Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 



FUK Gene

protein-coding   GIFtS: 55
GCID: GC16P070488

Fucokinase

  See related diseases
at  

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, 10fRNAdb, 12H-InvDB, 13NCBI, 14NONCODE, and/or 15RNAdb)
About This Section

TryGeneCards Plus

Aliases
fucokinase1 2
Fucokinase3
L-Fucose Kinase1 2
1110046B12Rik2
EC 2.7.1.523

External Ids:    HGNC: 295001   Entrez Gene: 1972582   Ensembl: ENSG000001573537   OMIM: 6086755   UniProtKB: Q8N0W33   

Export aliases for FUK gene to outside databases

Previous GC identifers: GC16P061190 GC16P070908 GC16P070223 GC16P070264 GC16P069045 GC16P056320


(According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

TryGeneCards Plus

Entrez Gene summary for FUK Gene:
The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate)
kinase family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme
catalyzes the first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose
may be important in mediating a number of cell-cell interactions such as blood group antigen recognition,
inflammation, and metastatis. While several transcript variants may exist for this gene, the full-length nature
of only one has been described to date. (provided by RefSeq, Jul 2008)

GeneCards Summary for FUK Gene:
FUK (fucokinase) is a protein-coding gene. Diseases associated with FUK include tropical spastic paraparesis, and spastic paraparesis. GO annotations related to this gene include fucokinase activity.

UniProtKB/Swiss-Prot: FUK_HUMAN, Q8N0W3
Function: Takes part in the salvage pathway for reutilization of fucose from the degradation of oligosaccharides




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 75), Regulatory elements and Epigenetics data according to QIAGEN, and/or SwitchGear Genomics)
About This Section

TryGeneCards Plus
RefSeq DNA sequence:
NC_000016.10  NT_010498.16  NC_018927.2  
Regulatory elements:
   Regulatory transcription factor binding sites in the FUK gene promoter:
         MAZR   FOXF2   p53   GCNF   Olf-1   IRF-1   C/EBPalpha   GCNF-1   GCNF-2   Pax-4a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidFUK promoter sequence
   Search Chromatin IP Primers for FUK

Epigenetics:
DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat FUK


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16q22.1   Ensembl cytogenetic band:  16q22.1   HGNC cytogenetic band: 16q22.1

FUK Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FUK gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16P070488:  view genomic region     (about GC identifiers)

Start:
70,488,324 bp from pter      End:
70,514,177 bp from pter
Size:
25,854 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, 2neXtProt, Ensembl, and/or Reactome, Modification sites according to PhosphoSitePlus, Specific Peptides from DME, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Cloud-Clone Corp.,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Cloud-Clone Corp., Antibodies by EMD Millipore, R&D Systems, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, LSBio, Abcam, and/or Cloud-Clone Corp.)
About This Section

TryGeneCards Plus

UniProtKB/Swiss-Prot: FUK_HUMAN, Q8N0W3 (See protein sequence)
Recommended Name: L-fucose kinase  
Size: 1084 amino acids; 117623 Da
Sequence caution: Sequence=BAB71190.1; Type=Frameshift; Positions=19; Sequence=CAD29647.1; Type=Frameshift;
Positions=19;
Secondary accessions: Q5PSM3 Q5XKL6 Q6ZRA0 Q96MT9
Alternative splicing: 2 isoforms:  Q8N0W3-1   Q8N0W3-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for FUK: NX_Q8N0W3

Explore proteomics data for FUK at MOPED

Post-translational modifications: 

  • Modification sites at neXtProt
  • Modification sites at PhosphoSitePlus

  • See FUK Protein Expression from SPIRE MOPED, PaxDB, and MaxQB

    REFSEQ proteins: NP_659496.2  
    ENSEMBL proteins: 
     ENSP00000288078   ENSP00000458483   ENSP00000459168   ENSP00000462584   ENSP00000368192  
     ENSP00000460484   ENSP00000458622   ENSP00000463088   ENSP00000408007  

