lacto and neolacto series

Glycosphingolipid biosynthesis - lacto and neolacto series

Pathways by source See SuperPaths
Show all pathways

2 Kegg Pathways (Kegg details for FUT6):

	Glycosphingolipid biosynthesis - lacto and neolacto series
	Metabolic pathways

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Pathway: Protein modification; protein glycosylation

FUT6 for pathways About GeneDecksing

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for FUT6

STRING Interaction Network Preview (showing 5 interactants - click image to see 16)

5/16 Interacting proteins for FUT6 (ENSP00000286955⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 16)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
B3GNT2	ENSP00000305595⁴	STRING: ENSP00000305595
B4GALT1	ENSP00000369055⁴	STRING: ENSP00000369055
B4GALT2	ENSP00000349293⁴	STRING: ENSP00000349293
B4GALT3	ENSP00000320965⁴	STRING: ENSP00000320965
FUT1	ENSP00000312021⁴	STRING: ENSP00000312021

About this table

Gene Ontology (GO): 3 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006486	protein glycosylation	TAS	11698403
GO:0036065	fucosylation	TAS	8175676
GO:0042355	L-fucose catabolic process	NAS	11698403

FUT6 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

FUT6 for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for FUT6

2 HMDB Compounds for FUT6 About this table

Compound	Synonyms	CAS #	PubMed Ids
GDP-L-fucose	GDP-beta-L-fucose (see all 5)	15839-70-0	--
Guanosine diphosphate	5'-GDP (see all 10)	146-91-8	--

5 Novoseek inferred chemical compound relationships for FUT6 gene About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
slex	67.2	2	7630015 (1), 12725333 (1)
polylactosamine	66.4	1	10622713 (1)
n-acetyllactosamine	54.8	1	10891123 (1)
n-ethylmaleimide	34.2	1	9042366 (1)
n-acetylglucosamine	32	1	10052591 (1)

Search CenterWatch for drugs/clinical trials and news about FUT6

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Sirion Biotech, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for FUT6 gene (2 alternative transcripts):

NM_000150.2 NM_001040701.1

Unigene Clusters for FUT6:

Fucosyltransferase 6 (alpha (1,3) fucosyltransferase)

Hs.631846 [show with all ESTs], Hs.705615 [show with all ESTs]

Unigene Representative Sequences: NM_000150, U27331

12 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000524754(uc021unl.1) ENST00000527106 ENST00000286955 ENST00000592563

ENST00000529165 ENST00000531085 ENST00000531199 ENST00000532464 ENST00000528505

ENST00000526499 ENST00000591079 ENST00000318336(uc002mdf.1 uc002mdg.1 uc002mdh.1)

Congresses - knowledge worth sharing:
European Congress of Clinical Microbiology and Infectious Diseases (ECCMID) 10 - 13 May 2014

miRNA Products:		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FUT6
		1 QIAGEN miScript miRNA Assays for microRNA that regulate FUT6:
		hsa-miR-875-3p
		SwitchGear 3'UTR luciferase reporter plasmid: FUT6 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene RNAi products in human, mouse, rat for FUT6
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUT6

Clone Products:		OriGene clones in human, mouse for FUT6 (see all 10) OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): FUT6 (NM_000150)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUT6
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUT6
		Sirion Biotech Customized lentivirus for stable overexpression of FUT6 Customized lentivirus expression plasmids for stable overexpression of FUT6

Primer Products:		OriGene qPCR primer pairs and template standards for FUT6 OriGene qSTAR qPCR primer pairs in human, mouse for FUT6
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat FUT6
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUT6
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUT6

Additional mRNA sequence: U27331.1

9 DOTS entries:

DT.95243192 DT.86994016 DT.99952233 DT.100019203 DT.100750043 DT.75105001 DT.97777317 DT.99978277

DT.121449794

22 AceView cDNA sequences:

U27332 U27331 BC061700 AW614132 BV198781 M98825 AF131211 U27336

BM756773 AK098073 BX113350 BV198591 AL702935 AI672482 AI952786 BG432556

AU098944 BG952128 BE833439 BG402446 AW176527 BV198613

GeneLoc Exon Structure

4 Alternative Splicing Database (ASD) splice patterns (SP) for FUT6 About this scheme

ExUns:	1a	·	1b	^	2	^	3a	·	3b	^	4	^	5	^	6a	·	6b	·	6c	·	6d	^	7
SP1:					-
SP2:					-				-		-		-
SP3:									-		-		-
SP4:

ECgene alternative splicing isoforms for FUT6

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

FUT6 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS <intensity>^2/3
CGAP TAG: ATGGCACGTG

About this image

See FUT6 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for FUT6

SOURCE GeneReport for Unigene clusters: Hs.631846 Hs.705615

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Tissue specificity: Kidney, liver, colon, small intestine, bladder, uterus and salivary gland

SABiosciences Custom PCR Arrays for FUT6

Primer Products:		OriGene qPCR primer pairs and template standards for FUT6 OriGene qSTAR qPCR primer pairs in human, mouse for FUT6
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat FUT6
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUT6
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUT6

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUT6

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for FUT6 gene from 6/11 species (see all 11) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
dog (Canis familiaris)	Mammalia	FUT5⁶ FUT5⁶	--	68(a) 67(a)	many ↔ many many ↔ many	20(54208840-54209892) 20(54224690-54225841)
chicken (Gallus gallus)	Aves	FUT3⁶	Uncharacterized protein	46(a)	1 → many	28(1498656-1499789)
lizard (Anolis carolinensis)	Reptilia	--	Uncharacterized protein	49(a)	1 → many	AAWZ02038436(4451-5581)
African clawed frog (Xenopus laevis)	Amphibia	LOC399049²	alpha 1,3/4 fucosyltransferase Lewis 1	74.41(n)		AJ580005.1
zebrafish (Danio rerio)	Actinopterygii	fut9⁶ -- (see all 15)	--	35(a) 35(a) (see all 15)	many ↔ many many ↔ many (see all 15)	8(3512976-3517595) 8(3626455-3650896)
worm (Caenorhabditis elegans)	Secernentea	fut-4¹	Protein FUT-4	42.45(n) 32.53(a)		187342 NM_061971.3 NP_494372.2

ENSEMBL Gene Tree for FUT6 (if available)
TreeFam Gene Tree for FUT6 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for FUT6 gene

FUT5² FUT4² FUT7² FUT3² FUT11² FUT10² FUT9²

5 SIMAP similar genes for FUT6 using alignment to 7 protein entries: FUT6_HUMAN (see all proteins):

FUT5 FUT3 FUT9 FUT7 FUT4

FUT6 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, ⁴UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Polymorphism: Expression of alpha(1,3)-fucosyltransferase in plasma can vary among different populations. 9% of

individuals on the isle of Java (Indonesia) do not express this enzyme. Ninety-five percent of plasma

alpha(1,3)-fucosyltransferase-deficient individuals have Lewis negative phenotype on red cells, suggesting strong

linkage disequilibrium between these two traits. Variations in FUT6 are responsible for plasma

alpha(1,3)-fucosyltransferase deficiency [MIM:613852]

