Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

FUK Gene

protein-coding   GIFtS: 53
GCID: GC16P070488

fucokinase

 Explore 5 diseases affiliated with
FUK via our new
 Human Malady Compendium 
Biological research products
for FUK
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Fucokinase3
Fucokinase3
FLJ394081
1110046B12Rik2
L-Fucose Kinase2
EC 2.7.1.523

External Ids:    HGNC: 295001   Entrez Gene: 1972582   Ensembl: ENSG000001573537   OMIM: 6086755   UniProtKB: Q8N0W33   

Export aliases for FUK gene to outside databases

Previous GC identifers: GC16P061190 GC16P070908 GC16P070223 GC16P070264 GC16P069045 GC16P056320


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for FUK:
The protein encoded by this gene belongs to the GHMP (galacto-, homoserine, mevalonate and phosphomevalonate) kinase
family and catalyzes the phosphorylation of L-fucose to form beta-L-fucose 1-phosphate. This enzyme catalyzes the
first step in the utilization of free L-fucose in glycoprotein and glycolipid synthesis. L-fucose may be important in
mediating a number of cell-cell interactions such as blood group antigen recognition, inflammation, and metastatis.
While several transcript variants may exist for this gene, the full-length nature of only one has been described to
date. (provided by RefSeq, Jul 2008)

UniProtKB/Swiss-Prot: FUK_HUMAN, Q8N0W3
Function: Takes part in the salvage pathway for reutilization of fucose from the degradation of oligosaccharides




(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000016.9  NC_018927.1  NT_010498.15  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the FUK gene promoter:
         MAZR   FOXF2   p53   GCNF   Olf-1   IRF-1   C/EBPalpha   GCNF-1   GCNF-2   Pax-4a   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidFUK promoter sequence
   Search SABiosciences Chromatin IP Primers for FUK

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FUK


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 16q22.1   Ensembl cytogenetic band:  16q22.1   HGNC cytogenetic band: 16q22.1

FUK Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FUK gene location

GeneLoc information about chromosome 16         GeneLoc Exon Structure

GeneLoc location for GC16P070488:  view genomic region     (about GC identifiers)

Start:
70,488,324 bp from pter      End:
70,514,177 bp from pter
Size:
25,854 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: FUK_HUMAN, Q8N0W3 (See protein sequence)
Recommended Name: L-fucose kinase  
Size: 1084 amino acids; 117623 Da
Sequence caution: Sequence=BAB71190.1; Type=Frameshift; Positions=19; Sequence=CAD29647.1; Type=Frameshift;
Positions=19;
Secondary accessions: Q5PSM3 Q5XKL6 Q6ZRA0 Q96MT9
Alternative splicing: 2 isoforms:  Q8N0W3-1   Q8N0W3-2   (No experimental confirmation available)

Explore the universe of human proteins at neXtProt for FUK: NX_Q8N0W3

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q8N0W3

  • FUK Protein expression data from MOPED and PaxDb:    About this image 
    FUK Protein Expression
    REFSEQ proteins: NP_659496.2  
    ENSEMBL proteins: 
     ENSP00000288078   ENSP00000458483   ENSP00000459168   ENSP00000462584   ENSP00000368192  
     ENSP00000460484   ENSP00000458622   ENSP00000463088   ENSP00000408007  

    Human Recombinant Protein Products for FUK: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    Browse OriGene Protein Over-expression Lysates
    OriGene Custom Protein Services for FUK 
    GenScript Custom Purified and Recombinant Proteins Services for FUK
    Novus Biologicals FUK Proteins
    Novus Biologicals FUK Lysate
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for FUK

    Gene Ontology (GO): 1 cellular component term (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005737cytoplasm IEA--

    FUK for ontologies           About GeneDecksing



    FUK Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for FUK 
    GenScript Custom Superior Antibodies Services for FUK
    Novus Biologicals FUK Antibodies
    Abcam antibodies for FUK 
    Uscn Antibodies for FUK
    ThermoFisher Antibody for FUK

    Assay Products for FUK: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for FUK
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for FUK


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    FUK for domains           About GeneDecksing

