Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FRMD4A Gene

Aliases for FRMD4A Gene

  • FERM Domain Containing 4A 2 3 5
  • FERM Domain Containing 4 2 3
  • FRMD4 3 4
  • FERM Domain-Containing Protein 4A 3
  • BA295P9.4 3
  • KIAA1294 4
  • CCAFCA 3

External Ids for FRMD4A Gene

Previous HGNC Symbols for FRMD4A Gene

  • FRMD4

Previous GeneCards Identifiers for FRMD4A Gene

  • GC10M013725
  • GC10M013597

Summaries for FRMD4A Gene

Entrez Gene Summary for FRMD4A Gene

  • This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

GeneCards Summary for FRMD4A Gene

FRMD4A (FERM Domain Containing 4A) is a Protein Coding gene. Diseases associated with FRMD4A include Corpus Callosum, Agenesis Of, With Facial Anomalies And Cerebellar Ataxia and Arrhythmogenic Right Ventricular Dysplasia, Familial, 6. Gene Ontology (GO) annotations related to this gene include protein binding, bridging. An important paralog of this gene is FRMD4B.

UniProtKB/Swiss-Prot for FRMD4A Gene

  • Scaffolding protein that regulates epithelial cell polarity by connecting ARF6 activation with the PAR3 complex (By similarity). Plays a redundant role with FRMD4B in epithelial polarization (By similarity). May regulate MAPT secretion by activating ARF6-signaling (PubMed:27044754).

Additional gene information for FRMD4A Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FRMD4A Gene

Genomics for FRMD4A Gene

GeneHancer (GH) Regulatory Elements for FRMD4A Gene

Promoters and enhancers for FRMD4A Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH10I014330 Promoter 0.7 EPDnew 550.1 +131.2 131228 0.1 ZNF398 WT1 FRMD4A GC10P014349 GC10P014310
GH10I014403 Enhancer 1.1 FANTOM5 ENCODE dbSUPER 11.7 +56.6 56582 4.5 NCOA3 NFIB ZNF664 CTBP1 GATA3 POLR2A RCOR1 FOS CHD2 TCF7L2 FRMD4A MIR1265 ENSG00000278100
GH10I014486 Enhancer 0.7 Ensembl ENCODE 11.9 -25.4 -25358 1.9 FOXA2 RFX1 FOS BMI1 RFX5 FRMD4A FAM107B GC10M014524
GH10I013815 Enhancer 1.2 Ensembl ENCODE dbSUPER 6.3 +645.7 645702 2.2 PKNOX1 FOXA2 MZF1 FEZF1 RAD21 ZSCAN5C FOS ZNF280D RXRA ZNF488 FRMD4A NUTF2P5 ENSG00000234091 GC10M013770
GH10I013682 Enhancer 1.1 Ensembl ENCODE dbSUPER 6.3 +776.7 776713 4.9 SRF ZNF687 PKNOX1 JUN MAX ZIC2 GABPA OSR2 PRDM6 POLR2A RNA5SP301 ENSG00000234091 ENSG00000225112 FRMD4A ENSG00000273474 LOC105376426 GC10P013600
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around FRMD4A on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FRMD4A gene promoter:

Genomic Locations for FRMD4A Gene

Genomic Locations for FRMD4A Gene
818,437 bases
Minus strand

Genomic View for FRMD4A Gene

Genes around FRMD4A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FRMD4A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FRMD4A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FRMD4A Gene

Proteins for FRMD4A Gene

  • Protein details for FRMD4A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    FERM domain-containing protein 4A
    Protein Accession:
    Secondary Accessions:
    • A7E2Y3
    • Q5T377