SNP ID	Valid	Clinical significance	Chr 19 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs17855739^1,2,4	C,F	pathogenic¹	6856794(-)	`CCTTCG/AAGAAC`	4	/K /E	mis¹ ese³		4		NA EU	5867
VAR_065915⁴		--	--	see VAR_065915	2	L V	mis⁴		0	--	--	--	--
rs778809^1,2	C,F,O,A,H	--	5590150(+)	`ACACCG/AGATGA`	2	--	ds500¹		35		NS EA NA WA CSA	3408
rs138096647^1,2		--	5590167(+)	`CTCTCA/TCACAC`	2	--	ds500¹		0	--	--	--	--
rs200071422^1,2		--	5590290(+)	`ACACT-/CCCCCC`	2	--	ds500¹		0	--	--	--	--
rs778808^1,2	C,F,A,H	--	5590295(-)	`AAAAAA/GGGGGG`	2	--	ds500¹		21		NS EA NA WA CSA	1996
rs371327345^1,2	C	--	5590295(+)	`CCCCC-/C/TTTTTT`	2	--	ds500¹		0	--	--	--	--
rs59768885^1,2	C	--	5590485(+)	`TTTTT-/T/TTT GAGAC`	4	--	ds500¹ cds¹		1		NA	2
rs181778413^1,2		--	5590505(+)	`TCTGTC/TGCCAG`	2	--	ut3¹		0	--	--	--	--
rs185911395^1,2	C	--	5590552(+)	`CCTCCA/GACTCT`	2	--	ut3¹		0	--	--	--	--
rs190325668^1,2		--	5590568(+)	`TCAAGC/TGATTC`	2	--	ut3¹		0	--	--	--	--
rs778807^1,2	C,H	--	5590627(-)	`TTTGCT/CGGGCG`	2	--	ut3¹ ese³		4		NA WA CSA	7
rs35845041^1,2	C	--	5590647(+)	`TTTTAG/ATAGAG`	2	--	ut3¹		1		NA	2
rs188390343^1,2		--	5590654(+)	`AGAGAC/TGGGTT`	2	--	ut3¹		0	--	--	--	--
rs138814800^1,2		--	5590758(+)	`GCACCC/TGGCCT`	2	--	ut3¹		0	--	--	--	--
rs12986368^1,2	C,F,H	--	5590770(+)	`ATCATC/TGGTTT`	2	--	ut3¹ ese³		13		NS EA NA WA	912
rs778806^1,2	C,F,H	--	5590777(-)	`GCAAAG/AAAAAC`	2	--	ut3¹		8		NS EA WA	1208
rs142774588^1,2	C	--	5590835(+)	`ACAGGC/TGGCTA`	2	--	ut3¹		0	--	--	--	--
rs191083363^1,2		--	5590848(+)	`AACATC/TACAAA`	2	--	ut3¹		0	--	--	--	--
rs182930080^1,2	C	--	5590949(+)	`TGAGGC/TTCCTA`	2	--	ut3¹		0	--	--	--	--
rs186655016^1,2		--	5590955(+)	`TCCTAC/GCAGGT`	2	--	ut3¹		0	--	--	--	--
rs116794036^1,2	C,F	--	5591044(+)	`GTCCCC/TAGGAG`	2	--	ut3¹		1		WA	118
rs147377203^1,2		--	5591099(+)	`CCAGCA/TTGTGA`	2	--	ut3¹		0	--	--	--	--
rs201366529^1,2	C	--	5591341(+)	`ACACCA/GGCCTC`	2	--	ut3¹		1		EU	1323
rs150572233^1,2	C,F	--	5591363(+)	`AAGCCG/TCTATG`	4	E A	mis¹		1		NA	4546
rs201278961^1,2	C	--	5591373(+)	`GCCGCG/ATGTCT`	4	/R /C	mis¹		1		EU	1323
rs192545727^1,2	C	--	5591404(+)	`AGTTTC/TCAGCA`	4	* W	stg¹		0	--	--	--	--
rs61740561^1,2	C,F	--	5591425(+)	`AAAGCG/CAGTGC`	4	/L	syn¹		7		NS CSA WA NA EU	6014
rs375242162^1,2	C	--	5591445(+)	`GGAGCA/GAGGCC`	4	R C	mis¹		0	--	--	--	--
rs61739552^1,2	C,F	--	5591450(+)	`GAGGCC/TGCAGC`	4	Q R	mis¹		3		NS NA EU	5907
rs61739551^1,2	C,F	--	5591456(+)	`GCAGCG/ATCTCC`	4	/T /M	mis¹		2		NS EU	1131
rs145035679^1,2	C,F	--	5591482(+)	`CTCAGG/TTAGCG`	4	* Y	stg¹		2		NA EU	5845
rs142915411^1,2	C	--	5591519(+)	`GGTACC/TGGGCC`	4	Q R	mis¹		1		NA	4434
rs61147939^1,2,4	C,F	--	5591520(+)	`GTACCG/CGGCCA`	4	/R /G	mis¹		1		EU	1029
rs141055382^1,2	F	--	5591545(+)	`TGGAAG/ATCGTC`	4	/D	syn¹		1		NA	4146
rs62110261^1,2	C,F	--	5591548(+)	`AAGTCG/ATCCAC`	4	/D	syn¹		1		EU	943
rs200779357^1,2	C	--	5591569(+)	`GCGTCG/AGGTGG`	4	/P	syn¹		1		EU	1153
rs112313064^1,2	C,F	--	5591572(+)	`TCGGGT/CGGCAG`	4	/P	syn¹		2		WA EU	701
rs146941796^1,2	C,F	--	5591573(+)	`CGGGTG/AGCAGG`	4	/P /L	mis¹		1		NA	3632
rs150055699^1,2	C,F	--	5591617(+)	`ACCACG/AGGCAC`	4	/P	syn¹		1		NA	3746
rs199718441^1,2		--	5591658(+)	`CTTCTC/TGGTGA`	4	K E	mis¹		0	--	--	--	--
rs141349215^1,2	C,F	--	5591689(+)	`TTCTCG/AAAGGC`	4	/F	syn¹		2		NA EU	5876
rs79359759^1,2	C,F	--	5591698(+)	`GCCAGA/GTAGAA`	4	Y	syn¹		2		CSA NA	4554
rs146077344^1,2	C	--	5591720(+)	`ACAGCG/ATCTCC`	4	/T /M	mis¹		1		NA	4552
rs443907^1,2	A	--	5591734(-)	`CAGGGA/GACCAT`	4	G	syn¹ ese³		1		NA	2
rs364637^1,2,4	C,F,A,H	--	5591739(-)	`TGCCCC/AAGGGA`	4	/K /Q	mis¹ ese³		10		EA NA NS MN	5212
rs141945646^1,2	F	--	5591760(+)	`GGAGCG/ATCCGT`	4	/R /C	mis¹		1		NA	4550
rs146312446^1,2	F	--	5591763(+)	`GCGTCC/TGTACA`	4	R G	mis¹		1		NA	4550
rs192315992^1,2	C	--	5591769(+)	`GTACAC/TGTCCA`	4	M V	mis¹		0	--	--	--	--
rs364587^1,2	C,F	--	5591785(-)	`CAGGCC/TCATCT`	4	A	syn¹ ese³		5		MN NA EU	6061
rs445878^1,2	C	--	5591818(+)	`CTGGCA/C/G/T GAGTT`	8	S	syn¹ ese³		3		NA	4554
rs3964631^1,2	H	--	5591823(-)	`GGCCAA/GACTCC`	4	N D	mis¹		4		NS EA	414