    FUK Human Recombinant Protein Products:

    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    OriGene Purified Protein for FUK
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom MassSpec
    OriGene Custom Protein Services for FUK
    GenScript Custom Purified and Recombinant Proteins Services for FUK
    Novus Biologicals FUK Proteins
    Novus Biologicals FUK Lysate
    Browse Sino Biological Recombinant Proteins
    Browse Sino Biological Cell Lysates
    Browse ProSpec Recombinant Proteins
    Cloud-Clone Corp. Proteins for FUK

    FUK Antibody Products:

    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    OriGene Antibodies for FUK
    OriGene Custom Antibody Services for FUK
    Novus Biologicals FUK Antibodies
    Abcam antibodies for FUK
    Cloud-Clone Corp. Antibodies for FUK
    ThermoFisher Antibody for FUK
    LSBio Antibodies in human, mouse, rat for FUK

    FUK Assay Products:

    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Assay Services for FUK
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for FUK
    Browse Enzo Life Sciences for kits & assays
    Cloud-Clone Corp. ELISAs for FUK
    Cloud-Clone Corp. CLIAs for FUK


    (According to HGNC, IUPHAR, InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    TryGeneCards Plus
    Selected InterPro protein domains (see all 6):
     IPR006206 Mevalonate/galactokinase
     IPR020568 Ribosomal_S5_D2-typ_fold
     IPR012887 Fucokinase
     IPR006204 GHMP_kinase_N_dom
     IPR014721 Ribosomal_S5_D2-typ_fold_subgr

    Graphical View of Domain Structure for InterPro Entry Q8N0W3

    ProtoNet protein and cluster: Q8N0W3

    3 Blocks protein domains:
    IPB006203 GHMP kinase
    IPB012887 L-fucokinase
    IPB013750 GHMP kinase


    UniProtKB/Swiss-Prot: FUK_HUMAN, Q8N0W3
    Similarity: Belongs to the GHMP kinase family


    FUK for domains           About GeneDecksing


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory, genOway,
    transcription factor targeting from QIAGEN and/or HOMER, miRNA Gene Targets from miRTarBase, shRNA from OriGene, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, SwitchGear Genomics, Gene Editing from DNA2.0, Clones from OriGene, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, ESI BIO, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: FUK_HUMAN, Q8N0W3
    Function: Takes part in the salvage pathway for reutilization of fucose from the degradation of oligosaccharides
    Catalytic activity: ATP + L-fucose = ADP + beta-L-fucose 1-phosphate

         Enzyme Number (IUBMB): EC 2.7.1.521

         Gene Ontology (GO): 5 molecular function terms:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005524ATP binding IEA--
    GO:0016301kinase activity ----
    GO:0016772transferase activity, transferring phosphorus-containing groups ----
    GO:0016773phosphotransferase activity, alcohol group as acceptor ----
    GO:0050201fucokinase activity NAS12056818
         
    FUK for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for FUK:
     Decreased viability  Paclitaxel antagonistic effect 

    Animal Models:
       inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for FUK
       inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for FUK

       genOway customized KO model: permanent, tissue-specific or time-controlled inactivation for FUK
       genOway customized Knockin model: humanization, point mutation, expression monitoring, etc. for FUK

    miRNA
    Products:
        
    miRTarBase miRNAs that target FUK:
    hsa-mir-92a-3p (MIRT049729), hsa-mir-618 (MIRT039601), hsa-mir-93-3p (MIRT038744)

    Block miRNA regulation of human, mouse, rat FUK using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate FUK (see all 9):
    hsa-miR-4324 hsa-miR-34c-5p hsa-miR-4251 hsa-miR-449b hsa-miR-516b* hsa-miR-449a hsa-miR-34a hsa-miR-516a-3p
    SwitchGear 3'UTR luciferase reporter plasmidFUK 3' UTR sequence
    Inhib. RNA
    Products:
        