    5/6 InterPro domains/families (see all 6):
     IPR006206 Mevalonate/galactokinase
     IPR020568 Ribosomal_S5_D2-typ_fold
     IPR012887 Fucokinase
     IPR006204 GHMP_kinase_N_dom
     IPR014721 Ribosomal_S5_D2-typ_fold_subgr

    Graphical View of Domain Structure for InterPro Entry Q8N0W3

    ProtoNet protein and cluster: Q8N0W3

    3 Blocks protein families:
    IPB006203 GHMP kinase
    IPB012887 L-fucokinase
    IPB013750 GHMP kinase


    UniProtKB/Swiss-Prot: FUK_HUMAN, Q8N0W3
    Similarity: Belongs to the GHMP kinase family


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013, inGenious Targeting Laboratory,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase, shRNA from OriGene, Sirion Biotech, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Sirion Biotech, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, Sirion Biotech, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Molecular Function:

         UniProtKB/Swiss-Prot Summary: FUK_HUMAN, Q8N0W3
    Function: Takes part in the salvage pathway for reutilization of fucose from the degradation of oligosaccharides
    Catalytic activity: ATP + L-fucose = ADP + beta-L-fucose 1-phosphate

         Enzyme Number (IUBMB): EC 2.7.1.521

         Gene Ontology (GO): 4 molecular function terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005524ATP binding IEA--
    GO:0016301kinase activity ----
    GO:0016772transferase activity, transferring phosphorus-containing groups ----
    GO:0050201fucokinase activity NAS12056818
         
    FUK for ontologies           About GeneDecksing


    Phenotypes:
         2 GenomeRNAi human phenotypes for FUK:
     Decreased viability  Paclitaxel antagonistic effect 

    Animal Models:
       inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for FUK 

    miRNA
    Products:
        
    OriGene 3'-UTR Clone: FUK
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FUK
    8/9 QIAGEN miScript miRNA Assays for microRNAs that regulate FUK (see all 9):
    hsa-miR-4324 hsa-miR-34c-5p hsa-miR-4251 hsa-miR-449b hsa-miR-516b* hsa-miR-449a hsa-miR-34a hsa-miR-516a-3p
    SwitchGear 3'UTR luciferase reporter plasmidFUK 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FUK (see all 7)
    OriGene shRNA RFP: FUK
    OriGene siRNA: FUK
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUK
    Sirion Biotech Custom design and validation of potent shRNA sequences against FUK 

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for FUK
    Sirion Biotech Customized adenovirus for overexpression of FUK 
    Sirion Biotech Customized adenovirus for potent knockdown of FUK

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FUK (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FUK (see all 2)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: FUK (NM_145059)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUK 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for FUK
    Search LifeMap BioReagents cell lines for FUK
    Sirion Biotech Customized stable knockdown cell line services for FUK 
    Sirion Biotech Customized inducible knockdown cell line services for FUK
    Sirion Biotech Customized stable overexpressing cell line services for FUK
    Sirion Biotech Customized inducible overexpressing cell line services for FUK

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUK


    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section

    Unified GeneCards pathways  About this table 
    See pathways by source

    Super-pathwaycontained gene-specific pathways
    1GDP-L-fucose biosynthesis II (from L-fucose)
    GDP-L-fucose biosynthesis II (from L-fucose)1.00
    2Amino sugar and nucleotide sugar metabolism
    Amino sugar and nucleotide sugar metabolism1.00
    3Fructose and mannose metabolism
    Fructose and mannose metabolism1.00
    4Metabolism
    Metabolic pathways0.38

    Pathway sources
    See GeneCards unified pathways
    Show all pathways


    1 BioSystems Pathway for FUK 
        GDP-L-fucose biosynthesis II (from L-fucose)


    3         Kegg Pathways  (Kegg details for FUK):
        Fructose and mannose metabolism
    Amino sugar and nucleotide sugar metabolism
    Metabolic pathways


    FUK for pathways           About GeneDecksing

    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for FUK

    STRING Interaction Network Preview (showing 5 interactants - click image to see 13)

