Home
GeneCards Guide
Suite
- MalaCards
- GeneALaCart
- GeneDecks
- GeneIP
- GeneLoc
Terms and Conditions
- Terms of Use
- 3rd Party Notice
About Us
User Feedback
Mirror sites

Set Analyses:

Generates a file of GeneCards annotations for your list of genes

Advanced Search

Search By

Section (entire)

for

All GeneCards Within gene subset (to enable gene prioritization):
or upload a file of gene symbols

Category Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21

GIFtS
-

FUT6 Gene

protein-coding GIFtS: 60
GCID: GC19M005830

fucosyltransferase 6 (alpha (1,3) fucosyltransferase)

Explore 13 diseases affiliated with
FUT6 via

MalaCards

our new
Human Malady Compendium

(According to ¹HGNC, ²Entrez Gene,
³UniProtKB/Swiss-Prot, ⁴UniProtKB/TrEMBL, ⁵OMIM, ⁶GeneLoc, ⁷Ensembl, ⁸DME, ⁹miRBase, and/or ¹⁰fRNAdb)
About This Section

Aliases
Fucosyltransferase 6 (Alpha (1,3) Fucosyltransferase)¹ ²		Fuc-TVI² ³
FCT3A¹ ² ³		EC 2.4.1.65³ ⁸
FucT-VI¹ ² ³		FLJ40754¹
FT1A¹ ²		Alpha-(1,3)-Fucosyltransferase¹
Fucosyltransferase VI² ³		Fucosyltransferase 6³
Galactoside 3-L-Fucosyltransferase² ³		EC 2.4.1⁸

External Ids:	HGNC: 4017¹	Entrez Gene: 2528²	Ensembl: ENSG00000156413⁷	OMIM: 136836⁵	UniProtKB: P51993³

Export aliases for FUT6 gene to outside databases

Previous GC identifers: GC19M005922 GC19M005771 GC19M005781 GC19M005759 GC19M005590

(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for FUT6:

The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X,

an E-selectin ligand. Mutations in this gene are a cause of fucosyltransferase-6 deficiency. Two transcript variants

encoding the same protein have been found for this gene. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Function: Enzyme involved in the biosynthesis of the E-Selectin ligand, sialyl-Lewis X. Catalyzes the transfer of

fucose from GDP-beta-fucose to alpha-2,3 sialylated substrates

Gene Wiki entry for FUT6

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section

RefSeq DNA sequence:

NC_000019.9 NC_018930.1 NT_011255.14

Regulatory elements:

SABiosciences Regulatory transcription factor binding sites in the FUT6 gene promoter:
c-Fos HOXA9 HOXA9B AP-1 C/EBPalpha Meis-1b Pax-3 CP2 c-Jun Meis-1
Other transcription factors

SwitchGear Promoter luciferase reporter plasmids (see all 2): FUT6 promoter sequence

Search SABiosciences Chromatin IP Primers for FUT6

Epigenetics:

QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FUT6

Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 19p13.3 Ensembl cytogenetic band: 19p13.3 HGNC cytogenetic band: 19p13.3

FUT6 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FUT6 gene location

GeneLoc information about chromosome 19 GeneLoc Exon Structure

GeneLoc location for GC19M005830: view genomic region (about GC identifiers)

Start:	5,830,621 bp from pter	End:	5,839,742 bp from pter
Size:	9,122 bases	Orientation:	minus strand

(According to ¹UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to ²PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993 (See protein sequence)

Recommended Name: Alpha-(1,3)-fucosyltransferase

Size: 359 amino acids; 41860 Da

Subcellular location: Golgi apparatus, Golgi stack membrane; Single-pass type II membrane protein. Note=Membrane-bound

form in trans cisternae of Golgi

Sequence caution: Sequence=AAC50191.1; Type=Miscellaneous discrepancy; Note=Probable cloning artifact;

Secondary accessions: A6NEX0 D6W637 Q9UND8

Alternative splicing: 2 isoforms: P51993-1 P51993-2

Explore the universe of human proteins at neXtProt for FUT6: NX_P51993

Post-translational modifications:

View modification sites using PhosphoSitePlus²

View neXtProt modification sites for NX_P51993

4/19 DME Specific Peptides for FUT6 (P51993) (see all 19)

VPVVLGP

CFFSYLR

FIHVDDF

ADCNITA

FUT6 Protein expression data from MOPED and PaxDb: About this image

REFSEQ proteins (2 alternative transcripts):

NP_000141.1 NP_001035791.1

ENSEMBL proteins:

ENSP00000431708 ENSP00000432954 ENSP00000286955 ENSP00000466016 ENSP00000436547

ENSP00000432161 ENSP00000436413 ENSP00000431880 ENSP00000433811 ENSP00000313398

Human Recombinant Protein Products:

	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse R&D Systems for human recombinant proteins
	Browse recombinant and purified proteins available from Enzo Life Sciences
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells OriGene Protein Over-expression Lysate (see all 3): FUT6 OriGene Custom Protein Services for FUT6
	GenScript Custom Purified and Recombinant Proteins Services for FUT6
	Novus Biologicals FUT6 Protein Novus Biologicals FUT6 Lysates
	Browse Sino Biological Recombinant Proteins
	Browse ProSpec Recombinant Proteins
	Uscn Proteins for FUT6

Gene Ontology (GO): 4 cellular component terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0005794	Golgi apparatus	TAS	11698403
GO:0016020	membrane	--	--
GO:0016021	integral to membrane	IEA	--
GO:0032580	Golgi cisterna membrane	IEA	--

FUT6 for ontologies About GeneDecksing

FUT6 Antibody Products:

	EMD Millipore Mono- and Polyclonal Antibodies for the study of FUT6
	Browse R&D Systems for Antibodies
	Browse OriGene Antibodies OriGene Custom Antibody Services for FUT6
	GenScript Custom Superior Antibodies Services for FUT6
	Novus Biologicals FUT6 Antibodies
	Search for Antibodies for FUT6 at Abcam
	Uscn Antibodies for FUT6
	ThermoFisher Antibody for FUT6

Assay Products for FUT6:

	Browse Kits and Assays available from EMD Millipore
	OriGene Custom Immunoassay Development Browse OriGene Fluorogenic Cell Assay Kits
	Browse R&D Systems for biochemical assays
	GenScript Custom Assay Services for FUT6
	Browse Enzo Life Sciences for kits & assays
	Uscn ELISAs and CLIAs for FUT6

(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

FUT6 for domains About GeneDecksing

1 InterPro domain/family:

IPR001503 Glyco_trans_10

Graphical View of Domain Structure for InterPro Entry P51993

ProtoNet protein and cluster: P51993

1 Blocks protein family: IPB001503 Glycosyl transferase

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Similarity: Belongs to the glycosyltransferase 10 family

(According to ¹UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or ²DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

Function Summary:

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Function: Enzyme involved in the biosynthesis of the E-Selectin ligand, sialyl-Lewis X. Catalyzes the transfer of

fucose from GDP-beta-fucose to alpha-2,3 sialylated substrates

Catalytic activity: GDP-beta-L-fucose + beta-D-galactosyl-(1->3)-N-acetyl-D-glucosaminyl-R = GDP +

beta-D-galactosyl-(1->3)-(alpha-L-fucosyl-(1->4))-N-acetyl-beta-D-glucosaminyl-R

Genatlas biochemistry entry for FUT6:

fucosyltransferase,alpha-(1,3),6 (FucT-VI),plasma type,responsible for the alpha 3-fucosylation of glycoproteins

produced in liver as suggested by the total absence of alpha 3 fucosylated-alpha 1-glycoproteins in patients with a

FUT6 missense mutation,with a high allelic diversity,ethnic specific

Enzyme Numbers (IUBMB): EC 2.4.1.65¹ ² EC 2.4.1²

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FUT6
		1 QIAGEN miScript miRNA Assays for microRNA that regulate FUT6:
		hsa-miR-875-3p
		SwitchGear 3'UTR luciferase reporter plasmid: FUT6 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FUT6 OriGene shRNA RFP: FUT6 OriGene siRNA: FUT6
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUT6

Gene Editing
Products:

DNA2.0 Custom Protein Engineering Service for FUT6

Clone Products:		Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FUT6 (see all 2) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FUT6 (see all 2) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): FUT6 (NM_000150)
		Browse Sino Biological Human cDNA Clones
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUT6
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUT6

Cell Line Products:		GenScript Custom overexpressing Cell Line Services for FUT6
		Search LifeMap BioReagents cell lines for FUT6