    OriGene RNAi products in human, mouse, rat for FUK
    Predesigned siRNA for gene silencing in human, mouse, rat FUK

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for FUK

    Clone
    Products:
         
    OriGene clones in human, mouse for FUK (see all 8)
    OriGene ORF clones in mouse, rat for FUK
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: FUK (NM_145059)
    Sino Biological Human cDNA Clone for FUK
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUK

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for FUK
    Browse ESI BIO Cell Lines and PureStem Progenitors for FUK 
    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUK


    (According to UniProtKB, COMPARTMENTS Subcellular localization database, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene.)
    About This Section

    TryGeneCards Plus

    Subcellular locations from COMPARTMENTS: 

    CompartmentConfidence
    cytosol2
    mitochondrion2
    nucleus2
    plasma membrane1

    Gene Ontology (GO): 1 cellular component term:    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm IEA--

    FUK for ontologies           About GeneDecksing


    (SuperPaths according to PathCards, Pathways according to R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Sino Biological, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to QIAGEN, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Apr 2014 via Entrez Gene).
    About This Section

    TryGeneCards Plus

    SuperPaths for FUK About    
    See pathways by source

    SuperPathContained pathways About
    1Fructose and mannose metabolism
    Fructose and mannose metabolism
    GDP-L-fucose biosynthesis II (from L-fucose)0.00
    2Metabolism
    Metabolic pathways0.38
    3Amino sugar and nucleotide sugar metabolism
    Amino sugar and nucleotide sugar metabolism

    Pathways by source                                                                                                                                                                 See SuperPaths
    Show all pathways


    1 BioSystems Pathway for FUK
        GDP-L-fucose biosynthesis II (from L-fucose)



    3 Kegg Pathways  (Kegg details for FUK):
        Fructose and mannose metabolism
    Amino sugar and nucleotide sugar metabolism
    Metabolic pathways


    FUK for pathways           About GeneDecksing

        Custom Pathway & Disease-focused RT2 Profiler PCR Arrays for FUK
    Interactions:

        Search GeneGlobe Interaction Network for FUK

    STRING Interaction Network Preview (showing 5 interactants - click image to see 13)

    Selected Interacting proteins for FUK (ENSP000002880784) via UniProtKB, MINT, STRING, and/or I2D (see all 13)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TNNI3KENSP000003599284STRING: ENSP00000359928
    HK2ENSP000002905734STRING: ENSP00000290573
    HK3ENSP000002924324STRING: ENSP00000292432
    HKDC1ENSP000003466434STRING: ENSP00000346643
    KHKENSP000002605984STRING: ENSP00000260598
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience, ApexBio, HMDB, BitterDB, and/or Novoseek, Ligands according to IUPHAR, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB)
    About This Section

    TryGeneCards Plus
    Browse Small Molecules at EMD Millipore
       Browse drugs & compounds from Enzo Life Sciences
      Browse compounds at ApexBio 

    Browse Tocris compounds for FUK

    4 HMDB Compounds for FUK    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    Fucose 1-phosphate(3,4,5-trihydroxy-6-methyl-tetrahydropyran-2-yl)oxyphosphonate (see all 11)16562-58-6--
    L-Fucose(-)-Fucose (see all 19)2438-80-4--



    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 236 Homo sapiens; Apr 25 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    Conferences by KenesGroup, exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN, SwitchGear Genomics,
    Tagged/untagged cDNA clones from OriGene, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, and/or QIAGEN )
    About This Section

    TryGeneCards Plus

    REFSEQ mRNAs for FUK gene: 
    NM_145059.2  

    Unigene Cluster for FUK:

