Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FOXS1 Gene

Aliases for FOXS1 Gene

  • Forkhead Box S1 2 3
  • FREAC10 3 4 6
  • FKHL18 3 4 6
  • Forkhead-Related Transcription Factor 10 3 4
  • Forkhead-Like 18 Protein 3 4
  • FREAC-10 3 4
  • Forkhead-Related Transcription Factor FREAC-10 3
  • Forkhead (Drosophila)-Like 18 2
  • Forkhead-Like 18 (Drosophila) 2
  • Forkhead-Related Activator 10 3
  • Forkhead Box Protein S1 3

External Ids for FOXS1 Gene

Previous HGNC Symbols for FOXS1 Gene

  • FKHL18

Previous GeneCards Identifiers for FOXS1 Gene

  • GC20M029896
  • GC20M030432
  • GC20M027221

Summaries for FOXS1 Gene

Entrez Gene Summary for FOXS1 Gene

  • The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]

GeneCards Summary for FOXS1 Gene

FOXS1 (Forkhead Box S1) is a Protein Coding gene. GO annotations related to this gene include sequence-specific DNA binding transcription factor activity and transcription factor binding. An important paralog of this gene is FOXE3.

UniProtKB/Swiss-Prot for FOXS1 Gene

  • Transcriptional repressor that suppresses transcription from the FASLG, FOXO3 and FOXO4 promoters. May have a role in the organization of the testicular vasculature (By similarity).

No data available for Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FOXS1 Gene

Genomics for FOXS1 Gene

Regulatory Elements for FOXS1 Gene

Epigenetics Products

  • DNA Methylation CpG Assay Predesigned for Pyrosequencing in human,mouse,rat

Genomic Location for FOXS1 Gene

31,844,300 bp from pter
31,845,619 bp from pter
1,320 bases
Minus strand

Genomic View for FOXS1 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for FOXS1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FOXS1 Gene

Proteins for FOXS1 Gene

  • Protein details for FOXS1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Forkhead box protein S1
    Protein Accession:
    Secondary Accessions:
    • Q96D28

    Protein attributes for FOXS1 Gene

    330 amino acids
    Molecular mass:
    35434 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FOXS1 Gene

Proteomics data for FOXS1 Gene at MOPED

Post-translational modifications for FOXS1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for FOXS1 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for FOXS1 Gene

Domains for FOXS1 Gene

Gene Families for FOXS1 Gene

Protein Domains for FOXS1 Gene

Suggested Antigen Peptide Sequences for FOXS1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry



  • Contains 1 fork-head DNA-binding domain.
  • Contains 1 fork-head DNA-binding domain.
genes like me logo Genes that share domains with FOXS1: view

Function for FOXS1 Gene

Molecular function for FOXS1 Gene

UniProtKB/Swiss-Prot Function:
Transcriptional repressor that suppresses transcription from the FASLG, FOXO3 and FOXO4 promoters. May have a role in the organization of the testicular vasculature (By similarity).

Gene Ontology (GO) - Molecular Function for FOXS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000981 sequence-specific DNA binding RNA polymerase II transcription factor activity IBA --
GO:0003677 DNA binding ISS --
GO:0003700 sequence-specific DNA binding transcription factor activity TAS 9325056
GO:0043565 sequence-specific DNA binding IEA --
genes like me logo Genes that share ontologies with FOXS1: view
genes like me logo Genes that share phenotypes with FOXS1: view

Animal Model Products

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for FOXS1

In Situ Assay Products

Flow Cytometry Products

No data available for Enzyme Numbers (IUBMB) , Animal Models , miRNA , Transcription Factor Targets and HOMER Transcription for FOXS1 Gene

Localization for FOXS1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FOXS1 Gene

Subcellular locations from

Jensen Localization Image for FOXS1 Gene COMPARTMENTS Subcellular localization image for FOXS1 gene
Compartment Confidence
nucleus 3
cytosol 1

Gene Ontology (GO) - Cellular Components for FOXS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005634 nucleus ISS --
genes like me logo Genes that share ontologies with FOXS1: view

Pathways for FOXS1 Gene

SuperPathways for FOXS1 Gene

No Data Available

Gene Ontology (GO) - Biological Process for FOXS1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001568 blood vessel development ISS --
GO:0006351 transcription, DNA-templated --
GO:0006355 regulation of transcription, DNA-templated --
GO:0006357 regulation of transcription from RNA polymerase II promoter IBA --
GO:0006366 transcription from RNA polymerase II promoter IBA --
genes like me logo Genes that share ontologies with FOXS1: view