In Situ Assay
Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUT6

Gene Ontology (GO): 3 molecular function terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0008417	fucosyltransferase activity	TAS	8175676
GO:0017060	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity	IEA	--
GO:0046920	alpha-(1->3)-fucosyltransferase activity	TAS	11698403

FUT6 for ontologies About GeneDecksing

1 GenomeRNAi human phenotype for FUT6:

Increased S DNA content

(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to ¹UniProtKB, ²MINT, ³I2D, and/or ⁴STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section

Unified GeneCards pathways About this table

See pathways by source

Super-pathway

contained gene-specific pathways

Glycosphingolipid biosynthesis - lacto and neolacto series

Glycosphingolipid biosynthesis - lacto and neolacto series

1.00

Metabolism

Metabolic pathways

0.38

Pathway sources
See GeneCards unified pathways
Show all pathways

2 Kegg Pathways (Kegg details for FUT6):

	Glycosphingolipid biosynthesis - lacto and neolacto series
	Metabolic pathways

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Pathway: Protein modification; protein glycosylation

FUT6 for pathways About GeneDecksing

Interactions:

Search SABiosciences Gene Network Central^TM Interacting Genes and Proteins Networks for FUT6

STRING Interaction Network Preview (showing 5 interactants - click image to see 16)

5/16 Interacting proteins for FUT6 (ENSP00000286955⁴) via UniProtKB, MINT, STRING, and/or I2D (see all 16)

Interactant		Interaction Details
GeneCard	External ID(s)	Interaction Details
B3GNT2	ENSP00000305595⁴	STRING: ENSP00000305595
B4GALT1	ENSP00000369055⁴	STRING: ENSP00000369055
B4GALT2	ENSP00000349293⁴	STRING: ENSP00000349293
B4GALT3	ENSP00000320965⁴	STRING: ENSP00000320965
FUT1	ENSP00000312021⁴	STRING: ENSP00000312021

About this table

Gene Ontology (GO): 3 biological process terms (GO ID links to tree view): About this table

GO ID	Qualified GO term	Evidence	PubMed IDs
GO:0006486	protein glycosylation	TAS	11698403
GO:0036065	fucosylation	TAS	8175676
GO:0042355	L-fucose catabolic process	NAS	11698403

FUT6 for ontologies About GeneDecksing

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section

FUT6 for compounds About GeneDecksing

Browse Small Molecules at EMD Millipore

Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for FUT6

2 HMDB Compounds for FUT6 About this table

Compound	Synonyms	CAS #	PubMed Ids
GDP-L-fucose	GDP-beta-L-fucose (see all 5)	15839-70-0	--
Guanosine diphosphate	5'-GDP (see all 10)	146-91-8	--

5 Novoseek chemical compound relationships for FUT6 gene About this table

Compound	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
slex	67.2	2	7630015 (1), 12725333 (1)
polylactosamine	66.4	1	10622713 (1)
n-acetyllactosamine	54.8	1	10891123 (1)
n-ethylmaleimide	34.2	1	9042366 (1)
n-acetylglucosamine	32	1	10052591 (1)

Search CenterWatch for drugs/clinical trials and news about FUT6

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for FUT6 gene (2 alternative transcripts):

NM_000150.2 NM_001040701.1

Unigene Clusters for FUT6:

Fucosyltransferase 6 (alpha (1,3) fucosyltransferase)

Hs.631846 [show with all ESTs], Hs.705615 [show with all ESTs]

Unigene Representative Sequences: NM_000150, U27331

12 Ensembl transcripts including schematic representations, and UCSC links where relevant:

ENST00000524754(uc021unl.1) ENST00000527106 ENST00000286955 ENST00000592563

ENST00000529165 ENST00000531085 ENST00000531199 ENST00000532464 ENST00000528505

ENST00000526499 ENST00000591079 ENST00000318336(uc002mdf.1 uc002mdg.1 uc002mdh.1)

miRNA Products:		Browse 3'-UTR reporter clones for miRNA target validation Browse OriGene MicroRNA Expression Plasmids
		QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FUT6
		1 QIAGEN miScript miRNA Assays for microRNA that regulate FUT6:
		hsa-miR-875-3p
		SwitchGear 3'UTR luciferase reporter plasmid: FUT6 3' UTR sequence

Inhib. RNA Products:		Browse for Gene Knock-down Tools from EMD Millipore
		OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FUT6 OriGene shRNA RFP: FUT6 OriGene siRNA: FUT6
		QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUT6

Clone Products:		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FUT6 (see all 2) OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FUT6 (see all 2) OriGene custom cloning services � gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
		GenScript: all cDNA clones in your preferred vector (see all 2): FUT6 (NM_000150)
		DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUT6
		Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUT6

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FUT6 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat FUT6
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUT6
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUT6

Additional cDNA sequence: U27331.1

9 DOTS entries:

DT.95243192 DT.86994016 DT.99952233 DT.100019203 DT.100750043 DT.75105001 DT.97777317 DT.99978277

DT.121449794

22 AceView cDNA sequences:

U27332 U27331 BV198781 U27336 BX113350 AL702935 AW614132 M98825

BC061700 BM756773 AF131211 BV198591 AK098073 BG432556 AI672482 AI952786

AU098944 BG952128 BE833439 BG402446 AW176527 BV198613

GeneLoc Exon Structure

4 Alternative Splicing Database (ASD) splice patterns (SP) for FUT6 About this scheme

ExUns:	1a	·	1b	^	2	^	3a	·	3b	^	4	^	5	^	6a	·	6b	·	6c	·	6d	^	7
SP1:					-
SP2:					-				-		-		-
SP3:									-		-		-
SP4:

ECgene alternative splicing isoforms for FUT6

(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

FUT6 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: ATGGCACGTG

About this image
See FUT6 Protein Expression from SPIRE MOPED and PaxDB
Genevestigator expression for FUT6

SOURCE GeneReport for Unigene clusters: Hs.631846 Hs.705615

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Tissue specificity: Kidney, liver, colon, small intestine, bladder, uterus and salivary gland

SABiosciences Custom PCR Arrays for FUT6

Primer Products:		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FUT6 Browse OriGene validated miRNA SYBR primer pairs
		SABiosciences RT² qPCR Primer Assay in human, mouse / rat FUT6
		QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUT6
		QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUT6

In Situ
Assay Products:

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUT6

(Orthologs according to ^1,2HomoloGene (²older version, for species not in ¹newer version), ³euGenes, ⁴SGD , ⁵MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or ⁶Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section

This gene was present in the common ancestor of animals.

Orthologs for FUT6 gene from 6/16 species (see all 16) About this table

Organism	Taxonomic classification	Gene	Description	Human Similarity	Orthology Type	Details
chicken (Gallus gallus)	Aves	F1NTW7_CHICK⁶ Q8UWB9_CHICK⁶ (see all 3)	Uncharacterized protein fucosyltransferase 7 (alpha (1,3) fucosyltransfera... (see all 3)	49(a) 34(a) (see all 3)	possible ortholog 1 ↔ many (see all 3)	28(1106979-1108076) 17(838136-839179)
lizard (Anolis carolinensis)	Reptilia	FUT10⁶	--	14(a)	possible ortholog	GL343339.1(1146655-1163889)
African clawed frog (Xenopus laevis)	Amphibia	LOC399049²	alpha 1,3/4 fucosyltransferase Lewis 1	74.41(n)		AJ580005.1
zebrafish (Danio rerio)	Actinopterygii	CT485993.1⁶ CABZ01086789.1⁶	--	36(a) 33(a)	possible ortholog possible ortholog	17(15480578-15481706) 5(26911359-26912408)
honey bee (Apis mellifera)	Insecta	--	--	21(a)	possible ortholog	Group1.53(187696-192664)
worm (Caenorhabditis elegans)	Secernentea	fut-4¹	Protein FUT-4	42.45(n) 32.53(a)		187342 NM_061971.3 NP_494372.2

ENSEMBL Gene Tree for FUT6 (if available)
TreeFam Gene Tree for FUT6 (if available)

(Paralogs according to ¹HomoloGene,
²Ensembl, and ³SIMAP, Pseudogenes according to ⁴Pseudogene.org Build 68)
About This Section

Paralogs for FUT6 gene

FUT5² FUT4² FUT7² FUT3² FUT10² FUT11² FUT9²

5 SIMAP similar genes for FUT6 using alignment to 7 protein entries: FUT6_HUMAN (see all proteins):

FUT5 FUT3 FUT9 FUT7 FUT4

FUT6 for paralogs About GeneDecksing

(SNPs/Variants according to the ¹NCBI SNP Database, ²Ensembl, ³PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