    Fucokinase
    Hs.7907  [show with all ESTs]
    Unigene Representative Sequence: BC032542
    14 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000288078(uc002eyy.3) ENST00000572784 ENST00000576107 ENST00000574784
    ENST00000571487(uc010vmb.1) ENST00000571514(uc002eyz.3) ENST00000378912(uc010cft.3)
    ENST00000464499 ENST00000573352 ENST00000576453 ENST00000498702 ENST00000573832
    ENST00000485034 ENST00000428974
    miRNA
    Products:
         
    Block miRNA regulation of human, mouse, rat FUK using miScript Target Protectors
    Selected qRT-PCR Assays for microRNAs that regulate FUK (see all 9):
    hsa-miR-4324 hsa-miR-34c-5p hsa-miR-4251 hsa-miR-449b hsa-miR-516b* hsa-miR-449a hsa-miR-34a hsa-miR-516a-3p
    SwitchGear 3'UTR luciferase reporter plasmidFUK 3' UTR sequence
    Inhib. RNA
    Products:
         
    OriGene RNAi products in human, mouse, rat for FUK
    Predesigned siRNA for gene silencing in human, mouse, rat FUK
    Clone
    Products:
         
    OriGene clones in human, mouse for FUK (see all 8)
    OriGene ORF clones in mouse, rat for FUK
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
    GenScript: all cDNA clones in your preferred vector: FUK (NM_145059)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUK
    Primer
    Products:
        
    OriGene qPCR primer pairs and template standards for FUK
    OriGene qSTAR qPCR primer pairs in human, mouse for FUK
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat FUK
      QuantiTect SYBR Green Assays in human, mouse, rat FUK
      QuantiFast Probe-based Assays in human, mouse, rat FUK

    Additional mRNA sequence: 

    AJ441184.1 AK056456.1 AK092025.1 AK096727.1 AK128387.1 AK293794.1 AK315590.1 BC013735.1 
    BC032542.1 

    11 DOTS entries:

    DT.445211  DT.100751447  DT.100672672  DT.99942941  DT.40189818  DT.91681107  DT.91681983  DT.99959196 
    DT.102836007  DT.92036016  DT.120681529 

    Selected AceView cDNA sequences (see all 91):

    BI910114 AI336954 BQ446717 AK128387 AK096727 T32783 AJ441184 AI825505 
    BM469047 BM693199 AY358187 BU631695 CB045093 BF834265 AW075581 AK123470 
    AI650939 AA628563 BM790446 BE551845 AK074168 AI655796 AW674711 AA301456 

    GeneLoc Exon Structure

    Selected Alternative Splicing Database (ASD) splice patterns (SP) for FUK (see all 10)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b · 6c ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b ^ 15a · 15b ^ 16 ^ 17 ^ 18a · 18b ^
    SP1:        -                                         -           -           -                                               -                                 
    SP2:        -                 -                       -           -           -                                               -                                 
    SP3:        -                 -                       -                       -                 -                             -                       -         
    SP4:        -     -     -     -     -     -     -     -     -     -     -     -     -           -                 -                                             
    SP5:        -                 -                                                                                                                                 

    ExUns: 19 ^ 20a · 20b ^ 21a · 21b ^ 22a · 22b ^ 23 ^ 24a · 24b ^ 25
    SP1:              -           -     -                 -               
    SP2:                          -     -                 -               
    SP3:                          -     -                                 
    SP4:                          -     -                 -               
    SP5:                                                                  


    ECgene alternative splicing isoforms for FUK

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, Protein expression images according to data from SPIRE 1MOPED, 2PaxDb, and 3MaxQB, plus additional links to SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from QIAGEN, Primers from OriGene, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    TryGeneCards Plus

    FUK expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS <intensity>2/3
    CGAP TAG: TGAGCGTGGG
    FUK Expression
    About this image