    Protein attributes for FRMD4A Gene

    1039 amino acids
    Molecular mass:
    115458 Da
    Quaternary structure:
    • Interacts (via coiled-coil domain) with CYTH1 (via coiled-coil domain). Interacts with PARD3 (via coiled-coil domain). Found in a complex with PARD3, CYTH1 and FRMD4A. Interacts with CYTH2. Interacts with CYTH3.
    • Sequence=BAA92532.1; Type=Erroneous initiation; Evidence={ECO:0000305};

neXtProt entry for FRMD4A Gene

Post-translational modifications for FRMD4A Gene

No Post-translational modifications

No data available for DME Specific Peptides for FRMD4A Gene

Domains & Families for FRMD4A Gene

Gene Families for FRMD4A Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for FRMD4A Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

genes like me logo Genes that share domains with FRMD4A: view

No data available for UniProtKB/Swiss-Prot for FRMD4A Gene

Function for FRMD4A Gene

Molecular function for FRMD4A Gene

UniProtKB/Swiss-Prot Function:
Scaffolding protein that regulates epithelial cell polarity by connecting ARF6 activation with the PAR3 complex (By similarity). Plays a redundant role with FRMD4B in epithelial polarization (By similarity). May regulate MAPT secretion by activating ARF6-signaling (PubMed:27044754).

Phenotypes From GWAS Catalog for FRMD4A Gene

Gene Ontology (GO) - Molecular Function for FRMD4A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0030674 protein binding, bridging IEA --
genes like me logo Genes that share ontologies with FRMD4A: view
genes like me logo Genes that share phenotypes with FRMD4A: view

Human Phenotype Ontology for FRMD4A Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Model Products

miRNA for FRMD4A Gene

miRTarBase miRNAs that target FRMD4A

Clone Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for FRMD4A Gene

Localization for FRMD4A Gene

Subcellular locations from UniProtKB/Swiss-Prot for FRMD4A Gene

Cytoplasm, cytoskeleton. Cell junction, adherens junction. Cell junction, tight junction. Note=Colocalized with CYTH1 at adherens junction and tight junction. Colocalized with PARD3 during the process of epithelial polarization. {ECO:0000250 UniProtKB:Q8BIE6}.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FRMD4A gene
Compartment Confidence
cytoskeleton 3
cytosol 3
nucleus 2
golgi apparatus 2

Subcellular locations from the

Human Protein Atlas (HPA)
  • Golgi apparatus (2)
  • Nucleus (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for FRMD4A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005737 cytoplasm IEA --
GO:0005856 cytoskeleton IEA --
GO:0005912 adherens junction IEA --
GO:0005923 bicellular tight junction IEA --
GO:0030054 cell junction IEA --
genes like me logo Genes that share ontologies with FRMD4A: view

Pathways & Interactions for FRMD4A Gene

SuperPathways for FRMD4A Gene

No Data Available

Gene Ontology (GO) - Biological Process for FRMD4A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0090162 establishment of epithelial cell polarity IEA --
genes like me logo Genes that share ontologies with FRMD4A: view

No data available for Pathways by source and SIGNOR curated interactions for FRMD4A Gene

Drugs & Compounds for FRMD4A Gene

No Compound Related Data Available

Transcripts for FRMD4A Gene

Unigene Clusters for FRMD4A Gene

FERM domain containing 4A:
Representative Sequences:

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FRMD4A Gene

ExUns: 1a · 1b ^ 2 ^ 3 ^ 4 ^ 5 ^ 6 ^ 7a · 7b ^ 8 ^ 9 ^ 10 ^ 11 ^ 12a · 12b ^ 13 ^ 14 ^ 15 ^ 16 ^ 17 ^ 18 ^ 19 ^ 20 ^ 21a · 21b · 21c ^
SP1: - - - - -
SP2: - - - - - -
SP3: - - - - - - - -
SP4: -
SP5: -
SP10: - - - -
SP11: - -
SP14: - -

ExUns: 22a · 22b ^ 23a · 23b ^ 24a · 24b · 24c · 24d ^ 25 ^ 26 ^ 27 ^ 28 ^ 29a · 29b ^ 30a · 30b ^ 31a · 31b ^ 32 ^ 33a · 33b · 33c ^ 34 ^ 35
SP1: - - - -
SP2: - -
SP5: - -
SP6: - -
SP9: -
SP12: -