    5/13 Interacting proteins for FUK (ENSP000002880784) via UniProtKB, MINT, STRING, and/or I2D (see all 13)
    InteractantInteraction Details
    GeneCardExternal ID(s)
    TNNI3KENSP000003599284STRING: ENSP00000359928
    HK2ENSP000002905734STRING: ENSP00000290573
    HK3ENSP000002924324STRING: ENSP00000292432
    HKDC1ENSP000003466434STRING: ENSP00000346643
    KHKENSP000002605984STRING: ENSP00000260598
    About this table

    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for FUK

    4 HMDB Compounds for FUK    About this table
    CompoundSynonyms CAS #PubMed Ids
    ADPadenosindiphosphorsaeure (see all 8)58-64-0--
    Adenosine triphosphate5'-(tetrahydrogen triphosphate) Adenosine (see all 24)56-65-5--
    Fucose 1-phosphate(3,4,5-trihydroxy-6-methyl-tetrahydropyran-2-yl)oxyphosphonate (see all 11)16562-58-6--
    L-Fucose(-)-Fucose (see all 19)2438-80-4--
    Search CenterWatch for drugs/clinical trials and news about FUK 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, Sirion Biotech, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for FUK gene: 
    NM_145059.2  

    Unigene Cluster for FUK:

    Fucokinase
    Hs.7907  [show with all ESTs]
    Unigene Representative Sequence: BC032542
    14 Ensembl transcripts including schematic representations, and UCSC links where relevant:
    ENST00000288078(uc002eyy.3) ENST00000572784 ENST00000576107 ENST00000574784
    ENST00000571487(uc010vmb.1) ENST00000571514(uc002eyz.3) ENST00000378912(uc010cft.3)
    ENST00000464499 ENST00000573352 ENST00000576453 ENST00000498702 ENST00000573832
    ENST00000485034 ENST00000428974

    miRNA
    Products:
         
    OriGene 3'-UTR Clone: FUK
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FUK
    8/9 QIAGEN miScript miRNA Assays for microRNAs that regulate FUK (see all 9):
    hsa-miR-4324 hsa-miR-34c-5p hsa-miR-4251 hsa-miR-449b hsa-miR-516b* hsa-miR-449a hsa-miR-34a hsa-miR-516a-3p
    SwitchGear 3'UTR luciferase reporter plasmidFUK 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FUK (see all 7)
    OriGene shRNA RFP: FUK
    OriGene siRNA: FUK
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUK
    Sirion Biotech Custom design and validation of potent shRNA sequences against FUK 
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FUK (see all 4)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FUK (see all 2)
    OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: FUK (NM_145059)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FUK
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUK 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FUK
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat FUK
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUK
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUK

    Additional cDNA sequence: 

    AJ441184.1 AK056456.1 AK092025.1 AK096727.1 AK128387.1 AK293794.1 AK315590.1 BC013735.1 
    BC032542.1 

    11 DOTS entries:

    DT.445211  DT.100751447  DT.100672672  DT.99942941  DT.40189818  DT.91681107  DT.91681983  DT.99959196 
    DT.102836007  DT.92036016  DT.120681529 

    24/91 AceView cDNA sequences (see all 91):

    AK128387 BM469047 CR610176 AW674711 BC032542 BM790446 AI825505 CD369374 
    BI910114 BM693199 AK096727 BE856687 AI202333 AA552095 BF834265 AI191022 
    AA628563 T32783 BX398994 AY358187 AI655796 CB045092 AK074168 BQ879115 

    GeneLoc Exon Structure

    5/10 Alternative Splicing Database (ASD) splice patterns (SP) for FUK (see all 10)    About this scheme

    ExUns: 1 ^ 2 ^ 3 ^ 4 ^ 5a · 5b ^ 6a · 6b · 6c ^ 7a · 7b ^ 8 ^ 9a · 9b ^ 10 ^ 11 ^ 12 ^ 13 ^ 14a · 14b ^ 15a · 15b ^ 16 ^ 17 ^ 18a · 18b ^
    SP1:        -                                         -           -           -                                               -                                 
    SP2:        -                 -                       -           -           -                                               -                                 
    SP3:        -                 -                       -                       -                 -                             -                       -         
    SP4:        -     -     -     -     -     -     -     -     -     -     -     -     -           -                 -                                             
    SP5:        -                 -                                                                                                                                 

