Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

FOXD4 Gene

protein-coding   GIFtS: 45
GCID: GC09M000116

forkhead box D4


(Previous symbol: FKHL9)
 Explore 5 diseases affiliated with
FOXD4 via our new
 Human Malady Compendium 
Biological research products
for FOXD4
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

Aliases
Forkhead Box D41 2     FOXD4A2 3
FKHL91 2 3 5     FREAC-52 3
FREAC51 2 3     FOXD4a1
Forkhead-Related Protein FKHL92 3     Forkhead Box Protein D42
Forkhead-Related Transcription Factor 52 3     Forkhead, Drosophila, Homolog-Like 92
Myeloid Factor-Alpha2 3     Forkhead-Related Activator 52

External Ids:    HGNC: 38051   Entrez Gene: 22982   Ensembl: ENSG000001701227   OMIM: 6010925   UniProtKB: Q129503   

Export aliases for FOXD4 gene to outside databases

Previous GC identifers: GC09M000084 GC09M000106 GC09M000058


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

Entrez Gene summary for FOXD4:
This gene encodes a member of the forkhead/winged helix-box (FOX) family of transcription factors. FOX transcription
factors play critical roles in the regulation of multiple processes including metabolism, cell proliferation and gene
expression during ontogenesis. Mutations in this gene are associated with a complex phenotype consisting of dilated
cardiomyopathy, obsessive-compulsive disorders, and suicidality. (provided by RefSeq, Mar 2012)

Gene Wiki entry for FOXD4


(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000009.11  NC_018920.1  NT_008413.18  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the FOXD4 gene promoter:
         TBP   C/EBPbeta   LCR-F1   GATA-1   GATA-2   Pax-3   FOXO4   STAT3   
         Other transcription factors

SwitchGear Promoter luciferase reporter plasmidFOXD4 promoter sequence
   Search SABiosciences Chromatin IP Primers for FOXD4

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FOXD4


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 9p24.3   Ensembl cytogenetic band:  9p24.3   HGNC cytogenetic band: 9p24.3

FOXD4 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FOXD4 gene location

GeneLoc information about chromosome 9         GeneLoc Exon Structure

GeneLoc location for GC09M000116:  view genomic region     (about GC identifiers)

Start:
116,234 bp from pter      End:
118,417 bp from pter
Size:
2,184 bases      Orientation:
minus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/Swiss-Prot: FOXD4_HUMAN, Q12950 (See protein sequence)
Recommended Name: Forkhead box protein D4  
Size: 439 amino acids; 47309 Da
Subcellular location: Nucleus
Secondary accessions: B2RN05 B9EGL7 Q5VVK1 Q8WXT6

Explore the universe of human proteins at neXtProt for FOXD4: NX_Q12950

Post-translational modifications:

  • View modification sites using PhosphoSitePlus2
  • View neXtProt modification sites for NX_Q12950

  • FOXD4 Protein expression data from MOPED and PaxDb:    About this image 
    Estimated protein expression log10 (pmol).

    REFSEQ proteins: NP_997188.2  
    ENSEMBL proteins: 
     ENSP00000371940  

    Human Recombinant Protein Products: 
    Browse Purified and Recombinant Proteins at EMD Millipore
    Browse R&D Systems for human recombinant proteins
    Browse recombinant and purified proteins available from Enzo Life Sciences
    Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
    OriGene Protein Over-expression Lysate: FOXD4
    OriGene Custom Protein Services for FOXD4 
    GenScript Custom Purified and Recombinant Proteins Services for FOXD4
    Novus Biologicals FOXD4 Protein
    Novus Biologicals FOXD4 Lysates
    Browse Sino Biological Recombinant Proteins
    Browse ProSpec Recombinant Proteins
    Uscn Proteins for FOXD4

    Gene Ontology (GO): 3 cellular component terms (GO ID links to tree view):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0005634nucleus NAS--
    GO:0005667transcription factor complex IBA--
    GO:0005730NOT nucleolus IDA--


    FOXD4 for ontologies           About GeneDecksing



    FOXD4 Antibody Products: 
    Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
    Browse R&D Systems for Antibodies
    Browse OriGene Antibodies
    OriGene Custom Antibody Services for FOXD4 
    GenScript Custom Superior Antibodies Services for FOXD4
    Novus Biologicals FOXD4 Antibody
    Search for Antibodies for FOXD4 at Abcam  
    Uscn Antibodies for FOXD4
    Search ThermoFisher Antibodies for FOXD4

    Assay Products for FOXD4: 
    Browse Kits and Assays available from EMD Millipore
    OriGene Custom Immunoassay Development
    Browse OriGene Fluorogenic Cell Assay Kits
    Browse R&D Systems for biochemical assays
    GenScript Custom Assay Services for FOXD4
    Browse Enzo Life Sciences for kits & assays
    Uscn ELISAs and CLIAs for FOXD4


    (According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
    About This Section

    FOXD4 for domains           About GeneDecksing

    3 InterPro domains/families:
     IPR011991 WHTH_trsnscrt_rep_DNA-bd_dom
     IPR018122 TF_fork_head_CS
     IPR001766 TF_fork_head