UniProtKB/Swiss-Prot: FUT6_HUMAN, P51993

Polymorphism: Expression of alpha(1,3)-fucosyltransferase in plasma can vary among different populations. 9% of

individuals on the isle of Java (Indonesia) do not express this enzyme. Ninety-five percent of plasma

alpha(1,3)-fucosyltransferase-deficient individuals have Lewis negative phenotype on red cells, suggesting strong

linkage disequilibrium between these two traits. Variations in FUT6 are responsible for plasma

alpha(1,3)-fucosyltransferase deficiency [MIM:613852]

SNP ID	Valid	Clinical significance	Chr 19 pos	Sequence	#	AA Chg	Type	More	#	Allele freq	Pop	Total sample	More
Genomic Data					Transcription Related Data				Allele Frequencies
				--	--	--		--	--
rs17855739^1,2	C,F,	pathogenic	5591688(-)	`CCTTCG/AAGAAC`	4	/K /E	mis¹ ese³		4		NA EU	5867
rs111912575^1,2	C,F,	--	5590447(+)	`CCACCG/ACACCC`	2	--	ds500¹		2		WA CSA	4
rs778806^1,2	C,F,H,	--	5590777(-)	`GCAAAG/AAAAAC`	2	--	ut3¹		8		NS EA WA	1208
rs116794036^1,2	C,F,	--	5591044(+)	`GTCCCC/TAGGAG`	2	--	ut3¹		1		WA	118
rs443907^1,2	A,	--	5591734(-)	`CAGGGA/GACCAT`	4	G	syn¹ ese³		1		NA	2
rs364637^1,2	C,F,A,H,	--	5591739(-)	`TGCCCC/AAGGGA`	4	/K /Q	mis¹ ese³		10		EA NA NS MN	5212
rs3964631^1,2	H,	--	5591823(-)	`GGCCAA/GACTCC`	4	N D	mis¹		4		NS EA	414
rs4041473^1,2	H,	--	5591824(-)	`GGGCCA/GAACTC`	4	P	syn¹		4		NS EA	420
rs2879401^1,2		--	5591828(-)	`CTGGGA/GGCCAA`	4	E G	mis¹		0	--	--	--	--
rs111494384^1,2	F	--	5591900(+)	`GCTGGC/ACGGAC`	4	/G /V	mis¹		1		CSA	4
rs111589452^1,2	F	--	5592051(+)	`CTGCCG/ACCTCG`	4	/R /W	mis¹		1		CSA	4
rs112849079^1,2	F	--	5592255(+)	`GTGGGC/TGGGGG`	4	T A	mis¹		1		CSA	4
rs113764706^1,2		--	5592364(+)	`TGAAAC/TAGCAG`	4	L	syn¹		1		CSA	2
rs73536616^1,2	C,F,	--	5592785(+)	`AGCCGA/GTCATA`	2	--	int¹		4		WA CSA EA	242
rs74421545^1,2	F,	--	5592961(+)	`GGAGAG/CACCCC`	2	--	int¹		1		NA	120
rs111342270^1,2	C,F,	--	5593307(+)	`CGCACC/TGCTGC`	2	--	int¹		2		WA CSA	4
rs112641207^1,2	C,F,	--	5593469(+)	`CCAACG/ATGGTG`	2	--	int¹		2		WA CSA	4
rs113769774^1,2	C,F,	--	5593535(+)	`TAATCC/ACAGCT`	2	--	int¹		2		WA CSA	4
rs73536626^1,2	C,F,	--	5593774(+)	`TAACTT/AGAGGT`	2	--	int¹		6		WA CSA EA	246
rs80053250^1,2	C,F,	--	5593846(+)	`ATTAGC/TTGGGC`	2	--	int¹		4		WA CSA	8
rs113180603^1,2		--	5593978(+)	`AGAGCG/AAGACC`	2	--	int¹		1		CSA	2
rs73536629^1,2	C,F,	--	5594029(+)	`NNNNCA/GGGGTT`	2	--	int¹		6		WA CSA NA EA	364
rs10403115^1,2	C,F,H,	--	5594193(+)	`AGAAGC/AAGGCT`	2	--	int¹		10		NS EA NA WA	1094
rs113426773^1,2		--	5595224(+)	`CAGACT/CCCAAA`	2	--	int¹		1		CSA	1
rs75998859^1,2		--	5598471(+)	`GATCCG/AGGTTG`	2	--	int¹		1		NA	120
rs73920069^1,2	C,F,	--	5598546(+)	`GAGGCC/TGCGGA`	2	--	ut5¹		3		WA CSA	122
rs116792659^1,2	C,F,	--	5598653(+)	`AACCAC/ACACAC`	2	--	ut5¹		1		WA	118
rs79484447^1,2		--	5599605(+)	`TGCAAA/GGGTGA`	2	--	us2k¹		1		NA	120
rs112358826^1,2	C,	--	5599756(+)	`TGGGCC/TAGGGG`	2	--	us2k¹		1		NA	2
rs16993228^1,2	C,F,H,	--	5599795(+)	`GCAACC/ATAATT`	2	--	us2k¹		18		NA NS EA	1882
rs778799^1,2	A	--	5600131(+)	`tgggcA/Gacagt`	2	--	us2k¹		0	--	--	--	--
rs113701779^1,2	C,	--	5600604(+)	`CTGGGTTCT/- TTTTT`	2	--	us2k¹		1		CSA	2
rs75243301^1,2	F,	--	5600977(+)	`GTCATT/CCCATC`	2	--	us2k¹		1		EA	120
rs59993317^1,2		--	5601269(+)	`GTTGGC/GGTCTT`	2	--	us2k¹		0	--	--	--	--
rs778809^1,2	C,F,O,A,H,	--	5830302(+)	`ACACCG/AGATGA`	2	--	ds500¹		35		NS EA NA WA CSA	3408
rs138096647^1,2		--	5830319(+)	`CTCTCA/TCACAC`	2	--	ds500¹		0	--	--	--	--
rs200071422^1,2		--	5830442(+)	`ACACT-/CCCCCC`	2	--	ds500¹		0	--	--	--	--
rs74254995^1,2	C,F,	--	5830447(+)	`CCCCCT/CTTTTT`	2	--	ds500¹		8		WA NA CSA	16
rs181778413^1,2		--	5830657(+)	`TCTGTC/TGCCAG`	2	--	ut3¹		0	--	--	--	--
rs185911395^1,2		--	5830704(+)	`CCTCCA/GACTCT`	2	--	ut3¹		0	--	--	--	--
rs190325668^1,2		--	5830720(+)	`TCAAGC/TGATTC`	2	--	ut3¹		0	--	--	--	--
rs778807^1,2	C,H,	--	5830779(-)	`TTTGCT/CGGGCG`	2	--	ut3¹ ese³		4		NA WA CSA	7
rs35845041^1,2	C,	--	5830799(+)	`TTTTAG/ATAGAG`	2	--	ut3¹		1		NA	2
rs188390343^1,2		--	5830806(+)	`AGAGAC/TGGGTT`	2	--	ut3¹		0	--	--	--	--
rs138814800^1,2		--	5830910(+)	`GCACCC/TGGCCT`	2	--	ut3¹		0	--	--	--	--
rs12986368^1,2	C,F,H,	--	5830922(+)	`ATCATC/TGGTTT`	2	--	ut3¹ ese³		13		NS EA NA WA	912
rs142774588^1,2		--	5830987(+)	`ACAGGC/TGGCTA`	2	--	ut3¹		0	--	--	--	--
rs191083363^1,2		--	5831000(+)	`AACATC/TACAAA`	2	--	ut3¹		0	--	--	--	--
rs182930080^1,2		--	5831101(+)	`TGAGGC/TTCCTA`	2	--	ut3¹		0	--	--	--	--
rs186655016^1,2		--	5831107(+)	`TCCTAC/GCAGGT`	2	--	ut3¹		0	--	--	--	--
rs147377203^1,2		--	5831251(+)	`CCAGCA/TTGTGA`	2	--	ut3¹		0	--	--	--	--
rs150572233^1,2	C,F,	--	5831515(+)	`AAGCCG/TCTATG`	4	E A	mis¹		1		NA	4546
rs201278961^1,2	C,	--	5831525(+)	`GCCGCG/ATGTCT`	4	/R /C	mis¹		1		EU	1323
rs192545727^1,2	C,	--	5831556(+)	`AGTTTC/TCAGCA`	4	* W	stg¹		0	--	--	--	--
rs61740561^1,2	C,F,,	--	5831577(+)	`AAAGCG/CAGTGC`	4	/L	syn¹		7		NS CSA WA NA EU	6014
rs61739552^1,2	C,F,	--	5831602(+)	`GAGGCC/TGCAGC`	4	Q R	mis¹		3		NS NA EU	5907
rs61739551^1,2	C,F,	--	5831608(+)	`GCAGCG/ATCTCC`	4	/T /M	mis¹		3		NS NA EU	5671
rs145035679^1,2	C,F,	--	5831634(+)	`CTCAGG/TTAGCG`	4	* Y	stg¹		2		NA EU	5845
rs61147939^1,2	C,F,	--	5831672(+)	`GTACCG/CGGCCA`	4	/R /G	mis¹		2		NA EU	5273