    FUK Protein expression data from MOPED1, PaxDb2 and MaxQB3    About this image

    FUK Protein Expression

    SOURCE GeneReport for Unigene cluster: Hs.7907
        Custom PCR Arrays for FUK
    Primer
    Products:
    OriGene qPCR primer pairs and template standards for FUK
    OriGene qSTAR qPCR primer pairs in human, mouse for FUK
    Pre-validated RT2 qPCR Primer Assay in human, mouse, rat FUK
    QuantiTect SYBR Green Assays in human, mouse, rat FUK
    QuantiFast Probe-based Assays in human, mouse, rat FUK
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUK

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    TryGeneCards Plus

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for FUK gene from Selected species (see all 15)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Fuk1 , 5 fucokinase1, 5 84.62(n)1
    85.61(a)1
      8 (57.79 cM)5
    2347301  NM_172283.31  NP_758487.21 
     1108824635 
    chicken
    (Gallus gallus)
    Aves FUK1 fucokinase 68.46(n)
    65.6(a)
      770049  XM_001233363.3  XP_001233364.3 
    lizard
    (Anolis carolinensis)
    Reptilia FUK6
    fucokinase
    61(a)
    1 ↔ 1
    GL343539.1(29003-64242)
    tropical clawed frog
    (Xenopus tropicalis)
    Amphibia fuk1 fucokinase 60.21(n)
    59.92(a)
      100497304  XM_004914045.1  XP_004914102.1 
    zebrafish
    (Danio rerio)
    Actinopterygii wufa03b122 wufa03b12 76.95(n)   334767  57042846 
    worm
    (Caenorhabditis elegans)
    Secernentea C26D10.41 C26D10.4 40.48(n)
    32.91(a)
      182938  NM_063355.3  NP_495756.2 
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons FKGP1 FKGP 38.91(n)
    29.7(a)
      839420  NM_100004.3  NP_563620.1 
    rice
    (Oryza sativa)
    Liliopsida Os03g01151001 Os03g0115100 41(n)
    31.33(a)
      4331392  NM_001055284.1  NP_001048749.1 


    ENSEMBL Gene Tree for FUK (if available)
    TreeFam Gene Tree for FUK (if available)

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section

    TryGeneCards Plus
    Paralogs for FUK gene
    1 SIMAP similar gene for FUK using alignment to 8 protein entries:     FUK_HUMAN (see all proteins):
    FLJ00241

    FUK for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, 4UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD), the Human Cytochrome P450 Allele Nomenclature Database, and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers, Cancer Mutation PCR Arrays and Assays, and Copy Number PCR Arrays from QIAGEN)
    About This Section

    TryGeneCards Plus

    Selected SNPs for FUK (see all 731)    About this table    
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1168382791,2
    C,F--70486585(+) AGCACC/TTGTGC 1 -- us2k11Minor allele frequency- T:0.03WA 118
    rs1148805261,2
    C,F--70486667(+) ATAAAG/ACTCAA 1 -- us2k11Minor allele frequency- A:0.03WA 118
    rs178854951,2
    C,F--70486848(+) TGAACA/TTCACT 1 -- us2k110Minor allele frequency- T:0.06NS WA 870
    rs1427637091,2
    --70486970(+) TGCCAA/TAGTTA 1 -- us2k10--------
    rs1919447621,2
    --70486984(+) ATGTGA/TGCACC 1 -- us2k10--------
    rs178861651,2
    F--70487223(+) TGCGC-/GCCACCACGCTCAGCTAATTTTTGTATTTTTAGTAGACGGGGTTTCACCATA
    TTGGCCAGGCTGGTCTTCAACTCCCGACCTCATGATCCACCCGCCTCGGCCTCA
    GCCAC
    1 -- us2k12Minor allele frequency- GCCACCACGCTCAGCTAATTTTTGTATTTTTAGTAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTTCAACTCCCGACCTCATGATCCACCCGCCTCGGCCTCA:0.02NS 94
    rs1843723371,2
    --70487224(+) TGCGCA/GCCACC 1 -- us2k10--------
    rs1407585531,2
    --70487317(+) CCACCC/TGCCTC 1 -- us2k10--------
    rs178820651,2
    C,F--70487323(+) GCCTCG/CGCCTC 1 -- us2k12Minor allele frequency- C:0.01NS 94
    rs1175735131,2
    F--70487403(+) GGGTAG/TGTAAG 1 -- us2k11Minor allele frequency- T:0.04EA 120