    Graphical View of Domain Structure for InterPro Entry Q12950

    ProtoNet protein and cluster: Q12950

    UniProtKB/Swiss-Prot: FOXD4_HUMAN, Q12950
    Similarity: Contains 1 fork-head DNA-binding domain


    (According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
    bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
    About This Section

    Function Summary:
         Genatlas biochemistry entry for FOXD4:
    transcription factor-like 9,with a Drosophila homeo forkhead DNA binding domain homolog

    miRNA
    Products:
        
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FOXD4
    1 QIAGEN miScript miRNA Assays for microRNA that regulate FOXD4:
    hsa-miR-873
    SwitchGear 3'UTR luciferase reporter plasmidFOXD4 3' UTR sequence
    Inhib. RNA
    Products:
        
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FOXD4 (see all 4)
    OriGene shRNA RFP: FOXD4
    OriGene siRNA: FOXD4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FOXD4

    Gene Editing
    Products:
    DNA2.0 Custom Protein Engineering Service for FOXD4

    Clone
    Products:
         
    Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FOXD4 (see all 2)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FOXD4
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: FOXD4 (NM_207305)
    Browse Sino Biological Human cDNA Clones
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FOXD4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FOXD4 

    Cell Line
    Products:
         
    GenScript Custom overexpressing Cell Line Services for FOXD4
    Search LifeMap BioReagents cell lines for FOXD4

    In Situ Assay
    Products:
       

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FOXD4

    Gene Ontology (GO): 5/6 molecular function terms (GO ID links to tree view) (see all 6):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0003690double-stranded DNA binding IBA--
    GO:0003700sequence-specific DNA binding transcription factor activity TAS9325056
    GO:0003705RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity IBA--
    GO:0008134transcription factor binding IBA--
    GO:0008301DNA binding, bending ISS7957066


    FOXD4 for ontologies           About GeneDecksing



    (Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
    About This Section



    Interactions:

        Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for FOXD4

    Gene Ontology (GO): 5/18 biological process terms (GO ID links to tree view) (see all 18):    About this table

    GO IDQualified GO termEvidencePubMed IDs
    GO:0001755neural crest cell migration IBA--
    GO:0006355regulation of transcription, DNA-dependent NAS--
    GO:0007275multicellular organismal development NAS--
    GO:0007389pattern specification process IBA--
    GO:0007422peripheral nervous system development IBA--


    FOXD4 for ontologies           About GeneDecksing



    (Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
    About This Section
    Browse Small Molecules at EMD Millipore
    Browse drugs & compounds from Enzo Life Sciences

    Browse Tocris compounds for FOXD4
    Search CenterWatch for drugs/clinical trials and news about FOXD4 

    (Secondary structures according to fRNAdb,
    GenBank/EMBL/DDBJ Accessions according to
    Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
    RefSeq according to Entrez Gene,
    DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
    exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
    RNAi Products from EMD Millipore,
    siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
    Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
    About This Section

    REFSEQ mRNAs for FOXD4 gene: 
    NM_207305.4  

    Unigene Cluster for FOXD4:

    Forkhead box D4
    Hs.584759  [show with all ESTs]
    Unigene Representative Sequence: BC089432
    1 Ensembl transcript including schematic representation, and UCSC links where relevant:
    ENST00000382500(uc003zfz.3)

    miRNA
    Products:
         
    Browse 3'-UTR reporter clones for miRNA target validation
    Browse OriGene MicroRNA Expression Plasmids
    QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FOXD4
    1 QIAGEN miScript miRNA Assays for microRNA that regulate FOXD4:
    hsa-miR-873
    SwitchGear 3'UTR luciferase reporter plasmidFOXD4 3' UTR sequence
    Inhib. RNA
    Products:
         
    Browse for Gene Knock-down Tools from EMD Millipore
    OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FOXD4 (see all 4)
    OriGene shRNA RFP: FOXD4
    OriGene siRNA: FOXD4
    QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FOXD4
    Clone
    Products:
         
    OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FOXD4 (see all 2)
    OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FOXD4
    OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling 
    GenScript: all cDNA clones in your preferred vector: FOXD4 (NM_207305)
    DNA2.0 Custom Codon Optimized Gene Synthesis Service for FOXD4
    Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FOXD4 
    Primer
    Products:
        
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FOXD4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat FOXD4
      QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FOXD4
      QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FOXD4

    Additional cDNA sequence: 

    AF452724.1 AY344640.1 BC089432.1 BC103886.2 BC136570.1 BC136571.1 U13223.1 

    1 DOTS entry:

    DT.436073 

    14 AceView cDNA sequences:

    U13223 AF452724 BV206348 CA313252 CF132229 AW451208 AI819034 AY344640 
    NM_207305 CF139066 CB856755 AI860024 AA628485 AW151124 

    GeneLoc Exon Structure


    (RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
    PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
    About This Section