rs4041473^1,2	H	--	5591824(-)	`GGGCCA/GAACTC`	4	P	syn¹		4		NS EA	420
rs2879401^1,2		--	5591828(-)	`CTGGGA/GGCCAA`	4	E G	mis¹		0	--	--	--	--
rs401508^1,2	C	--	5591842(+)	`GACACC/TGCCCA`	4	A	syn¹ ese³		3		NA MN	188
rs146819588^1,2	C,F	--	5591876(+)	`AGAGGT/CTGAGC`	4	/N /S	mis¹		1		NA	4488
rs145009020^1,2	C,F	--	5591889(+)	`TGGGTG/AGGCAG`	4	/H /Y	mis¹		2		NA EU	5711
rs111494384^1,2	F	--	5591900(+)	`GCTGGC/ACGGAC`	4	/G /V	mis¹		1		CSA	4
rs150924444^1,2	C	--	5591902(+)	`TGGCCG/AGACCA`	4	/S	syn¹		1		NA	4422
rs150560931^1,2	C	--	5591925(+)	`CCGTA-/GGGGCG`	4	Y LR	fra¹		0	--	--	--	--
rs200897572^1,2	C	--	5592038(+)	`TCCATC/TGCTGC`	4	Q R	mis¹		0	--	--	--	--
rs201634023^1,2		--	5592050(+)	`CCTGCC/TGCCTC`	4	Q R	mis¹		0	--	--	--	--
rs111589452^1,2	C,F	--	5592051(+)	`CTGCCG/ACCTCG`	4	/R /W	mis¹		1		CSA	4
rs185108416^1,2	C	--	5592055(+)	`CGCCTC/TGGGGA`	4	P	syn¹		0	--	--	--	--
rs778805^1,2,4	C,F,A,H	--	5592057(-)	`GCTCCC/TCGAGG`	4	P S	mis¹		27		NS EA NA CSA WA EU	8401
rs189959983^1,2		--	5592058(+)	`CTCGGA/GGAGCG`	4	S	syn¹		0	--	--	--	--
rs138645125^1,2	C,F	--	5592063(+)	`GGAGCG/ATGGGA`	4	/R /C	mis¹		2		NA EU	5867
rs115405004^1,2	C	--	5592067(+)	`CGTGGG/AAGCTG`	4	/L	syn¹		2		WA NA	4668
rs114460969^1,2	C,F	--	5592091(+)	`TACATG/TACCTC`	4	V	syn¹		2		WA NA	4668
rs72486354^1,2	C	--	5592098(+)	`CCTCTC/TGGTGG`	4	Q R	mis¹		0	--	--	--	--
rs192615441^1,2	C	--	5592099(+)	`CTCTCC/GGTGGT`	4	R G	mis¹		0	--	--	--	--
rs138857915^1,2	F	--	5592115(+)	`ATGACC/TGCGTC`	4	A	syn¹		1		NA	4550
rs150692510^1,2	C	--	5592223(+)	`GGCCAC/TGTCCA`	4	T	syn¹		1		NA	4546
rs112849079^1,2	C,F	--	5592255(+)	`GTGGGC/TGGGGG`	4	T A	mis¹		1		CSA	4
rs199791598^1,2	C	--	5592289(+)	`GACCCA/GTTAGG`	4	N	syn¹		1		EU	1307
rs141062404^1,2	C	--	5592309(+)	`GGGATC/TGTCTT`	4	N D	mis¹		1		NA	4530
rs202215473^1,2		--	5592312(+)	`ATCGTC/TTTGAG`	4	N D	mis¹		0	--	--	--	--
rs144807324^1,2	C,F	--	5592323(+)	`ACACAC/TGCAGA`	4	H R	mis¹		1		NA	4518
rs201524447^1,2		--	5592324(+)	`CACACA/GCAGAT`	4	R C	mis¹		0	--	--	--	--
rs113764706^1,2	C,F	--	5592364(+)	`TGAAAC/TAGCAG`	4	L	syn¹		1		CSA	2
rs143668927^1,2	C,F	--	5592409(+)	`TTGGCC/TGGGCC`	4	P	syn¹		1		NA	4490
rs9807877^1,2	C,F	--	5592437(+)	`AGAGTA/CTCTGG`	2	--	ut5¹		17		NA WA CSA EA EU	1811
rs778804^1,2	C,F,A,H	--	5592540(-)	`CTGTGA/TAACAG`	2	--	int¹		13		NA WA CSA EA	379
rs78060698^1,2	C,F	--	5592621(+)	`GCCCAG/AAGTCC`	2	--	int¹		3		WA NA EA	358
rs148081894^1,2		--	5592645(+)	`CATTAA/GACAAC`	2	--	int¹		0	--	--	--	--
rs140902372^1,2		--	5592693(+)	`TGGGAA/GAGGCC`	2	--	int¹		0	--	--	--	--
rs3916080^1,2	C,F,A,H	--	5592747(-)	`TCTGGG/TGACAC`	2	--	int¹		18		NA EA NS	1820
rs187996741^1,2		--	5592783(+)	`ACAGCC/TGATCA`	2	--	int¹		0	--	--	--	--
rs73536616^1,2	C,F	--	5592785(+)	`AGCCGA/GTCATA`	2	--	int¹		4		WA CSA EA	242
rs116156270^1,2	F	--	5592814(+)	`TGAGTC/TGAGGC`	2	--	int¹		1		WA	118
rs181895181^1,2	C	--	5592830(+)	`CCCATA/GACTCT`	2	--	int¹		0	--	--	--	--
rs3859563^1,2	C,F,A,H	--	5592885(-)	`CTGGTA/GAGCTC`	2	--	int¹		31		NS EA NA WA CSA	2988
rs186454128^1,2		--	5592912(+)	`GGAAAC/GGGTGC`	2	--	int¹		0	--	--	--	--
rs74421545^1,2	C,F	--	5592961(+)	`GGAGAG/CACCCC`	2	--	int¹		1		NA	120
rs150165046^1,2		--	5593004(+)	`TCAGGA/GCTGCC`	2	--	int¹		0	--	--	--	--
rs189299112^1,2	C	--	5593121(+)	`GAAGCC/TGAGGC`	2	--	int¹		0	--	--	--	--
rs10420107^1,2	C,F	--	5593127(+)	`gaggcG/Aggcag`	2	--	int¹		5		NA WA CSA	10
rs142805855^1,2		--	5593144(+)	`AGGTCA/GAGAGA`	2	--	int¹		0	--	--	--	--
rs182076858^1,2	C	--	5593275(+)	`CCTGGC/GGGGTG`	2	--	int¹		0	--	--	--	--
rs186630068^1,2		--	5593278(+)	`GGGGGA/GTGGAG`	2	--	int¹		0	--	--	--	--
rs111342270^1,2	C,F	--	5593307(+)	`CGCACC/TGCTGC`	2	--	int¹		2		WA CSA	4
rs138026647^1,2	C	--	5593398(+)	`TGCCTA/GTAATC`	2	--	int¹		0	--	--	--	--
rs10402728^1,2	C,F,A	--	5593470(+)	`caacgC/Tggtga`	2	--	int¹		6		NA WA CSA	12
rs113769774^1,2	C,F	--	5593535(+)	`TAATCC/ACAGCT`	2	--	int¹		2		WA CSA	4
rs142996053^1,2	C	--	5593633(+)	`GGACAA/CAGAAT`	2	--	int¹		0	--	--	--	--
rs191474144^1,2		--	5593728(+)	`GCTCAC/TGACTG`	2	--	int¹		0	--	--	--	--