    ExUns: 19 ^ 20a · 20b ^ 21a · 21b ^ 22a · 22b ^ 23 ^ 24a · 24b ^ 25
    SP1:              -           -     -                 -               
    SP2:                          -     -                 -               
    SP3:                          -     -                                 
    SP4:                          -     -                 -               
    SP5:                                                                  


    ECgene alternative splicing isoforms for FUK

    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    FUK expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TGAGCGTGGG
    FUK Expression
    About this image
    See FUK Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for FUK

    SOURCE GeneReport for Unigene cluster: Hs.7907
        SABiosciences Custom PCR Arrays for FUK

    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FUK
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse, rat FUK
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUK
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUK
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUK

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of eukaryotes.

    Orthologs for FUK gene from 7/20 species (see all 20)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    mouse
    (Mus musculus)
    Mammalia Fuk1 , 5 fucokinase1, 5 84.81(n)1
    85.83(a)1
      8 (57.79 cM)5
    2347301  NM_172283.31  NP_758487.21 
     1108824635 
    chicken
    (Gallus gallus)
    Aves FUK1 fucokinase 68.16(n)
    65.72(a)
      770049  XM_001233363.2  XP_001233364.2 
    lizard
    (Anolis carolinensis)
    Reptilia FUK6
    --
    61(a)
    1 ↔ 1
    GL343539.1(29003-64242)
    zebrafish
    (Danio rerio)
    Actinopterygii wufa03b122 wufa03b12 76.95(n)   334767  57042846 
    worm
    (Caenorhabditis elegans)
    Secernentea C26D10.46
    --
    25(a)
    1 ↔ 1
    II(8329708-8333416)
    thale cress
    (Arabidopsis thaliana)
    eudicotyledons FKGP1 L-fucokinase/GDP-L-fucose pyrophosphorylase 38.99(n)
    29.76(a)
      839420  NM_100004.3  NP_563620.1 
    rice
    (Oryza sativa)
    Liliopsida Os03g01151001 hypothetical protein 41.47(n)
    31.88(a)
      4331392  NM_001055284.1  NP_001048749.1 


    ENSEMBL Gene Tree for FUK (if available)
    TreeFam Gene Tree for FUK (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
      --

    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/499 NCBI SNPs in FUK are shown (see all 499    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 16 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1168382791,2
    F--70486585(+) AGCACC/TTGTGC 1 -- us2k11Minor allele frequency- T:0.03WA 118
    rs1148805261,2
    F--70486667(+) ATAAAG/ACTCAA 1 -- us2k11Minor allele frequency- A:0.03WA 118
    rs178854951,2
    C,F--70486848(+) TGAACA/TTCACT 1 -- us2k110Minor allele frequency- T:0.06NS WA 870
    rs1427637091,2
    --70486970(+) TGCCAA/TAGTTA 1 -- us2k10--------
    rs1919447621,2
    --70486984(+) ATGTGA/TGCACC 1 -- us2k10--------
    rs178861651,2
    F--70487223(+) TGCGC-/GCCACCACGCTCAGCTAATTTTTGTATTTTTAGTAGACGGGGTTTCACCATA
    TTGGCCAGGCTGGTCTTCAACTCCCGACCTCATGATCCACCCGCCTCGGCCTCA
    GCCAC
    1 -- us2k12Minor allele frequency- GCCACCACGCTCAGCTAATTTTTGTATTTTTAGTAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTTCAACTCCCGACCTCATGATCCACCCGCCTCGGCCTCA:0.02NS 94
    rs1843723371,2
    --70487224(+) TGCGCA/GCCACC 1 -- us2k10--------
    rs1407585531,2
    --70487317(+) CCACCC/TGCCTC 1 -- us2k10--------
    rs178820651,2
    C--70487323(+) GCCTCG/CGCCTC 1 -- us2k12Minor allele frequency- C:0.01NS 94
    rs1175735131,2
    F--70487403(+) GGGTAG/TGTAAG 1 -- us2k11Minor allele frequency- T:0.04EA 120

    HapMap Linkage Disequilibrium report for FUK (70488324 - 70514177 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 1 variation for FUK
         1 CNV: 4965