    HapMap Linkage Disequilibrium report for FUK (70488324 - 70514177 bp)

    Structural Variations
         Database of Genomic Variants (DGV) 3 variations for FUK:    About this table    
    Variant IDTypeSubtypePubMed ID
    nsv833272CNV Loss17160897
    nsv906873CNV Loss21882294
    nsv7285OTHER Inversion18451855

    Site Specific Mutation Identification with PCR Assays
    SeqTarget long-range PCR primers for resequencing FUK
    DNA2.0 Custom Variant and Variant Library Synthesis for FUK

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Conferences by KenesGroup, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    TryGeneCards Plus
    OMIM gene information: 608675    OMIM disorders: --

    5 diseases for FUK:    
    About MalaCards
    tropical spastic paraparesis    spastic paraparesis    spasticity    tuberculosis
    obesity


    FUK for disorders           About GeneDecksing


    Export disorders for FUK gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    TryGeneCards Plus

    PubMed articles for FUK gene, integrated from 10 sources (see all 11):
    (articles sorted by number of sources associating them with FUK)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of human L-fucose kinase amino acid sequence. (PubMed id 12056818)1, 2, 3 Hinderlich S.... Bauer C. (Biochem. Biophys. Res. Commun. 2002)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S.... Malek J. (Genome Res. 2004)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (Nat. Genet. 2004)
    4. Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (PubMed id 23251661)1 Comuzzie A.G....Butte N.F. (PLoS ONE 2012)
    5. Systematic and quantitative assessment of the ubiquitin-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (Mol. Cell 2011)
    6. Global identification of modular cullin-RING ligase substrates. (PubMed id 21963094)1 Emanuele M.J....Elledge S.J. (Cell 2011)
    7. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PubMed id 12975309)1 Clark H.F.... Gray A.M. (Genome Res. 2003)
    8. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002)
    9. Composition of Drosophila melanogaster proteome involved in fucosylated glycan metabolism. (PubMed id 11698403)9 Roos C.... Renkonen R. (J. Biol. Chem. 2002)
    10. Activity of enzymes catalyzing formation of beta-L-fucosyl phosphate and GDP-beta-L-fucose in amphibian tissues and their application in chemo-enzymic synthesis of GDP-beta-L-fucose. (PubMed id 10424902)9 Druzhinina T.N....Shibaev V.N. (Biochemistry Mosc. 1999)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section

    TryGeneCards Plus
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section

    TryGeneCards Plus
    Entrez Gene: 197258 HGNC: 29500 AceView: FUK Ensembl:ENSG00000157353 euGenes: HUgn197258
    ECgene: FUK Kegg: 197258 H-InvDB: FUK

    (According to HUGE)
    About This Section

    TryGeneCards Plus
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, UniProtKB/TrEMBL, and/or others, e.g. Wikipedia and GeneReviews, via UniProtKB/Swiss-Prot)
    About This Section

    TryGeneCards Plus
    NameDescription
    PharmGKB entry for FUK Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for FUK Genetics and Cytogenetics in Oncology and Haematology
    SeattleSNPshttp://pga.gs.washington.edu/data/fuk/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section

    TryGeneCards Plus
    Patent Information for FUK gene:
    Search GeneIP for patents involving FUK

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Cloud-Clone Corp., Thermo Fisher Scientific, LSBio, Gene Editing from DNA2.0. Clones from OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, and ESI BIO, PCR Arrays from QIAGEN, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, Enzo Life Sciences, and/or ApexBio, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory, genOway)
    About This Section