rs73536626^1,2	C,F	--	5593774(+)	`TAACTT/AGAGGT`	2	--	int¹		6		WA CSA EA	246
rs34940903^1,2	C,F	--	5593797(+)	`ACCAGC/TGTGGT`	2	--	int¹		7		WA NA EA	366
rs12460874^1,2	C,F,H	--	5593815(+)	`GAGAAC/TCCACA`	2	--	int¹		6		NA WA EA	364
rs80053250^1,2	C,F	--	5593846(+)	`ATTAGC/TTGGGC`	2	--	int¹		4		WA CSA	8
rs113180603^1,2	C,F	--	5593978(+)	`AGAGCG/AAGACC`	2	--	int¹		1		CSA	2
rs201818635^1,2	C	--	5593997(+)	`AAAAGA/GAAAAA`	2	--	int¹		0	--	--	--	--
rs73536629^1,2	C,F	--	5594029(+)	`CACTCA/GGGGTT`	2	--	int¹		6		WA CSA NA EA	364
rs17271883^1,2	C,F,H	--	5594060(+)	`GGTTAC/TTCCTC`	2	--	int¹		30		NA NS EA WA CSA	2910
rs182801390^1,2		--	5594063(+)	`TACTCC/TTCTGG`	2	--	int¹		0	--	--	--	--
rs9807817^1,2	C	--	5594098(+)	`GGGACA/C/TGATAG`	2	--	int¹		0	--	--	--	--
rs185319450^1,2		--	5594121(+)	`GCAGGC/TGTGGG`	2	--	int¹		0	--	--	--	--
rs10403115^1,2	C,F,H	--	5594193(+)	`AGAAGC/AAGGCT`	2	--	int¹		10		NS EA NA WA	1094
rs190028992^1,2		--	5594295(+)	`TCCCCC/TGGAGT`	2	--	int¹		0	--	--	--	--
rs143814846^1,2		--	5594362(+)	`GCTCAC/TGCCTG`	2	--	int¹		0	--	--	--	--
rs112948212^1,2	C	--	5594700(+)	`GTGGCG/AGGAAA`	2	--	int¹		1		CSA	2
rs146838879^1,2		--	5594759(+)	`GGACCC/TTTGGA`	2	--	int¹		0	--	--	--	--
rs114239131^1,2	F	--	5594937(+)	`ACTGTG/TTCCGT`	2	--	int¹		1		WA	118
rs182260582^1,2		--	5595062(+)	`GACCCC/TAGATC`	2	--	int¹		0	--	--	--	--
rs140627364^1,2		--	5595075(+)	`GACCTC/TGGGAA`	2	--	int¹		0	--	--	--	--
rs188029579^1,2		--	5595125(+)	`TGCAGA/CCCTAC`	2	--	int¹		0	--	--	--	--
rs150006352^1,2		--	5595144(+)	`ATTCTA/GCAGAT`	2	--	int¹		0	--	--	--	--
rs193059412^1,2		--	5595162(+)	`CTAAGA/GCTCAG`	2	--	int¹		0	--	--	--	--
rs113426773^1,2	C,F	--	5595224(+)	`CAGACT/CCCAAA`	2	--	int¹		1		CSA	1
rs114914894^1,2	F	--	5595278(+)	`CAGATG/AGAGCT`	2	--	int¹		1		WA	118
rs149138148^1,2	C	--	5595386(+)	`GTGGGC/TGGATT`	2	--	int¹		0	--	--	--	--
rs12019136^1,2	C	--	5595494(+)	`TACTCA/GGGAGG`	2	--	int¹		0	--	--	--	--
rs141399491^1,2		--	5595540(+)	`AGGTTG/TCAGTG`	2	--	int¹		0	--	--	--	--
rs183761652^1,2		--	5595557(+)	`GATTGC/TACCAT`	2	--	int¹		0	--	--	--	--
rs188241965^1,2		--	5595597(+)	`ACTCCA/GTCTCA`	2	--	int¹		0	--	--	--	--
rs146989239^1,2	C	--	5595758(+)	`GTCGCC/TCAGAC`	2	--	int¹		0	--	--	--	--
rs192934379^1,2		--	5595860(+)	`TACAAC/GTGTGC`	2	--	int¹		0	--	--	--	--
rs184569848^1,2		--	5595901(+)	`TAGTAA/GAGACG`	2	--	int¹		0	--	--	--	--
rs118074313^1,2	C,F	--	5595980(+)	`GCCTCC/TCAAAG`	2	--	int¹		1		EA	120
rs188543315^1,2		--	5596021(+)	`CCGGCA/CTGGCT`	2	--	int¹		0	--	--	--	--
rs139999431^1,2	C	--	5596044(+)	`TTTTC-/TTTTCT TTTCTTTTGTTTTC`	2	--	cds¹		0	--	--	--	--
rs138092143^1,2		--	5596128(+)	`AACCTC/GCGCCT`	2	--	int¹		0	--	--	--	--
rs141699860^1,2		--	5596418(+)	`TTGGGC/TGGCTG`	2	--	int¹		0	--	--	--	--
rs191454233^1,2		--	5596426(+)	`CTGAGA/GTGGGA`	2	--	int¹		0	--	--	--	--
rs150111526^1,2		--	5596437(+)	`GGATCA/GCTTGA`	2	--	int¹		0	--	--	--	--
rs183542990^1,2		--	5596543(+)	`ACATGC/GTGGCC`	2	--	int¹		0	--	--	--	--
rs138417949^1,2		--	5596577(+)	`CTGAGG/TCAGGA`	2	--	int¹		0	--	--	--	--
rs149247815^1,2		--	5596632(+)	`TGCACC/TATTGC`	2	--	int¹		0	--	--	--	--
rs146172666^1,2		--	5596664(+)	`TGAGAC/TCGTGT`	2	--	int¹		0	--	--	--	--
rs145275499^1,2	C	--	5596674(+)	`TCTCA-/AAAT AAATA`	2	--	int¹		0	--	--	--	--
rs1678849^1,2	C,F,H	--	5596781(+)	`GACTGA/GTATTA`	2	--	int¹		35		NS EA NA WA CSA	3099
rs117449805^1,2	C,F	--	5596797(+)	`AGTAAT/CTGGGA`	2	--	int¹		2		NA EA	240
rs140193260^1,2		--	5596806(+)	`GAAACC/TTTTGA`	2	--	int¹		0	--	--	--	--
rs61546992^1,2	C	--	5597014(+)	`GCGCCC/TCCCAC`	2	--	int¹		0	--	--	--	--
rs60383067^1,2	C	--	5597102(+)	`CTCAAC/TTGACC`	2	--	int¹		1		NA	2
rs201320927^1,2		--	5597151(+)	`TGAGT-/CACCACCA`	2	--	cds¹		0	--	--	--	--
rs148557976^1,2		--	5597317(+)	`GCCAGG/TCACGG`	2	--	int¹		0	--	--	--	--
rs142897039^1,2		--	5597321(+)	`GGCACA/GGTGGC`	2	--	int¹		0	--	--	--	--
rs35222081^1,2	C,F	--	5597328(+)	`TGGCTC/TATGCC`	2	--	int¹		5		NA WA	128
rs189399461^1,2		--	5597412(+)	`ACATGC/GTGAAA`	2	--	int¹		0	--	--	--	--