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FUK
    DNA2.0 Custom Variant and Variant Library Synthesis for FUK

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    FUK for disorders           About GeneDecksing

    OMIM gene information: 608675    OMIM disorders: --

    5 diseases for FUK:    About MalaCards
    tropical spastic paraparesis    spastic paraparesis    spasticity    tuberculosis
    mycobacterium tuberculosis


    Export disorders for FUK gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for FUK gene integrated from 9 sources:
    (articles sorted by number of sources associating them with FUK)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. Identification of human L-fucose kinase amino acid sequence. (PubMed id 12056818)1, 2, 3 Hinderlich S.... Bauer C. (2002)
    2. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    3. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PubMed id 14702039)1, 2 Ota T.... Sugano S. (2004)
    4. Systematic and quantitative assessment of the ubiquiti n-modified proteome. (PubMed id 21906983)1 Kim W....Gygi S.P. (2011)
    5. The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. (PubMed id 12975309)1 Clark H.F.... Gray A.M. (2003)
    6. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)
    7. Composition of Drosophila melanogaster proteome involved in fucosylated glycan metabolism. (PubMed id 11698403)9 Roos C.... Renkonen R. (2002)
    8. Activity of enzymes catalyzing formation of beta-L-fucosyl phosphate and GDP-beta-L-fucose in amphibian tissues and their application in chemo-enzymic synthesis of GDP-beta-L-fucose. (PubMed id 10424902)9 Druzhinina T.N....Shibaev V.N. (1999)
    9. Identification of new members of a carbohydrate kinase-encoding gene family. (PubMed id 8521274)9 Worley K.C....Smith R.F. (1995)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 197258 HGNC: 29500 AceView: FUK Ensembl:ENSG00000157353 euGenes: HUgn197258
    ECgene: FUK Kegg: 197258 H-InvDB: FUK

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for FUK Pharmacogenomics, SNPs, Pathways
    ATLAS Chromosomes in Cancer entry for FUK Genetics and Cytogenetics in Oncology and Haematology
    SeattleSNPshttp://pga.gs.washington.edu/data/fuk/

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for FUK gene:
    Search GeneIP for patents involving FUK

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0 and Sirion Biotech, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript, LifeMap BioReagents, and Sirion Biotech, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences, In Situ Hybridization Assays from
    Advanced Cell Diagnostics, Animal models from inGenious Targeting Laboratory)
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for FUK  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FUK   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FUK  
     Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for FUK   OriGene 3'-UTR Clone for FUK  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FUK   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FUK  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for FUK   OriGene Custom Protein Services for FUK  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat FUK
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FUK
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FUK
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FUK
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FUK
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FUK
     GenScript Custom Purified and Recombinant Proteins Services for FUK GenScript cDNA clones with any tag delivered in your preferred vector for FUK
     GenScript Custom Assay Services for FUK GenScript Custom Superior Antibodies Services for FUK
     GenScript Custom overexpressing Cell Line Services for FUK CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in FUK promoter
     Search Chromatin IP Primers for FUK
     RT2 qPCR Primer Assay in human, mouse, rat FUK
     Search GNC Networks for FUK
     SABiosciences Custom PCR Arrays for FUK
     Search Tocris compounds for FUK
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     FUK antibodies
     FUK proteins
     FUK lysates
     Antibodies for FUK
     See all of Abcam's Antibodies, Kits and Proteins for FUK
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     FUK Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for FUK
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FUK
     SwitchGear 3'UTR luciferase reporter plasmids for FUK
     SwitchGear Promoter luciferase reporter plasmids for FUK
     ThermoFisher Antibody for FUK
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FUK
     inGenious Targeting Laboratory - Customizable classic, inducible, and humanized mouse model solutions for FUK
    Sirion Biotech Customized:
     stable knockdown cell line services for FUK
     inducible knockdown cell line services for FUK
     design and validation of potent shRNA sequences against FUK
     adenovirus for potent knockdown of FUK
     adenovirus for overexpression of FUK
     stable overexpressing cell line services for FUK
     inducible overexpressing cell line services for FUK
           
    GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013 , 13 May 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      FUK gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 106 solr: 1.4