rs141055382^1,2	F	--	5831697(+)	`TGGAAG/ATCGTC`	4	/D	syn¹		1		NA	4146
rs62110261^1,2	C,F,	--	5831700(+)	`AAGTCG/ATCCAC`	4	/D	syn¹		2		NA EU	5023
rs112313064^1,2	C,F,	--	5831724(+)	`TCGGGT/CGGCAG`	4	/P	syn¹		3		WA NA EU	3557
rs146941796^1,2	C,F,	--	5831725(+)	`CGGGTG/AGCAGG`	4	/P /L	mis¹		1		NA	3632
rs150055699^1,2	C,F,	--	5831769(+)	`ACCACG/AGGCAC`	4	/P	syn¹		1		NA	3746
rs199718441^1,2		--	5831810(+)	`CTTCTC/TGGTGA`	4	K E	mis¹		0	--	--	--	--
rs141349215^1,2	C,F,	--	5831841(+)	`TTCTCG/AAAGGC`	4	/F	syn¹		2		NA EU	5876
rs79359759^1,2	C,F,	--	5831850(+)	`GCCAGA/GTAGAA`	4	Y	syn¹		2		CSA NA	4554
rs146077344^1,2	C,	--	5831872(+)	`ACAGCG/ATCTCC`	4	/T /M	mis¹		1		NA	4552
rs141945646^1,2	F	--	5831912(+)	`GGAGCG/ATCCGT`	4	/R /C	mis¹		1		NA	4550
rs146312446^1,2	F	--	5831915(+)	`GCGTCC/TGTACA`	4	R G	mis¹		1		NA	4550
rs192315992^1,2	C,	--	5831921(+)	`GTACAC/TGTCCA`	4	M V	mis¹		0	--	--	--	--
rs364587^1,2	C,F,	--	5831937(-)	`CAGGCC/TCATCT`	4	A	syn¹ ese³		5		MN NA EU	6061
rs445878^1,2	C,,	--	5831970(+)	`CTGGCA/C/G/T GAGTT`	8	S	syn¹ ese³		3		NA	4554
rs401508^1,2	C,	--	5831994(+)	`GACACT/CGCCCA`	4	/A	syn¹ ese³		4		NA MN	4726
rs146819588^1,2	C,F,	--	5832028(+)	`AGAGGT/CTGAGC`	4	/N /S	mis¹		1		NA	4488
rs145009020^1,2	C,F	--	5832041(+)	`TGGGTG/AGGCAG`	4	/H /Y	mis¹		2		NA EU	5711
rs150924444^1,2	C,	--	5832054(+)	`TGGCCG/AGACCA`	4	/S	syn¹		1		NA	4422
rs150560931^1,2	C,	--	5832077(+)	`CCGTA-/GGGGCG`	4	PY PLR	fra¹		0	--	--	--	--
rs201634023^1,2		--	5832202(+)	`CCTGCC/TGCCTC`	4	Q R	mis¹		0	--	--	--	--
rs185108416^1,2	C,	--	5832207(+)	`CGCCTC/TGGGGA`	4	P	syn¹		0	--	--	--	--
rs778805^1,2	C,F,A,H,	--	5832209(-)	`GCTCCC/TCGAGG`	4	P S	mis¹		27		NS EA NA CSA WA EU	8401
rs189959983^1,2		--	5832210(+)	`CTCGGA/GGAGCG`	4	S	syn¹		0	--	--	--	--
rs138645125^1,2	C,F,	--	5832215(+)	`GGAGCG/ATGGGA`	4	/R /C	mis¹		2		NA EU	5867
rs115405004^1,2	C,	--	5832219(+)	`CGTGGG/AAGCTG`	4	/L	syn¹		2		WA NA	4668
rs114460969^1,2	C,F,	--	5832243(+)	`TACATG/TACCTC`	4	V	syn¹		2		WA NA	4668
rs192615441^1,2	C,	--	5832251(+)	`CTCTCC/GGTGGT`	4	R G	mis¹		0	--	--	--	--
rs138857915^1,2	F	--	5832267(+)	`ATGACC/TGCGTC`	4	A	syn¹		1		NA	4550
rs150692510^1,2	C,	--	5832375(+)	`GGCCAC/TGTCCA`	4	T	syn¹		1		NA	4546
rs141062404^1,2	C	--	5832461(+)	`GGGATC/TGTCTT`	4	N D	mis¹		1		NA	4530
rs202215473^1,2		--	5832464(+)	`ATCGTC/TTTGAG`	4	N D	mis¹		0	--	--	--	--
rs144807324^1,2	C,F	--	5832475(+)	`ACACAC/TGCAGA`	4	H R	mis¹		1		NA	4518
rs201524447^1,2		--	5832476(+)	`CACACA/GCAGAT`	4	R C	mis¹		0	--	--	--	--
rs143668927^1,2	C,F,	--	5832561(+)	`TTGGCC/TGGGCC`	4	P	syn¹		1		NA	4490
rs9807877^1,2	C,F,	--	5832589(+)	`AGAGTA/CTCTGG`	2	--	ut5¹		17		NA WA CSA EA EU	1811
rs778804^1,2	C,F,A,H,	--	5832692(-)	`CTGTGA/TAACAG`	2	--	int¹		13		NA WA CSA EA	379
rs78060698^1,2	F,	--	5832773(+)	`GCCCAG/AAGTCC`	2	--	int¹		3		WA NA EA	358
rs148081894^1,2		--	5832797(+)	`CATTAA/GACAAC`	2	--	int¹		0	--	--	--	--
rs140902372^1,2		--	5832845(+)	`TGGGAA/GAGGCC`	2	--	int¹		0	--	--	--	--
rs3916080^1,2	C,F,A,H,	--	5832899(-)	`TCTGGG/TGACAC`	2	--	int¹		18		NA EA NS	1820
rs187996741^1,2		--	5832935(+)	`ACAGCC/TGATCA`	2	--	int¹		0	--	--	--	--
rs116156270^1,2	F,	--	5832966(+)	`TGAGTC/TGAGGC`	2	--	int¹		1		WA	118
rs181895181^1,2		--	5832982(+)	`CCCATA/GACTCT`	2	--	int¹		0	--	--	--	--
rs3859563^1,2	C,F,A,H,	--	5833037(-)	`CTGGTA/GAGCTC`	2	--	int¹		31		NS EA NA WA CSA	2988
rs186454128^1,2		--	5833064(+)	`GGAAAC/GGGTGC`	2	--	int¹		0	--	--	--	--
rs150165046^1,2		--	5833156(+)	`TCAGGA/GCTGCC`	2	--	int¹		0	--	--	--	--
rs189299112^1,2		--	5833273(+)	`GAAGCC/TGAGGC`	2	--	int¹		0	--	--	--	--
rs10420107^1,2	C,F,	--	5833279(+)	`GAGGCG/AGGCAG`	2	--	int¹		5		NA WA CSA	10
rs142805855^1,2		--	5833296(+)	`AGGTCA/GAGAGA`	2	--	int¹		0	--	--	--	--
rs182076858^1,2		--	5833427(+)	`CCTGGC/GGGGTG`	2	--	int¹		0	--	--	--	--
rs186630068^1,2		--	5833430(+)	`GGGGGA/GTGGAG`	2	--	int¹		0	--	--	--	--
rs138026647^1,2		--	5833550(+)	`TGCCTA/GTAATC`	2	--	int¹		0	--	--	--	--
rs10402728^1,2	C,F,A,	--	5833622(+)	`CAACGC/TGGTGA`	2	--	int¹		6		NA WA CSA	12
rs142996053^1,2		--	5833785(+)	`GGACAA/CAGAAT`	2	--	int¹		0	--	--	--	--
rs191474144^1,2		--	5833880(+)	`GCTCAC/TGACTG`	2	--	int¹		0	--	--	--	--
rs34940903^1,2	C,F,	--	5833949(+)	`ACCAGC/TGTGGT`	2	--	int¹		7		WA NA EA	366
rs12460874^1,2	C,F,H,	--	5833967(+)	`GAGAAC/TCCACA`	2	--	int¹		6		NA WA EA	364
rs11305548^1,2	C,	--	5834149(+)	`AAAAGA/-AAAAA`	2	--	int¹ trp³		2		NA CSA	4
rs201818635^1,2	C	--	5834149(+)	`AAAAGA/GAAAAA`	2	--	int¹		0	--	--	--	--
rs17271883^1,2	C,F,H,	--	5834212(+)	`GGTTAC/TTCCTC`	2	--	int¹		30		NA NS EA WA CSA	2910
rs182801390^1,2		--	5834215(+)	`TACTCC/TTCTGG`	2	--	int¹		0	--	--	--	--
rs137858664^1,2	C,	--	5834251(+)	`GGACA-/GATAGGAGGGAGAAT AGGCAGGCGTGGGGACCGATAG`	2	--	int¹		0	--	--	--	--
rs9807817^1,2	C	--	5834282(+)	`GGGACA/C/TGATAG`	2	--	int¹		0	--	--	--	--
rs185319450^1,2		--	5834305(+)	`GCAGGC/TGTGGG`	2	--	int¹		0	--	--	--	--
rs190028992^1,2		--	5834479(+)	`TCCCCC/TGGAGT`	2	--	int¹		0	--	--	--	--
rs143814846^1,2		--	5834546(+)	`GCTCAC/TGCCTG`	2	--	int¹		0	--	--	--	--
rs5826905^1,2	C,	--	5834823(+)	`ACAAC-/AAAAAA`	2	--	int¹		0	--	--	--	--
rs35061054^1,2	C	--	5834826(+)	`AAAAA-/ACAAAA`	2	--	int¹		0	--	--	--	--
rs146838879^1,2		--	5834942(+)	`GGACCC/TTTGGA`	2	--	int¹		0	--	--	--	--