rs151063460^1,2		--	5597538(+)	`GCAGTC/GAGCCA`	2	--	int¹		0	--	--	--	--
rs181960535^1,2	C	--	5597548(+)	`AAGGTC/TGCGCC`	2	--	int¹		0	--	--	--	--
rs199653133^1,2	C	--	5597621(+)	`TAAAA-/AAATAA`	2	--	int¹		0	--	--	--	--
rs139732932^1,2	C	--	5597820(+)	`GCTGTC/TGGGCT`	2	--	int¹		0	--	--	--	--
rs186998191^1,2		--	5597938(+)	`TTTGCC/TGGTGA`	2	--	int¹		0	--	--	--	--
rs189798285^1,2		--	5597977(+)	`GGGAAC/TGGGAG`	2	--	int¹		0	--	--	--	--
rs144630605^1,2		--	5598028(+)	`ATGATC/TGATCC`	2	--	int¹		0	--	--	--	--
rs147868544^1,2	C	--	5598106(+)	`CCACCA/GGGAGT`	2	--	int¹		0	--	--	--	--
rs181853100^1,2		--	5598110(+)	`CGGGAA/GTGGCA`	2	--	int¹		0	--	--	--	--
rs141468240^1,2		--	5598143(+)	`AGGAAA/GGATGA`	2	--	int¹		0	--	--	--	--
rs8101385^1,2	C,F,A,H	--	5598412(+)	`CAGGAC/TTGAGG`	2	--	int¹		21		NS EA NA WA CSA	2348
rs185856449^1,2		--	5598435(+)	`GGCTCA/GGAGCC`	2	--	int¹		0	--	--	--	--
rs147005931^1,2		--	5598470(+)	`CGATCC/TGGGTT`	2	--	int¹		0	--	--	--	--
rs75998859^1,2	F	--	5598471(+)	`GATCCG/AGGTTG`	2	--	int¹		1		NA	120
rs147625395^1,2		--	5598477(+)	`GGTTGG/TGGGTG`	2	--	int¹		0	--	--	--	--
rs73920069^1,2	C,F	--	5598546(+)	`GAGGCC/TGCGGA`	2	--	ut5¹		3		WA CSA	122
rs190182678^1,2		--	5598597(+)	`ACCACA/GCAGCA`	2	--	ut5¹		0	--	--	--	--
rs116792659^1,2	C,F	--	5598653(+)	`AACCAC/ACACAC`	2	--	ut5¹		1		WA	118
rs182398606^1,2		--	5598740(+)	`TCCCCA/GTTGCA`	2	--	ut5¹		0	--	--	--	--
rs149084677^1,2		--	5598860(+)	`ACCACC/TGGTTC`	2	--	ut5¹		0	--	--	--	--
rs116953194^1,2	C,F	--	5599042(+)	`GAAACC/TGGTGG`	2	--	ut5¹		1		NA	120
rs143110842^1,2	C	--	5599243(+)	`GGAGAC/GGAGGC`	2	--	ut5¹		0	--	--	--	--
rs148224427^1,2		--	5599284(+)	`GCCATA/GGGGTG`	2	--	ut5¹		0	--	--	--	--
rs185205230^1,2		--	5599323(+)	`TGAGGC/GTTCAA`	2	--	ut5¹		0	--	--	--	--
rs192361745^1,2		--	5599378(+)	`CTGGTA/GGGCTG`	2	--	ut5¹		0	--	--	--	--
rs778798^1,2	C,F,O,A,H	--	5599430(+)	`CCTCAA/CCAAGC`	2	--	ut5¹		36		EA NA NS WA CSA	2945
rs141189382^1,2		--	5599553(+)	`AATACC/TGGTTT`	2	--	ut5¹		0	--	--	--	--
rs3760776^1,2	C,F,H	--	5599563(-)	`TCCTCC/TCTCAA`	2	--	us2k¹ tfbs³		28		EA NA NS WA CSA	4384
rs79484447^1,2	F	--	5599605(+)	`TGCAAA/GGGTGA`	2	--	us2k¹		1		NA	120
rs183678660^1,2		--	5599628(+)	`CCCAGA/CCTCCA`	2	--	us2k¹		0	--	--	--	--
rs112358826^1,2	C,F	--	5599756(+)	`TGGGCC/TAGGGG`	2	--	us2k¹		1		NA	2
rs188678363^1,2		--	5599791(+)	`AGTGGC/TAACCT`	2	--	us2k¹		0	--	--	--	--
rs16993228^1,2	C,F,H	--	5599795(+)	`GCAACC/ATAATT`	2	--	us2k¹		18		NA NS EA	1882
rs191782730^1,2		--	5600024(+)	`GTGGGC/TGCCTG`	2	--	us2k¹		0	--	--	--	--
rs182865049^1,2		--	5600034(+)	`GTAGTC/TCCAGC`	2	--	us2k¹		0	--	--	--	--
rs778799^1,2	A	--	5600131(+)	`tgggcA/Gacagt`	2	--	us2k¹		0	--	--	--	--
rs137876199^1,2		--	5600251(+)	`CGCTTA/GAGCCC`	2	--	us2k¹		0	--	--	--	--
rs708686^1,2	C,F,A,H	--	5600436(+)	`gactaC/Taggcg`	2	--	us2k¹		20		NS EA NA WA CSA	2228
rs708685^1,2	C,F,H	--	5600478(+)	`ttttaG/Atagag`	2	--	us2k¹		12		WA NA CSA EA	376
rs115967729^1,2	F	--	5600487(+)	`AGCTGG/TTTTTC`	2	--	us2k¹		1		WA	118
rs187157758^1,2		--	5600673(+)	`TGGCAC/TGATCT`	2	--	us2k¹		0	--	--	--	--
rs10409772^1,2	C,F	--	5600747(+)	`ACAGGA/CGTCCG`	2	--	us2k¹		4		WA CSA	7
rs146393697^1,2		--	5600762(+)	`CACGCC/TCAGCT`	2	--	us2k¹		0	--	--	--	--
rs75243301^1,2	C,F	--	5600977(+)	`GTCATT/CCCATC`	2	--	us2k¹		1		EA	120
rs139387520^1,2	C	--	5600992(+)	`TGATCA/GCTGGG`	2	--	us2k¹		0	--	--	--	--
rs191553601^1,2		--	5601054(+)	`AACGTA/GTGCTC`	2	--	us2k¹		0	--	--	--	--
rs3760775^1,2	C,F,H	--	5601177(-)	`TGATAC/ACCTAC`	2	--	us2k¹		29		EA NS NA WA CSA	4362
rs59993317^1,2	C	--	5601269(+)	`GTTGGC/GGTCTT`	2	--	us2k¹		0	--	--	--	--
rs3760774^1,2	C,F,A,H	--	5601283(-)	`GTCCAA/GTGAGG`	2	--	us2k¹		24		EA NS NA WA	3922
rs3760773^1,2	C,F	--	5601421(-)	`CAGCCC/AGTGGG`	2	--	us2k¹		1		NA	2
rs187453729^1,2		--	5601479(+)	`TGGGGA/GTTTGA`	2	--	us2k¹		0	--	--	--	--
rs111912575^1,2	C,F	--	5830599(+)	`CCACCG/ACACCC`	2	--	ds500¹		2		WA CSA	4
rs112641207^1,2	C,F	--	5833621(+)	`CCAACG/ATGGTG`	2	--	int¹		2		WA CSA	4
rs11305548^1,2	C	--	5834149(+)	`AAAAGA/-AAAAA`	2	--	int¹ trp³		2		NA CSA	4