Relevant External Links for FRMD4A Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FRMD4A Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FRMD4A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for FRMD4A Gene

This gene is overexpressed in Heart (46.9) and Fetal Brain (14.4).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for FRMD4A Gene

Protein tissue co-expression partners for FRMD4A Gene

NURSA nuclear receptor signaling pathways regulating expression of FRMD4A Gene:


SOURCE GeneReport for Unigene cluster for FRMD4A Gene:


Evidence on tissue expression from TISSUES for FRMD4A Gene

  • Nervous system(4.7)
  • Liver(4.2)
genes like me logo Genes that share expression patterns with FRMD4A: view

No data available for mRNA differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Phenotype-based relationships between genes and organs from Gene ORGANizer for FRMD4A Gene

Orthologs for FRMD4A Gene

This gene was present in the common ancestor of animals.

Orthologs for FRMD4A Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia FRMD4A 33 34
  • 99.61 (n)
(Monodelphis domestica)
Mammalia FRMD4A 34
  • 93 (a)
(Canis familiaris)
Mammalia FRMD4A 33 34
  • 92.67 (n)
(Bos Taurus)
Mammalia FRMD4A 33 34
  • 89.81 (n)
(Mus musculus)
Mammalia Frmd4a 33 16 34
  • 89.42 (n)
(Rattus norvegicus)
Mammalia Frmd4a 33
  • 88.74 (n)
(Ornithorhynchus anatinus)
Mammalia FRMD4A 34
  • 82 (a)
(Gallus gallus)
Aves FRMD4A 34
  • 94 (a)
LOC419035 33
  • 83.63 (n)
(Anolis carolinensis)
Reptilia FRMD4A 34
  • 91 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia frmd4a 33
  • 76.08 (n)
Str.4039 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.9210 33
(Danio rerio)
Actinopterygii FRMD4A 34
  • 81 (a)
si:ch211-220f12.1 33
  • 74.5 (n)
(Caenorhabditis elegans)
Secernentea F07C6.4 34
  • 21 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 45 (a)
Species where no ortholog for FRMD4A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for FRMD4A Gene

Gene Tree for FRMD4A (if available)
Gene Tree for FRMD4A (if available)

Paralogs for FRMD4A Gene

Paralogs for FRMD4A Gene

(4) SIMAP similar genes for FRMD4A Gene using alignment to 6 proteins:

genes like me logo Genes that share paralogs with FRMD4A: view

Variants for FRMD4A Gene

Sequence variations from dbSNP and Humsavar for FRMD4A Gene

SNP ID Clin Chr 10 pos Variation AA Info Type
rs869025338 pathogenic, Corpus callosum, agenesis of, with facial anomalies and cerebellar ataxia 13,657,443(-) CCTGGGACTCCAG/CCTGGGACTCCAGCCTGGGACTCCAG coding_sequence_variant, frameshift, genic_downstream_transcript_variant
rs1000002108 -- 14,034,533(-) C/T genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000015567 -- 13,725,605(-) T/C genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant
rs1000016771 -- 14,202,560(-) C/T genic_upstream_transcript_variant, intron_variant
rs1000020842 -- 13,932,169(-) C/A genic_downstream_transcript_variant, genic_upstream_transcript_variant, intron_variant