rs114239131^1,2	F,	--	5835120(+)	`ACTGTG/TTCCGT`	2	--	int¹		1		WA	118
rs182260582^1,2		--	5835245(+)	`GACCCC/TAGATC`	2	--	int¹		0	--	--	--	--
rs140627364^1,2		--	5835258(+)	`GACCTC/TGGGAA`	2	--	int¹		0	--	--	--	--
rs188029579^1,2		--	5835308(+)	`TGCAGA/CCCTAC`	2	--	int¹		0	--	--	--	--
rs150006352^1,2		--	5835327(+)	`ATTCTA/GCAGAT`	2	--	int¹		0	--	--	--	--
rs193059412^1,2		--	5835345(+)	`CTAAGA/GCTCAG`	2	--	int¹		0	--	--	--	--
rs114914894^1,2	F,	--	5835461(+)	`CAGATG/AGAGCT`	2	--	int¹		1		WA	118
rs149138148^1,2		--	5835569(+)	`GTGGGC/TGGATT`	2	--	int¹		0	--	--	--	--
rs12019136^1,2		--	5835677(+)	`TACTCA/GGGAGG`	2	--	int¹		0	--	--	--	--
rs141399491^1,2		--	5835723(+)	`AGGTTG/TCAGTG`	2	--	int¹		0	--	--	--	--
rs183761652^1,2		--	5835740(+)	`GATTGC/TACCAT`	2	--	int¹		0	--	--	--	--
rs188241965^1,2		--	5835780(+)	`ACTCCA/GTCTCA`	2	--	int¹		0	--	--	--	--
rs146989239^1,2		--	5835941(+)	`GTCGCC/TCAGAC`	2	--	int¹		0	--	--	--	--
rs192934379^1,2		--	5836043(+)	`TACAAC/GTGTGC`	2	--	int¹		0	--	--	--	--
rs184569848^1,2		--	5836084(+)	`TAGTAA/GAGACG`	2	--	int¹		0	--	--	--	--
rs118074313^1,2	F,	--	5836163(+)	`GCCTCC/TCAAAG`	2	--	int¹		1		EA	120
rs188543315^1,2		--	5836204(+)	`CCGGCA/CTGGCT`	2	--	int¹		0	--	--	--	--
rs139999431^1,2		--	5836227(+)	`TTTTC-/TTTTCT TTTCTTTTGTTTTC`	2	--	int¹		0	--	--	--	--
rs138092143^1,2		--	5836311(+)	`AACCTC/GCGCCT`	2	--	int¹		0	--	--	--	--
rs141699860^1,2		--	5836601(+)	`TTGGGC/TGGCTG`	2	--	int¹		0	--	--	--	--
rs191454233^1,2		--	5836609(+)	`CTGAGA/GTGGGA`	2	--	int¹		0	--	--	--	--
rs150111526^1,2		--	5836620(+)	`GGATCA/GCTTGA`	2	--	int¹		0	--	--	--	--
rs183542990^1,2		--	5836726(+)	`ACATGC/GTGGCC`	2	--	int¹		0	--	--	--	--
rs138417949^1,2		--	5836760(+)	`CTGAGG/TCAGGA`	2	--	int¹		0	--	--	--	--
rs149247815^1,2		--	5836815(+)	`TGCACC/TATTGC`	2	--	int¹		0	--	--	--	--
rs146172666^1,2		--	5836847(+)	`TGAGAC/TCGTGT`	2	--	int¹		0	--	--	--	--
rs145275499^1,2	C,	--	5836857(+)	`TCTCA-/AAAT AAATA`	2	--	int¹		0	--	--	--	--
rs1678849^1,2	C,F,H,	--	5836964(+)	`GACTGA/GTATTA`	2	--	int¹		35		NS EA NA WA CSA	3099
rs117449805^1,2	F,	--	5836980(+)	`AGTAAT/CTGGGA`	2	--	int¹		2		NA EA	240
rs140193260^1,2		--	5836989(+)	`GAAACC/TTTTGA`	2	--	int¹		0	--	--	--	--
rs61546992^1,2		--	5837197(+)	`GCGCCC/TCCCAC`	2	--	int¹		0	--	--	--	--
rs60383067^1,2	C,	--	5837285(+)	`CTCAAC/TTGACC`	2	--	int¹		1		NA	2
rs201320927^1,2		--	5837334(+)	`TGAGT-/CACCACCA`	2	--	int¹		0	--	--	--	--
rs148557976^1,2		--	5837500(+)	`GCCAGG/TCACGG`	2	--	int¹		0	--	--	--	--
rs142897039^1,2		--	5837504(+)	`GGCACA/GGTGGC`	2	--	int¹		0	--	--	--	--
rs35222081^1,2	C,F,	--	5837511(+)	`TGGCTC/TATGCC`	2	--	int¹		5		NA WA	128
rs189399461^1,2		--	5837595(+)	`ACATGC/GTGAAA`	2	--	int¹		0	--	--	--	--
rs151063460^1,2		--	5837721(+)	`GCAGTC/GAGCCA`	2	--	int¹		0	--	--	--	--
rs181960535^1,2		--	5837731(+)	`AAGGTC/TGCGCC`	2	--	int¹		0	--	--	--	--
rs199653133^1,2		--	5837804(+)	`AAAAT-/AAAATA`	2	--	int¹		0	--	--	--	--
rs139732932^1,2		--	5838003(+)	`GCTGTC/TGGGCT`	2	--	int¹		0	--	--	--	--
rs186998191^1,2		--	5838121(+)	`TTTGCC/TGGTGA`	2	--	int¹		0	--	--	--	--
rs189798285^1,2		--	5838160(+)	`GGGAAC/TGGGAG`	2	--	int¹		0	--	--	--	--
rs144630605^1,2		--	5838211(+)	`ATGATC/TGATCC`	2	--	int¹		0	--	--	--	--
rs147868544^1,2		--	5838289(+)	`CCACCA/GGGAGT`	2	--	int¹		0	--	--	--	--
rs181853100^1,2		--	5838293(+)	`CGGGAA/GTGGCA`	2	--	int¹		0	--	--	--	--
rs141468240^1,2		--	5838326(+)	`AGGAAA/GGATGA`	2	--	int¹		0	--	--	--	--
rs8101385^1,2	C,F,A,H,	--	5838595(+)	`CAGGAC/TTGAGG`	2	--	int¹		21		NS EA NA WA CSA	2348
rs185856449^1,2		--	5838618(+)	`GGCTCA/GGAGCC`	2	--	int¹		0	--	--	--	--
rs147005931^1,2		--	5838653(+)	`CGATCC/TGGGTT`	2	--	int¹		0	--	--	--	--
rs147625395^1,2		--	5838660(+)	`GGTTGG/TGGGTG`	2	--	int¹		0	--	--	--	--
rs190182678^1,2		--	5838780(+)	`ACCACA/GCAGCA`	2	--	ut5¹		0	--	--	--	--
rs182398606^1,2		--	5838923(+)	`TCCCCA/GTTGCA`	2	--	ut5¹		0	--	--	--	--
rs149084677^1,2		--	5839043(+)	`ACCACC/TGGTTC`	2	--	ut5¹		0	--	--	--	--
rs116953194^1,2		--	5839225(+)	`GAAACC/TGGTGG`	2	--	ut5¹		1		NA	120
rs143110842^1,2		--	5839426(+)	`GGAGAC/GGAGGC`	2	--	ut5¹		0	--	--	--	--
rs148224427^1,2		--	5839467(+)	`GCCATA/GGGGTG`	2	--	ut5¹		0	--	--	--	--
rs185205230^1,2		--	5839506(+)	`TGAGGC/GTTCAA`	2	--	ut5¹		0	--	--	--	--
rs192361745^1,2		--	5839561(+)	`CTGGTA/GGGCTG`	2	--	ut5¹		0	--	--	--	--
rs778798^1,2	C,F,O,A,H,	--	5839613(+)	`CCTCAA/CCAAGC`	2	--	ut5¹		36		EA NA NS WA CSA	2945
rs141189382^1,2		--	5839736(+)	`AATACC/TGGTTT`	2	--	ut5¹		0	--	--	--	--
rs3760776^1,2	C,F,H,	--	5839746(-)	`TCCTCC/TCTCAA`	2	--	us2k¹ tfbs³		28		EA NA NS WA CSA	4384
rs183678660^1,2		--	5839811(+)	`CCCAGA/CCTCCA`	2	--	us2k¹		0	--	--	--	--
rs188678363^1,2		--	5839974(+)	`AGTGGC/TAACCT`	2	--	us2k¹		0	--	--	--	--
rs191782730^1,2		--	5840207(+)	`GTGGGC/TGCCTG`	2	--	us2k¹		0	--	--	--	--
rs182865049^1,2		--	5840217(+)	`GTAGTC/TCCAGC`	2	--	us2k¹		0	--	--	--	--
rs137876199^1,2		--	5840434(+)	`CGCTTA/GAGCCC`	2	--	us2k¹		0	--	--	--	--
rs708686^1,2	C,F,A,H,	--	5840619(+)	`GACTAC/TAGGCG`	2	--	us2k¹		20		NS EA NA WA CSA	2228
rs708685^1,2	C,F,H,	--	5840661(+)	`TTTTAG/ATAGAG`	2	--	us2k¹		12		WA NA CSA EA	376
rs115967729^1,2		--	5840670(+)	`AGCTGG/TTTTTC`	2	--	us2k¹		1		WA	118