rs137858664^1,2	C	--	5834251(+)	`GGACA-/GATAGGAGGGAGAAT AGGCAGGCGTGGGGACCGATAG`	2	--	int¹		0	--	--	--	--
rs5826905^1,2	C	--	5834825(+)	`AAAAA-/ACAAAA`	2	--	int¹		0	--	--	--	--
rs112868050^1,2	C	--	5836217(+)	`GTTAA-/TTTTC/T TTTCTTTTCTTTTC`	2	--	int¹		1		CSA	2
rs113185071^1,2	C	--	5837732(+)	`AGGTCA/GCGCCA`	2	--	int¹		1		CSA	1
rs71836060^1,2	C	--	5840335(+)	`GTCTC-/AAAAAAA`	2	--	us2k¹		0	--	--	--	--
rs12972960^1,2	C,A	--	5840789(+)	`GGGTTC/TTTTTT`	2	--	us2k¹ trp³		2		WA CSA	3
rs35628490^1,2	--	--	5590645(+)	`ATTTT-/TAGTAG`	2	--	ut3¹		0	--	--	--	--
rs11267124^1,2	--	--	5834282(+)	`GGGAC-/CGATAGGAGGGAGAA TAGGCAGGCGTGGGGACTCACA`	2	--	int¹		0	--	--	--	--
rs71844111^1,2	--	--	5840789(+)	`GGTTT-/CTTT TTTTT`	2	--	us2k¹		0	--	--	--	--
rs78324382^1,2	--	--	5597625(+)	`ATAAA-/ATAAA TAAAC`	2	--	int¹		0	--	--	--	--
rs367958174^1,2	--	--	5592141(+)	`CTTGCA/GTCGGC`	4	R C	mis¹		0	--	--	--	--
rs147799077^1,2	--	--	5591566(+)	`AAGGCG/ATCGGG`	4	/D	syn¹		1		NA	3778
rs60037261^1,2	--	--	5593571(+)	`CACTTG/TAACCC`	2	--	int¹		0	--	--	--	--
rs376619746^1,2	--	--	5600420(+)	`CCTCCC/TAGTAG`	2	--	us2k¹		0	--	--	--	--
rs368424921^1,2	--	--	5594406(+)	`GACCGC/GTGAGG`	2	--	int¹		0	--	--	--	--
rs139295920^1,2	--	--	5591370(+)	`TATGCC/TGCGTG`	4	S G	mis¹		1		NA	4544
rs147795465^1,2	--	--	5591847(+)	`TGCCCA/GGGCCA`	4	R W	mis¹		1		NA	4532
rs142068894^1,2	--	--	5592117(+)	`GACCGC/TGTCTG`	4	T A	mis¹		1		NA	4550
rs376289834^1,2	--	--	5593216(+)	`GGTGGC/TGTGTG`	2	--	int¹		0	--	--	--	--
rs373661477^1,2	--	--	5597147(+)	`AGGCAC/TGAGTC`	2	--	int¹		0	--	--	--	--
rs367612855^1,2	--	--	5591532(+)	`GTCCTC/TGGGGC`	4	K E	mis¹		0	--	--	--	--
rs373318674^1,2	--	--	5594651(+)	`AAAAAA/CAAAAA`	2	--	int¹		0	--	--	--	--
rs199597075^1,2	--	--	5592144(+)	`GCGGTC/TGGCAG`	4	N D	mis¹		1		EU	1323
rs56772013^1,2	--	--	5593572(+)	`ACTTGA/GACCCG`	2	--	int¹		0	--	--	--	--
rs371135883^1,2	--	--	5597905(+)	`TATGGC/TACCTC`	2	--	int¹		0	--	--	--	--
rs372792619^1,2	--	--	5590050(+)	`ACCACA/TGGCGC`	2	--	ds500¹		0	--	--	--	--
rs34221339^1,2	--	--	5596400(+)	`ACCTA-/ATAATC`	2	--	int¹		0	--	--	--	--
rs373816097^1,2	--	--	5591547(+)	`GAAGTC/TGTCCA`	4	N D	mis¹		0	--	--	--	--
rs144743691^1,2	--	--	5592146(+)	`GGTCGG/ACAGTG`	4	/A /V	mis¹		1		NA	4548
rs372180434^1,2	--	--	5590806(+)	`GGTGCA/GTGATT`	2	--	ut3¹		0	--	--	--	--
rs375251723^1,2	--	--	5590809(+)	`GCGGTC/GTTATC`	2	--	ut3¹		0	--	--	--	--
rs371867552^1,2	--	--	5592370(+)	`AGCAGC/TTGGTC`	4	T	syn¹		0	--	--	--	--
rs374972154^1,2	--	--	5597751(+)	`ACAGCC/TCTCGA`	2	--	int¹		0	--	--	--	--
rs368783240^1,2	--	--	5600084(+)	`GAGGCA/GAGCTT`	2	--	us2k¹		0	--	--	--	--
rs377471195^1,2	--	--	5592166(+)	`TCAGCC/TGTGCC`	4	T	syn¹		0	--	--	--	--
rs200710904^1,2	--	--	5592420(+)	`CAGGGG/AATCCA`	4	/P /S	mis¹		1		EU	1313
rs368365032^1,2	--	--	5598719(+)	`CAAATC/TTGGGG`	2	--	ut5¹		0	--	--	--	--
rs144398741^1,2	--	--	5591807(+)	`AGTAGC/TGCACC`	4	H R	mis¹		1		NA	4550
rs2434718^1,2	--	--	5596044(+)	`CTTTTC/GTTTTC`	2	--	int¹ trp³		0	--	--	--	--
rs371011074^1,2	--	--	5593254(+)	`GAGGCA/GGAGAA`	2	--	int¹		0	--	--	--	--
rs35285366^1,2	--	--	5594846(+)	`GGATC-/CTGGAG`	2	--	int¹ ut5¹		0	--	--	--	--
rs377682351^1,2	--	--	5591952(+)	`GCTGCA/GTAGGA`	4	R C	mis¹		0	--	--	--	--
rs371330919^1,2	--	--	5600770(+)	`AGCTA-/TTTTTTT`	2	--	us2k¹		0	--	--	--	--
rs370191158^1,2	--	--	5591623(+)	`GGCACA/GGCCCA`	4	A	syn¹		0	--	--	--	--
rs376667883^1,2	--	--	5591908(+)	`GACCAC/TGGCTC`	4	P	syn¹		0	--	--	--	--
rs369325804^1,2	--	--	5600450(-)	`AGTGCC/TGTGTC`	2	--	us2k¹		0	--	--	--	--
rs62105961^1,2	--	--	5595484(+)	`TAATGC/TCAGCT`	2	--	int¹		0	--	--	--	--
rs370437317^1,2	--	--	5593337(+)	`AATTCC/TATCTT`	2	--	int¹		0	--	--	--	--
rs374406742^1,2	--	--	5596269(+)	`GAACTC/TCTGAC`	2	--	int¹		0	--	--	--	--
rs373642727^1,2	--	--	5591377(+)	`CGTGTC/TTGGTA`	4	Q	syn¹		0	--	--	--	--
rs370973422^1,2	--	--	5593273(+)	`AACCTA/GGGGGG`	2	--	int¹		0	--	--	--	--
rs36091103^1,2	--	--	5590075(+)	`CAGGG-/GAATTG`	2	--	ds500¹		0	--	--	--	--
rs367548237^1,2	--	--	5593847(+)	`TTAGCC/TGGGCA`	2	--	int¹		0	--	--	--	--