Structural Variations from Database of Genomic Variants (DGV) for FRMD4A Gene

Variant ID Type Subtype PubMed ID
dgv121e199 CNV deletion 23128226
dgv677n100 CNV gain 25217958
esv1329436 CNV deletion 17803354
esv25190 CNV gain 19812545
esv26313 CNV gain 19812545
esv2653994 CNV deletion 19546169
esv2657983 CNV deletion 23128226
esv2663852 CNV deletion 23128226
esv2674085 CNV deletion 23128226
esv2733428 CNV deletion 23290073
esv275072 CNV gain+loss 21479260
esv2759734 CNV loss 17122850
esv2761575 CNV gain 21179565
esv32672 CNV gain 17666407
esv3302943 CNV tandem duplication 20981092
esv33167 CNV loss 17666407
esv3378758 CNV insertion 20981092
esv3450764 CNV insertion 20981092
esv3545936 CNV deletion 23714750
esv3578646 CNV loss 25503493
esv3578647 CNV loss 25503493
esv3622406 CNV loss 21293372
esv3622407 CNV loss 21293372
esv3622408 CNV loss 21293372
esv3622409 CNV loss 21293372
esv3622410 CNV loss 21293372
esv3622411 CNV loss 21293372
esv3622412 CNV gain 21293372
esv3622414 CNV loss 21293372
esv3622415 CNV loss 21293372
esv3622416 CNV loss 21293372
esv3622417 CNV loss 21293372
esv3622418 CNV loss 21293372
esv3622419 CNV loss 21293372
esv3891761 CNV gain 25118596
esv988013 CNV insertion 20482838
nsv1068282 CNV deletion 25765185
nsv1068283 CNV deletion 25765185
nsv1113252 CNV deletion 24896259
nsv1113253 CNV deletion 24896259
nsv1122494 CNV deletion 24896259
nsv1137879 CNV deletion 24896259
nsv473658 CNV novel sequence insertion 20440878
nsv474358 CNV novel sequence insertion 20440878
nsv475185 CNV novel sequence insertion 20440878
nsv507541 OTHER sequence alteration 20534489
nsv508569 CNV deletion 20534489
nsv512149 CNV loss 21212237
nsv516253 CNV loss 19592680
nsv516579 CNV loss 19592680
nsv528027 CNV gain 19592680
nsv549996 CNV gain 21841781
nsv5842 CNV deletion 18451855
nsv5855 CNV deletion 18451855
nsv831789 CNV gain+loss 17160897
nsv831790 CNV loss 17160897

Variation tolerance for FRMD4A Gene

Residual Variation Intolerance Score: 2.98% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 4.23; 62.23% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FRMD4A Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FRMD4A Gene

Disorders for FRMD4A Gene

MalaCards: The human disease database

(8) MalaCards diseases for FRMD4A Gene - From: HGMD, OMIM, ClinVar, Orphanet, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards


  • Agenesis of the corpus callosum, with facial anomalies and cerebellar ataxia (CCAFCA) [MIM:616819]: An autosomal recessive intellectual disability syndrome characterized by congenital microcephaly, low anterior hairline, bitemporal narrowing, low-set protruding ears, strabismus and tented thick eyebrows with sparse hair in their medial segment. {ECO:0000269 PubMed:25388005}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for FRMD4A

Genetic Association Database
Human Genome Epidemiology Navigator
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with FRMD4A: view

No data available for Genatlas for FRMD4A Gene

Publications for FRMD4A Gene

  1. Prediction of the coding sequences of unidentified human genes. XVI. The complete sequences of 150 new cDNA clones from brain which code for large proteins in vitro. (PMID: 10718198) Nagase T … Ohara O (DNA research : an international journal for rapid publication of reports on genes and genomes 2000) 2 3 4 58
  2. FRMD4A-cytohesin signaling modulates the cellular release of tau. (PMID: 27044754) Yan X … Huttunen HJ (Journal of cell science 2016) 3 4 58
  3. A syndrome of congenital microcephaly, intellectual disability and dysmorphism with a homozygous mutation in FRMD4A. (PMID: 25388005) Fine D … Birk OS (European journal of human genetics : EJHG 2015) 3 4 58
  4. Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. (PMID: 20379614) Rose JE … Uhl GR (Molecular medicine (Cambridge, Mass.) 2010) 3 44 58
  5. A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project. (PMID: 20031603) Marroni F … EUROSPAN Consortium (Circulation. Cardiovascular genetics 2009) 3 44 58

Products for FRMD4A Gene

Sources for FRMD4A Gene

Loading form....