    TryGeneCards Plus

     
     EMD Millipore genomic analysis products

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Enzyme Activity Assays/Reagents  
     Browse ELISpot/FluoroSpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Luminex Assays  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Recombinant/Natural Proteins   Browse Stem Cell Products  
     Browse cDNA Clones   Browse Proteome Profiler Antibody Arrays  
     OriGene Antibodies for FUK   OriGene RNAi products in human, mouse, rat for FUK  
     OriGene qPCR primer pairs and template standards for FUK   Browse OriGene Protein Over-expression Lysates  
     OriGene Custom Mass Spec   OriGene clones in human, mouse for FUK  
     OriGene qSTAR qPCR primer pairs in human, mouse for FUK   OriGene Purified Protein for FUK  
     OriGene ORF clones in mouse, rat for FUK   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for FUK   OriGene Custom Protein Services for FUK  

     
     
     Block miRNA regulation of human, mouse, rat FUK using miScript Target Protectors SeqTarget long-range PCR primers for resequencing FUK
     DNA Methylation CpG Assay Predesigned for Pyrosequencing in human, mouse, rat FUK Predesigned siRNA for gene silencing in human, mouse, rat FUK
     QuantiFast Probe-based Assays in human, mouse, rat FUK QuantiTect SYBR Green Assays in human, mouse, rat FUK
     Custom PCR Arrays for FUK Search Chromatin IP Primers for FUK
     Pre-validated RT2 qPCR Primer Assay in human, mouse, rat FUK  Search GeneGlobe Interaction Network for FUK
     Regulatory tfbs in FUK promoter
     GenScript Custom Purified and Recombinant Proteins Services for FUK GenScript cDNA clones with any tag delivered in your preferred vector for FUK
     GenScript Custom Assay Services for FUK GenScript Custom overexpressing Cell Line Services for FUK
     CloneReady with Over 120,000 Genes  Gene Synthesis: Any Gene in Any Vector
     Vector-based siRNA and miRNA, Ready for Transfection Gene Mutant Library, Variants up to 10^11
     Plasmid Preparation Custom Peptide Services
     Search for Antibodies & Assays

     Search Tocris compounds for FUK
     Browse Sino Biological Proteins
     Browse Sino Biological Cell Lysates
     cDNA Clones for FUK
     4000+ Proteins
     Search Sino Biological for antibodies, proteins & pathways
     Protein Production Services
     Transfection Reagents
     Protein A/G/L resins
     Isotyping reagents
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies

     Novus Tissue Slides
     FUK antibodies
     FUK proteins
     FUK lysates
     Antibodies for FUK
     See all of Abcam's Antibodies, Kits and Proteins for FUK
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins
     Proteins for FUK
     Antibodies for FUK
     ELISAs for FUK
     CLIAs for FUK



     Browse ESI BIO Cell Lines and PureStem Progenitors for FUK
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUK
     SwitchGear 3'UTR luciferase reporter plasmids for FUK
     SwitchGear Promoter luciferase reporter plasmids for FUK
     ThermoFisher Antibody for FUK
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUK
     inGenious Targeting Laboratory: Let us create your new Knockout/Knockin mouse model for FUK
     inGenious Targeting Laboratory: Contact us about creating complex and humanized mouse models for FUK
     LSBio Antibodies in human, mouse, rat for FUK
    Customized transgenic rodents for:
     Humanization
     Biomarker expression
     Off-target effect monitoring
     Translational medicine
     Tissue-specific gene expresssion
     Time-controlled gene expresssion
     Browse compounds at ApexBio
           
    GeneCards Homepage - Last full update: 7 May 2014 - Incrementals: 9 May 2014 , 2 Jun 2014 , 26 Jun 2014 , 30 Jun 2014

    View Random Gene

    Category
    (GIFtS: )
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      FUK gene at Home site.
    Version: 3.12.142 28 July 2014
    hostname: 356980-web2.xennexinc.com index build: 126 solr: 1.4