rs12972960^1,2	C,A	--	5840789(+)	`GGGTTC/TTTTTT`	2	--	us2k¹ trp³		2		WA CSA	3
rs187157758^1,2		--	5840852(+)	`TGGCAC/TGATCT`	2	--	us2k¹		0	--	--	--	--
rs10409772^1,2	C,F,	--	5840926(+)	`ACAGGA/CGTCCG`	2	--	us2k¹		4		WA CSA	7
rs146393697^1,2		--	5840941(+)	`CACGCC/TCAGCT`	2	--	us2k¹		0	--	--	--	--
rs139387520^1,2		--	5841171(+)	`TGATCA/GCTGGG`	2	--	us2k¹		0	--	--	--	--
rs191553601^1,2		--	5841233(+)	`AACGTA/GTGCTC`	2	--	us2k¹		0	--	--	--	--
rs3760775^1,2	C,F,H,	--	5841356(-)	`TGATAC/ACCTAC`	2	--	us2k¹		29		EA NS NA WA CSA	4362
rs3760774^1,2	C,F,A,H,	--	5841462(-)	`GTCCAA/GTGAGG`	2	--	us2k¹		24		EA NS NA WA	3922
rs3760773^1,2	C,	--	5841600(-)	`CAGCCC/AGTGGG`	2	--	us2k¹		1		NA	2
rs187453729^1,2		--	5841658(+)	`TGGGGA/GTTTGA`	2	--	us2k¹		0	--	--	--	--
rs10416201^1,2	--	--	5600788(+)	`ttttgG/Tatttt`	2	--	us2k¹		0	--	--	--	--
rs139398925^1,2	--	--	5831919(+)	`CCGTAC/AACGTC`	4	/V	syn¹		1		NA	4550
rs200968732^1,2	--	--	5832268(+)	`TGACCC/GCGTCT`	4	A G	mis¹		0	--	--	--	--
rs202219878^1,2	--	--	5832136(+)	`CGTCCA/GTGGCT`	4	T M	mis¹		1		EU	1323
rs113185071^1,2	--	--	5597549(+)	`AGGTCA/GCGCCA`	2	--	int¹		1		CSA	1
rs144343232^1,2	--	--	5840785(+)	`GCTGG-/CTTT GTTTT`	2	--	us2k¹		0	--	--	--	--
rs200341405^1,2	--	--	5832346(+)	`AGCGGG/AGCAGA`	4	/P /L	mis¹		1		EU	1323
rs140002776^1,2	--	--	5831607(+)	`CGCAGC/TGTCTC`	4	T	syn¹		1		NA	4548
rs72486354^1,2	--	--	5592098(+)	`CCTCTC/TGGTGG`	4	Q R	mis¹		0	--	--	--	--
rs141754965^1,2	--	--	5831871(+)	`GACAGC/TGTCTC`	4	T	syn¹		1		NA	4552
rs148077576^1,2	--	--	5832301(+)	`CGGCAG/ATGATG`	4	/T /I	mis¹		1		NA	4550
rs141842356^1,2	--	--	5832307(+)	`TGATGT/GTGCAG`	4	/N /T	mis¹		1		NA	4552
rs67126335^1,2	--	--	5834242(+)	`GAGAG-/GTGGGGACAGATAGG AGGGAGAATAGGCAGGCGTGGG`	2	--	int¹		0	--	--	--	--
rs12986208^1,2	--	--	5593921(+)	`gggaaA/Gcagag`	2	--	int¹		0	--	--	--	--
rs77143661^1,2	--	--	5594129(+)	`GGGGA-/CCGATAGGAGGGAGA ATAGGCAGGCGTGGGGACTCACA`	2	--	int¹		0	--	--	--	--
rs111696939^1,2	--	--	5596675(+)	`CTCAAG/AATAAA`	2	--	int¹		1		CSA	2
rs200897572^1,2	--	--	5832190(+)	`TCCATC/TGCTGC`	4	Q R	mis¹		0	--	--	--	--
rs140726017^1,2	--	--	5832103(+)	`CGCTGC/TGGTAG`	4	H R	mis¹		1		NA	4546
rs11401281^1,2	--	--	5594150(+)	`GAGGG-/ACAGTG`	2	--	int¹		0	--	--	--	--
rs72442142^1,2	--	--	5833805(+)	`AAAAA-/AGAAAG`	2	--	int¹		1		CSA	2
rs200530785^1,2	--	--	5831422(+)	`GTCCTT/GAGGTA`	2	--	ut3¹		1		EU	593
rs12971282^1,2	--	--	5590838(+)	`GGCGGC/GTAACA`	2	--	ut3¹		0	--	--	--	--
rs201687215^1,2	--	--	5832402(+)	`ATGGAG/CTGGGC`	4	/H /Q	mis¹		1		EU	1317
rs62105963^1,2	--	--	5600692(+)	`GGCAAA/GCTCTG`	2	--	us2k¹		1		NA	2
rs200779357^1,2	--	--	5831721(+)	`GCGTCG/AGGTGG`	4	/P	syn¹		1		EU	1153
rs34079155^1,2	--	--	5831077(+)	`CCAGG-/GTGAGG`	2	--	ut3¹		0	--	--	--	--
rs35628490^1,2	--	--	5830793(+)	`ATTTT-/TAGTAG`	2	--	ut3¹		0	--	--	--	--
rs71836060^1,2	--	--	5600152(+)	`GTCTC-/AAAAAAA`	2	--	us2k¹		0	--	--	--	--
rs11267124^1,2	--	--	5834282(+)	`GGGAC-/CGATAGGAGGGAGAA TAGGCAGGCGTGGGGACTCACA`	2	--	int¹		0	--	--	--	--
rs71844111^1,2	--	--	5840789(+)	`GGTTT-/CTTT TTTTT`	2	--	us2k¹		0	--	--	--	--
rs147799077^1,2	--	--	5831718(+)	`AAGGCG/ATCGGG`	4	/D	syn¹		1		NA	3778
rs78324382^1,2	--	--	5597625(+)	`ATAAA-/ATAAA TAAAC`	2	--	int¹		0	--	--	--	--
rs139295920^1,2	--	--	5831522(+)	`TATGCC/TGCGTG`	4	S G	mis¹		1		NA	4544
rs142068894^1,2	--	--	5832269(+)	`GACCGC/TGTCTG`	4	T A	mis¹		1		NA	4550
rs142915411^1,2	--	--	5831671(+)	`GGTACC/TGGGCC`	4	Q R	mis¹		1		NA	4434
rs60037261^1,2	--	--	5593571(+)	`CACTTG/TAACCC`	2	--	int¹		0	--	--	--	--
rs147795465^1,2	--	--	5831999(+)	`TGCCCA/GGGCCA`	4	R W	mis¹		1		NA	4532
rs146718871^1,2	--	--	5840787(+)	`TGGGT-/TTCT TTTTT`	2	--	us2k¹		0	--	--	--	--
rs1674157^1,2	--	--	5840788(+)	`GGGttC/Tttttt`	2	--	us2k¹		0	--	--	--	--
rs199597075^1,2	--	--	5832296(+)	`GCGGTC/TGGCAG`	4	N D	mis¹		1		EU	1323
rs56772013^1,2	--	--	5593572(+)	`ACTTGA/GACCCG`	2	--	int¹		0	--	--	--	--
rs199791598^1,2	--	--	5832441(+)	`GACCCA/GTTAGG`	4	N	syn¹		1		EU	1307
rs200710904^1,2	--	--	5832572(+)	`CAGGGG/AATCCA`	4	/P /S	mis¹		1		EU	1313
rs144743691^1,2	--	--	5832298(+)	`GGTCGG/ACAGTG`	4	/A /V	mis¹		1		NA	4548
rs34221339^1,2	--	--	5596400(+)	`ACCTA-/ATAATC`	2	--	int¹		0	--	--	--	--
rs17855737^1,2	--	--	5592358(+)	`AGCAGC/GTGAAA`	4	H Q	mis¹ ese³		0	--	--	--	--
rs200051257^1,2	--	--	5831823(+)	`TAGTCG/AGGGTG`	4	/P	syn¹		1		EU	1323
rs148596155^1,2	--	--	5831643(+)	`CGGGCG/ATGGTC`	4	/H	syn¹		1		NA	4514
rs200306706^1,2	--	--	5833835(+)	`TCACTC/TGGGGT`	2	--	int¹		0	--	--	--	--
rs147518378^1,2	--	--	5832519(+)	`AACAGC/AAGCGT`	4	/L	syn¹		1		NA	4522
rs111410322^1,2	--	--	5594346(+)	`CAGGCC/TGGGTG`	2	--	int¹		1		CSA	2
rs112948212^1,2	--	--	5594700(+)	`GTGGCG/AGGAAA`	2	--	int¹		1		CSA	2
rs200850531^1,2	--	--	5834148(+)	`AAAAAA/GAAAAA`	2	--	int¹		0	--	--	--	--
rs62105961^1,2	--	--	5595484(+)	`TAATGC/TCAGCT`	2	--	int¹		0	--	--	--	--
rs36091103^1,2	--	--	5830224(+)	`CAGGG-/GAATTG`	2	--	ds500¹		0	--	--	--	--
rs139735085^1,2	--	--	5840795(+)	`TTTTTC/TTTTTT`	2	--	us2k¹		0	--	--	--	--
rs144398741^1,2	--	--	5831959(+)	`AGTAGC/TGCACC`	4	H R	mis¹		1		NA	4550
rs2434718^1,2	--	--	5836227(+)	`CTTTTC/GTTTTC`	2	--	int¹ trp³		0	--	--	--	--
rs201366529^1,2	--	--	5831493(+)	`ACACCA/GGCCTC`	2	--	ut3¹		1		EU	1323