No data available for Pathways by source for FOXS1 Gene

Transcripts for FOXS1 Gene

mRNA/cDNA for FOXS1 Gene

(1) REFSEQ mRNAs :
(3) Additional mRNA sequences :
(31) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FOXS1 Gene

Forkhead box S1:
Representative Sequences:

CRISPR Products

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for FOXS1

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for FOXS1 Gene

No ASD Table

Relevant External Links for FOXS1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FOXS1 Gene

mRNA expression in normal human tissues for FOXS1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FOXS1 Gene

This gene is overexpressed in Artery - Coronary (10.6), Artery - Aorta (8.3), and Artery - Tibial (7.0).

Integrated Proteomics: protein expression from ProteomicsDB, PaxDb, MOPED, and MaxQB for FOXS1 Gene

SOURCE GeneReport for Unigene cluster for FOXS1 Gene Hs.516971

genes like me logo Genes that share expressions with FOXS1: view

Primer Products

In Situ Assay Products

No data available for Protein differential expression in normal tissues , mRNA Expression by UniProt/SwissProt and Expression partners for FOXS1 Gene

Orthologs for FOXS1 Gene

This gene was present in the common ancestor of animals.

Orthologs for FOXS1 Gene

Organism Taxonomy Gene Similarity Type Details
(Bos Taurus)
Mammalia FOXS1 35
  • 87.27 (n)
  • 84.85 (a)
FOXS1 36
  • 85 (a)
(Canis familiaris)
Mammalia FOXS1 35
  • 90.3 (n)
  • 89.7 (a)
(Mus musculus)
Mammalia Foxs1 35
  • 79.53 (n)
  • 75.68 (a)
Foxs1 16
Foxs1 36
  • 76 (a)
(Pan troglodytes)
Mammalia FOXS1 35
  • 99.39 (n)
  • 99.39 (a)
FOXS1 36
  • 99 (a)
(Rattus norvegicus)
Mammalia Foxs1 35
  • 79.82 (n)
  • 77.68 (a)
(Monodelphis domestica)
Mammalia FOXS1 36
  • 47 (a)
(Gallus gallus)
Aves FOXS1 35
  • 64.25 (n)
  • 58.99 (a)
(Anolis carolinensis)
Reptilia FOXS1 36
  • 43 (a)
(Danio rerio)
Actinopterygii foxc1b 36
  • 26 (a)
fruit fly
(Drosophila melanogaster)
Insecta croc 36
  • 20 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 36
  • 20 (a)
Species with no ortholog for FOXS1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FOXS1 Gene

Gene Tree for FOXS1 (if available)
Gene Tree for FOXS1 (if available)

Paralogs for FOXS1 Gene

(11) SIMAP similar genes for FOXS1 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with FOXS1: view

Variants for FOXS1 Gene

Sequence variations from dbSNP and Humsavar for FOXS1 Gene

SNP ID Clin Chr 20 pos Sequence Context AA Info Type MAF
rs368075072 -- 31,846,099(+) AGACA(-/TACACGTACAGACACACAGAGACACACAGACACAGACA)CACAC upstream-variant-2KB
rs367844725 -- 31,845,246(+) ATGTC(A/G)TGGCA reference, synonymous-codon
rs202034274 -- 31,844,841(+) GGCGT(A/G)GGGGC synonymous-codon, reference
rs201517755 -- 31,844,921(+) GGCCA(C/T)GGGGA missense, reference

Relevant External Links for FOXS1 Gene

HapMap Linkage Disequilibrium report

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for FOXS1 Gene

Disorders for FOXS1 Gene

No disorders were found for FOXS1 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for FOXS1 Gene

Publications for FOXS1 Gene

  1. Chromosome localization, sequence analysis, and expression pattern identify FKHL 18 as a novel human forkhead gene. (PMID: 9325056) Cederberg A. … Enerbaeck S. (Genomics 1997) 2 3 4
  2. The DNA sequence and comparative analysis of human chromosome 20. (PMID: 11780052) Deloukas P. … Rogers J. (Nature 2001) 3 4
  3. Comparative genomics of vertebrate Fox cluster loci. (PMID: 17062144) Wotton K.R. … Shimeld S.M. (BMC Genomics 2006) 2 3
  4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3 4
  5. Towards a proteome-scale map of the human protein-protein interaction network. (PMID: 16189514) Rual J.F. … Vidal M. (Nature 2005) 3

Products for FOXS1 Gene

Sources for FOXS1 Gene

Back to Top