HapMap Linkage Disequilibrium report for FUT6 (5830621 - 5839742 bp)

Structural Variations
Database of Genomic Variants (DGV) 5 variations for FUT6: About this table

Variant ID	Type	Subtype	PubMed ID
esv2718050	CNV	Deletion	23290073
dgv3694n71	CNV	Loss	21882294
dgv3693n71	CNV	Loss	21882294
nsv910901	CNV	Loss	21882294
nsv910903	CNV	Loss	21882294

Human Gene Mutation Database (HGMD): FUT6

Locus Specific Mutation Databases (LSDB): FUT6

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FUT6

DNA2.0 Custom Variant and Variant Library Synthesis for FUT6

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

OMIM gene information: 136836 OMIM disorders: --

9 diseases for FUT6: About MalaCards

cytomegalovirus infection herpes simplex colorectal cancer schizophrenia

hepatocellular carcinoma lung cancer endotheliitis pancreatitis

breast cancer

FUT6 for disorders About GeneDecksing

5 Novoseek inferred disease relationships for FUT6 gene About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
colon carcinoma	35.9	3	12670495 (2), 10747292 (1)
cancer lung	0	1	10449611 (1)
colorectal cancer	0	1	9690558 (1)
carcinoma	0	2	9690558 (2)
cancer	0	3	7693344 (1), 9538143 (1), 10449611 (1)

Genetic Association Database (GAD): FUT6
Human Genome Epidemiology (HuGE) Navigator: FUT6 (4 documents)

Export disorders for FUT6 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for FUT6 gene, integrated from 9 sources (see all 72):
(articles sorted by number of sources associating them with FUT6)

Utopia: connect your pdf to the dynamic
world of online information

The cloning and expression of a human alpha-1,3 fucosyltransferase capable of forming the E-selectin ligand. (PubMed id 1520296)^{1, 2, 3, 9} Koszdin K.L. and Bowen B.R. (1992)
Expression of human chromosome 19p alpha(1,3)-fucosyltransferase genes in normal tissues. Alternative splicing, polyadenylation, and isoforms. (PubMed id 7650030)^{1, 2, 9} Cameron H.S.... Weston B.W. (1995)
Molecular basis for plasma alpha(1,3)-fucosyltransferase gene deficiency (FUT6). (PubMed id 8175676)^{1, 2, 9} Mollicone R....Oriol R. (1994)
Physical maps of human alpha (1,3)fucosyltransferase genes FUT3-FUT6 on chromosomes 19p13.3 and 11q21. (PubMed id 7782074)^{1, 3, 9} McCurley R.S....Weston B.W. (1995)
Genome-wide association study identifies novel loci as sociated with serum level of vitamin B12 in Chinese men. (PubMed id 22367966)^{1, 4} Lin X....Sun J. (2012)
Genomics meets glycomics-the first GWAS study of huma n N-Glycome identifies HNF1I+ as a master regulator of plasma protein fucosylati on. (PubMed id 21203500)^{1, 4} Lauc G....Rudan I. (2010)
Variation at the NFATC2 locus increases the risk of t hiazolidinedione-induced edema in the Diabetes REduction Assessment with ramipr il and rosiglitazone Medication (DREAM) study. (PubMed id 20628086)^{1, 4} Bailey S.D....Anand S. (2010)
Molecular cloning of a fourth member of a human alpha (1,3)fucosyltransferase gene family. Multiple homologous sequences that determine expression of the Lewis x, sialyl Lewis x, and difucosyl sialyl Lewis x epitopes. (PubMed id 1339443)^{1, 2} Weston B.W.... Lowe J.B. (1992)
Identification of two functionally deficient plasma alpha 3-fucosyltransferase (FUT6) alleles. (PubMed id 11102976)^{2, 9} Elmgren A....Larson G. (2000)
Expression levels of FUT6 gene transfected into human colon carcinoma cells switch two sialyl-Lewis X-related carbohydrate antigens with distinct properties in cell adhesion. (PubMed id 12670495)^{1, 9} Kanoh A....Irimura T. (2003)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 2528	HGNC: 4017	AceView: FUT6	Ensembl:ENSG00000156413	euGenes: HUgn2528
ECgene: FUT6	Kegg: 2528	H-InvDB: FUT6