HapMap Linkage Disequilibrium report for FUT6 (5830621 - 5839742 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
Database of Genomic Variants (DGV) variations for FUT6: --
Human Gene Mutation Database (HGMD): FUT6

Locus Specific Mutation Databases (LSDB): FUT6

SABiosciences Cancer Mutation PCR Assays

QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FUT6

DNA2.0 Custom Variant and Variant Library Synthesis for FUT6

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Novoseek, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section

FUT6 for disorders           About GeneDecksing

OMIM gene information: 136836    OMIM disorders: --

13 diseases for FUT6:    About MalaCards

fucosyltransferase-6 deficiency fucosyltransferase deficiency cytomegalovirus infection herpes simplex

colon carcinoma colorectal cancer hepatocellular carcinoma carcinoma

lung carcinoma lung cancer breast cancer schizophrenia

pancreatitis

5 Novoseek disease relationships for FUT6 gene About this table

Disease	-log (P-Val)	Hits	PubMed IDs for Articles with Shared Sentences (# sentences)
colon carcinoma	35.9	3	12670495 (2), 10747292 (1)
cancer lung	0	1	10449611 (1)
colorectal cancer	0	1	9690558 (1)
carcinoma	0	2	9690558 (2)
cancer	0	3	7693344 (1), 9538143 (1), 10449611 (1)

Human Genome Epidemiology (HuGE) Navigator: FUT6 (4 documents)

Export disorders for FUT6 gene to outside databases

(in PubMed. Associations of this gene to articles via ¹Entrez Gene, ²UniProtKB/Swiss-Prot, ³HGNC, ⁴GAD, ⁵PharmGKB, ⁶HMDB, ⁷DrugBank, ⁸UniProtKB/TrEMBL, ⁹ Novoseek, and/or ¹⁰fRNAdb)
About This Section

PubMed articles for FUT6 gene, integrated from 9 sources (see all 71):
(articles sorted by number of sources associating them with FUT6)

Utopia: connect your pdf to the dynamic
world of online information

The cloning and expression of a human alpha-1,3 fucosyltransferase capable of forming the E-selectin ligand. (PubMed id 1520296)^{1, 2, 3, 9} Koszdin K.L. and Bowen B.R. (1992)
Expression of human chromosome 19p alpha(1,3)-fucosyltransferase genes in normal tissues. Alternative splicing, polyadenylation, and isoforms. (PubMed id 7650030)^{1, 2, 9} Cameron H.S.... Weston B.W. (1995)
Molecular basis for plasma alpha(1,3)-fucosyltransferase gene deficiency (FUT6). (PubMed id 8175676)^{1, 2, 9} Mollicone R....Oriol R. (1994)
Physical maps of human alpha (1,3)fucosyltransferase genes FUT3-FUT6 on chromosomes 19p13.3 and 11q21. (PubMed id 7782074)^{1, 3, 9} McCurley R.S....Weston B.W. (1995)
Molecular cloning of a fourth member of a human alpha (1,3)fucosyltransferase gene family. Multiple homologous sequences that determine expression of the Lewis x, sialyl Lewis x, and difucosyl sialyl Lewis x epitopes. (PubMed id 1339443)^{1, 2} Weston B.W.... Lowe J.B. (1992)
Identification of two functionally deficient plasma alpha 3-fucosyltransferase (FUT6) alleles. (PubMed id 11102976)^{2, 9} Elmgren A....Larson G. (2000)
Expression levels of FUT6 gene transfected into human colon carcinoma cells switch two sialyl-Lewis X-related carbohydrate antigens with distinct properties in cell adhesion. (PubMed id 12670495)^{1, 9} Kanoh A....Irimura T. (2003)
Relative positions of two clusters of human alpha-L-fucosyltransferases in 19q (FUT1-FUT2) and 19p (FUT6-FUT3-FUT5) within the microsatellite genetic map of chromosome 19. (PubMed id 7656588)^{1, 9} Reguigne-Arnould I....Oriol R. (1995)
alpha1,3Fucosyltransferase VI is expressed in HepG2 cells and codistributed with beta1,4galactosyltransferase I in the golgi apparatus and monensin-induced swollen vesicles. (PubMed id 10536043)^{1, 9} Borsig L....Berger E.G. (1999)
Functional analysis of a1,3/4-fucosyltransferase VI in human hepatocellular carcinoma cells. (PubMed id 22155250)¹ Guo Q....Wu Y. (2012)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section