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for FUT6	Pharmacogenomics, SNPs, Pathways
GGDB	http://riodb.ibase.aist.go.jp/rcmg/ggdb/Homolog?cat=symbol&symbol=FUT6
Functional Glycomics Gateway - GTase	http://www.functionalglycomics.org/glycomics/molecule/jsp/glycoEnzyme/viewGlycoEnzyme.jsp?gbpId=gt_hum_603

Intellectual Property for FUT6 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for FUT6 gene:
Search GeneIP for patents involving FUT6

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Sirion Biotech, Cell lines from GenScript, and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
About This Section

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse Small Molecules at EMD Millipore
	Browse for Gene Knock-down Tools from EMD Millipore
	EMD Millipore Mono- and Polyclonal Antibodies for the study of FUT6
	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse Kits and Assays available from EMD Millipore

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Protease Activity Assays and Reagents		Browse Recombinant/Natural Proteins
	Browse Stem Cell Products		Browse Tocris Biochemicals & Compounds
	Browse cDNA Clones		Browse Proteome Profiler Antibody Arrays

	Browse OriGene Antibodies		OriGene RNAi products in human, mouse, rat for FUT6
	OriGene qPCR primer pairs and template standards for FUT6		OriGene Protein Over-expression Lysate for FUT6
	OriGene Custom Mass Spec		OriGene clones in human, mouse for FUT6
	OriGene qSTAR qPCR primer pairs in human, mouse for FUT6		Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
	Browse OriGene ORF clones		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for FUT6		OriGene Custom Protein Services for FUT6

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat FUT6
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FUT6
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FUT6
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUT6
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUT6
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUT6

	GenScript Custom Purified and Recombinant Proteins Services for FUT6		GenScript cDNA clones with any tag delivered in your preferred vector for FUT6
	GenScript Custom Assay Services for FUT6		GenScript Custom Superior Antibodies Services for FUT6
	GenScript Custom overexpressing Cell Line Services for FUT6		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in FUT6 promoter
	Search Chromatin IP Primers for FUT6
	RT² qPCR Primer Assay in human, mouse / rat FUT6
	Search GNC Networks for FUT6
	SABiosciences Custom PCR Arrays for FUT6

Search Tocris compounds for FUT6

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological Cell Lysates
	Browse Sino Biological cDNA Clones
	4000+ Proteins
	Search Sino Biological for antibodies, proteins & pathways
	Protein Production Services
	Transfection Reagents
	Protein A/G/L resins
	Isotyping reagents

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	FUT6 antibodies
	FUT6 proteins
	FUT6 lysates

	Antibodies for FUT6
	See all of Abcam's Antibodies, Kits and Proteins for FUT6
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

	Proteins for FUT6
	Antibodies for FUT6
	ELISAs for FUT6
	CLIAs for FUT6

Search LifeMap BioReagents cell lines for FUT6

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUT6

	SwitchGear 3'UTR luciferase reporter plasmids for FUT6
	SwitchGear Promoter luciferase reporter plasmids for FUT6

ThermoFisher Antibody for FUT6

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUT6

	inGenious Targeting Laboratory - Custom generated mouse model solutions for FUT6
	inGenious Targeting Laboratory - Custom generated inducible mouse model solutions for FUT6

Customized:

	lentivirus for stable overexpression of FUT6
	lentivirus expression plasmids for stable overexpression of FUT6
	adenovirus for overexpression of FUT6

LSBio Antibodies in human, mouse, rat for FUT6

Customized transgenic rodents for:

	Humanization
	Biomarker expression
	Off-target effect monitoring
	Translational medicine
	Tissue-specific gene expresssion
	Time-controlled gene expresssion

GeneCards Homepage - Last full update: 23 Oct 2013 - Incrementals: 3 Nov 2013 , 7 Nov 2013 , 23 Jan 2014

View Random Gene

Category			TGFB1 (GIFtS: 73) transforming growth factor, beta 1
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes FUT6 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4

Advanced Search

Export list of displayed genes

FUT6 Gene

Fucosyltransferase 6 (Alpha (1,3) Fucosyltransferase)

Aliases
for FUT6 gene

Summaries
for FUT6 gene

Genomic Views
for FUT6 gene

Proteins
for FUT6 gene

Protein Domains /
Families
for FUT6 gene

Function
for FUT6 gene

Pathways & Interactions
for FUT6 gene

Drugs & Compounds
for FUT6 gene

Transcripts
for FUT6 gene

Expression
for FUT6 gene

Orthologs
for FUT6 gene

Paralogs
for FUT6 gene

Genomic Variants
for FUT6 gene

Disorders / Diseases
for FUT6 gene

Publications
for FUT6 gene

External Searches for FUT6 gene

Genome Databases showing FUT6 gene

Other Databases showing FUT6 gene

Specialized Databases showing FUT6 gene

Intellectual Property
for FUT6 gene

Products
for FUT6 gene

View Random Gene

Advanced Search

Export list of displayed genes

FUT6 Gene

Fucosyltransferase 6 (Alpha (1,3) Fucosyltransferase)

Aliasesfor FUT6 gene

Summariesfor FUT6 gene

Genomic Viewsfor FUT6 gene

Proteinsfor FUT6 gene

Protein Domains /Familiesfor FUT6 gene

Functionfor FUT6 gene

Pathways & Interactionsfor FUT6 gene

Drugs & Compoundsfor FUT6 gene

Transcriptsfor FUT6 gene

Expression for FUT6 gene

Orthologsfor FUT6 gene

Paralogsfor FUT6 gene

Genomic Variantsfor FUT6 gene

Disorders / Diseasesfor FUT6 gene

Publicationsfor FUT6 gene

External Searches for FUT6 gene

Genome Databases showing FUT6 gene

Other Databases showing FUT6 gene

Specialized Databases showing FUT6 gene

Intellectual Propertyfor FUT6 gene

Productsfor FUT6 gene

View Random Gene

Aliases
for FUT6 gene

Summaries
for FUT6 gene

Genomic Views
for FUT6 gene

Proteins
for FUT6 gene

Protein Domains /
Families
for FUT6 gene

Function
for FUT6 gene

Pathways & Interactions
for FUT6 gene

Drugs & Compounds
for FUT6 gene

Transcripts
for FUT6 gene

Expression
for FUT6 gene

Orthologs
for FUT6 gene

Paralogs
for FUT6 gene

Genomic Variants
for FUT6 gene

Disorders / Diseases
for FUT6 gene

Publications
for FUT6 gene

Intellectual Property
for FUT6 gene

Products
for FUT6 gene