		AND	OR
Aliases
Disorders
Free Text

Query String		PubMed OMIM NCBI Bookshelf
	(Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section

Entrez Gene: 2528	HGNC: 4017	AceView: FUT6	Ensembl:ENSG00000156413	euGenes: HUgn2528
ECgene: FUT6	Kegg: 2528	H-InvDB: FUT6

(According to HUGE)
About This Section

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section

Name	Description
PharmGKB entry for FUT6	Pharmacogenomics, SNPs, Pathways
GGDB	http://riodb.ibase.aist.go.jp/rcmg/ggdb/Homolog?cat=symbol&symbol=FUT6
Functional Glycomics Gateway - GTase	http://www.functionalglycomics.org/glycomics/molecule/jsp/glycoEnzyme/viewGlycoEnzyme.jsp?gbpId=gt_hum_603

Intellectual Property for FUT6 gene
(Patent information from GeneIP, Licensable technologies from WIS Yeda, Salk, Tufts, IP news from LifeMap Sciences, Inc.)

About This Section

Patent Information for FUT6 gene:
Search GeneIP for patents involving FUT6

GeneCards and IP:
Japan Patent Office Licenses GeneCards European Patent Office Licenses GeneCards Improving the IP Search

(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section

	EMD Millipore Mono- and Polyclonal Antibodies for the study of FUT6
	Browse Purified and Recombinant Proteins at EMD Millipore
	Browse for Gene Knock-down Tools from EMD Millipore
	Browse Kits and Assays available from EMD Millipore
	Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
	Browse Small Molecules at EMD Millipore

	EMD Millipore Custom Antibody & Bulk Services
	EMD Millipore Preclinical / Clinical Development Services
	EMD Millipore Immunoassay Services
	EMD Millipore Target Screening & Profiling Services

	Browse Antibodies		Browse Cell Culture Products
	Browse ELISAs		Browse Flow Cytometry Kits
	Browse Primer Pairs		Browse Kinase Activity Assays/Reagents
	Browse ELISpot Kits/Development Modules		Browse TFB/Immunoprecipitation Assays
	Browse Apoptosis Detection Kits/Reagents		Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents
	Browse DNA Damage/Repair Kits/Reagents		Browse Multiplex/Array Assay Kits/Reagents
	Browse Cell Selection/Detection Kits/Reagents		Browse Secondary Antibodies/Controls/Staining Reagents
	Browse Phosphatase Activity Assays/Reagents		Browse Recombinant/Natural Proteins

	Browse OriGene Antibodies		OriGene shRNA RFP for FUT6
	OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FUT6		OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FUT6
	OriGene Protein Over-expression Lysate for FUT6		Browse OriGene Fluorogenic Cell Assay Kits
	OriGene siRNA for FUT6		Browse 3'-UTR reporter clones for miRNA target validation
	OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FUT6		OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FUT6
	Browse OriGene GFP tagged cDNA clones in CMV expression vector		Browse OriGene MicroRNA Expression Plasmids
	Browse OriGene basic RS shRNAs		Browse OriGene validated miRNA SYBR primer pairs
	Browse OriGene full length recombinant human proteins expressed in human HEK293 cells		OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
	OriGene Custom Antibody Services for FUT6		OriGene Custom Protein Services for FUT6
	OriGene Custom Immunoassay Development

	QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat FUT6
	QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FUT6
	QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FUT6
	QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUT6
	QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUT6
	QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUT6

	GenScript Custom Purified and Recombinant Proteins Services for FUT6		GenScript cDNA clones with any tag delivered in your preferred vector for FUT6
	GenScript Custom Assay Services for FUT6		GenScript Custom Superior Antibodies Services for FUT6
	GenScript Custom overexpressing Cell Line Services for FUT6		CloneReady with Over 120,000 Genes
	Gene Synthesis: Any Gene in Any Vector		Vector-based siRNA and miRNA, Ready for Transfection
	Gene Mutant Library, Variants up to 10^11		Plasmid Preparation
	Custom Peptide Services

Search for Antibodies & Assays

	Regulatory tfbs in FUT6 promoter
	Search Chromatin IP Primers for FUT6
	RT² qPCR Primer Assay in human, mouse / rat FUT6
	Search GNC Networks for FUT6
	SABiosciences Custom PCR Arrays for FUT6

Search Tocris compounds for FUT6

	Browse Sino Biological Proteins and Antibodies
	Browse Sino Biological cDNA Clones
	Antibodies/Proteins Production Services
	Rabbit Monoclonal Antibody Platform
	Bulk Purchasing

Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

	Novus Tissue Slides
	FUT6 antibodies
	FUT6 proteins
	FUT6 lysates

	Search for Antibodies for FUT6 at Abcam
	See all of Abcam's Antibodies, Kits and Proteins for FUT6
	Custom Antibody / Protein Production Service
	Bulk Purchasing
	Advantages of Rabbit Monoclonal antibodies
	Abcam protocols and scientific support

Browse ProSpec Recombinant Proteins

FUT6 Proteins, Antibodies, CLIAs, and ELISAs

Search LifeMap BioReagents cell lines for FUT6

	Gene Synthesis
	Protein Engineering
	Variant Library Synthesis
	Codon Optimization
	Protein Production and Purification

Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUT6

	SwitchGear 3'UTR luciferase reporter plasmids for FUT6
	SwitchGear Promoter luciferase reporter plasmids for FUT6

ThermoFisher Antibody for FUT6

Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUT6

GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category			VWF (GIFTS: 73) von Willebrand factor
GIFtS Group

The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z

The GeneCards Human Gene Database

Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes Disease genes FUT6 gene at Home site.

hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4

Advanced Search

Export list of displayed genes

FUT6 Gene

fucosyltransferase 6 (alpha (1,3) fucosyltransferase)

Aliases
for FUT6 gene

Summaries
for FUT6 gene

Genomic Views
for FUT6 gene

Proteins
for FUT6 gene

Protein Domains /
Families
for FUT6 gene

Function
for FUT6 gene

Pathways & Interactions
for FUT6 gene

Drugs & Compounds
for FUT6 gene

Transcripts
for FUT6 gene

Expression
for FUT6 gene

Orthologs
for FUT6 gene

Paralogs
for FUT6 gene

Genomic Variants
for FUT6 gene

Disorders / Diseases
for FUT6 gene

Publications
for FUT6 gene

External Searches for FUT6 gene

Genome Databases showing FUT6 gene

Other Databases showing FUT6 gene

Specialized Databases showing FUT6 gene

Intellectual Property
for FUT6 gene

Products
for FUT6 gene

View Random Gene

Advanced Search

Export list of displayed genes

FUT6 Gene

fucosyltransferase 6 (alpha (1,3) fucosyltransferase)

Aliasesfor FUT6 gene

Summariesfor FUT6 gene

Genomic Viewsfor FUT6 gene

Proteinsfor FUT6 gene

Protein Domains /Familiesfor FUT6 gene

Functionfor FUT6 gene

Pathways & Interactionsfor FUT6 gene

Drugs & Compoundsfor FUT6 gene

Transcriptsfor FUT6 gene

Expression for FUT6 gene

Orthologsfor FUT6 gene

Paralogsfor FUT6 gene

Genomic Variantsfor FUT6 gene

Disorders / Diseasesfor FUT6 gene

Publicationsfor FUT6 gene

External Searches for FUT6 gene

Genome Databases showing FUT6 gene

Other Databases showing FUT6 gene

Specialized Databases showing FUT6 gene

Intellectual Propertyfor FUT6 gene

Productsfor FUT6 gene

View Random Gene

Aliases
for FUT6 gene

Summaries
for FUT6 gene

Genomic Views
for FUT6 gene

Proteins
for FUT6 gene

Protein Domains /
Families
for FUT6 gene

Function
for FUT6 gene

Pathways & Interactions
for FUT6 gene

Drugs & Compounds
for FUT6 gene

Transcripts
for FUT6 gene

Expression
for FUT6 gene

Orthologs
for FUT6 gene

Paralogs
for FUT6 gene

Genomic Variants
for FUT6 gene

Disorders / Diseases
for FUT6 gene

Publications
for FUT6 gene

Intellectual Property
for FUT6 gene

Products
for FUT6 gene