    FOXD4 expression in normal human tissues (normalized intensities)
    See probesets specificity/sensitivity at GeneAnnot
    About this imageBioGPS
    CGAP TAG: TTCCCCCTTC

    Microarray
    RNAseq (Illumina Body Map)
    (100×FPKM)½
    SAGE (Serial Analysis of Gene Expression)

    About this image
    See FOXD4 Protein Expression from SPIRE MOPED and PaxDB
    Genevestigator expression for FOXD4

    SOURCE GeneReport for Unigene cluster: Hs.584759
        SABiosciences Custom PCR Arrays for FOXD4
    Primer
    Products:
    OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FOXD4
    Browse OriGene validated miRNA SYBR primer pairs
    SABiosciences RT2 qPCR Primer Assay in human, mouse / rat FOXD4
    QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FOXD4
    QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FOXD4
    In Situ
    Assay Products:
     

     
    Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FOXD4

    (Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
    About This Section

    This gene was present in the common ancestor of animals.

    Orthologs for FOXD4 gene from 4/14 species (see all 14)    About this table
    Organism Taxonomic
    classification
    Gene Description Human
    Similarity
    Orthology
    Type
    Details
    lizard
    (Anolis carolinensis)
    Reptilia --
    --
    55(a)
    1 → many
    2(49994144-49994639)
    zebrafish
    (Danio rerio)
    Actinopterygii foxd56
    forkhead box D5
    31(a)
    1 → many
    8(31300987-31302137)
    fruit fly
    (Drosophila melanogaster)
    Insecta fd59A6
    forkhead domain 59A
    19(a)
    1 → many
    2R(18754044-18758229)
    worm
    (Caenorhabditis elegans)
    Secernentea unc-1301 Protein UNC-130 49.78(n)
    50.22(a)
      174721  NM_064010.2  NP_496411.1 


    ENSEMBL Gene Tree for FOXD4 (if available)
    TreeFam Gene Tree for FOXD4 (if available) 

    (Paralogs according to 1HomoloGene,
    2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
    About This Section
    Paralogs for FOXD4 gene
    FOXF12  FOXA22  FOXD4L12  FOXF22  FOXC22  FOXB12  FOXI22  FOXE32  
    FOXC12  FOXD4L22  FOXQ12  FOXD4L32  FOXA32  FOXD12  FOXD32  FOXD4L52  
    FOXD4L42  FOXE12  FOXL12  FOXA12  FOXB22  FOXI12  FOXD4L62  FOXS12  
    FOXL22  FOXD22  
    13 SIMAP similar genes for FOXD4 using alignment to 3 protein entries:     FOXD4_HUMAN (see all proteins):
    FOXD4L2    FOXD4L4    FOXD4L5    FOXD4L1    FOXD4L3    FOXD4L6
    FOXE1    FOXC1    FOXD3    FOXE3    FOXL2    FOXB1
    FOXD2

    FOXD4 for paralogs           About GeneDecksing



    (SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
    About This Section

    10/151 NCBI SNPs in FOXD4 are shown (see all 151    About this table
    Genomic DataTranscription Related DataAllele Frequencies
    SNP IDValidClinical
    significance
    Chr 9 posSequence#AA
    Chg
    TypeMore#Allele
    freq
    PopTotal
    sample
    More
    ----------
    rs1499961151,2
    Cother116962(+) TGCCCG/ACCCAG 2 /G syn11Minor allele frequency- A:0.00NA 3488
    rs625336011,2
    --61180(+) ATTCCG/ACTCTG 1 -- us2k12Minor allele frequency- A:0.04NA 122
    rs29212981,2
    C--61276(-) TGCCTC/ACATCA 1 -- us2k11Minor allele frequency- A:0.50NA 2
    rs31196071,2
    C--61349(+) tgtcaC/Ttattg 1 -- us2k10--------
    rs625336021,2
    C,--61366(+) AGTTTG/AAGGAA 1 -- us2k12Minor allele frequency- A:0.04NA 122
    rs601318911,2
    --61573(+) GTCTAC/TCTTAC 1 -- us2k10--------
    rs115991,2
    --115758(+) GTTGCA/CAAGTC 1 -- ds50013Minor allele frequency- C:0.03NA MN 188
    rs1441691261,2
    --115821(+) AAATG-/TGTATATATATATATATATAT
    ATATATATATATATATATATATA
    TATAT
    1 -- ds50010--------
    rs712444501,2
    C--115822(+) AATGTG/ATATAT 1 -- ds50011Minor allele frequency- A:0.50NA 2
    rs625335861,2
    --115968(+) GGGGTA/GAGGAA 1 -- ds50010--------

    HapMap Linkage Disequilibrium report for FOXD4 (116234 - 118417 bp)
    Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
    Database of Genomic Variants (DGV): 10 variations for FOXD4
         10 CNVs: 8617 31461 2780 3753 52810 95777 34455 8616 52811 65299
    Human Gene Mutation Database (HGMD): FOXD4

    SABiosciences Cancer Mutation PCR Assays
    QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FOXD4
    DNA2.0 Custom Variant and Variant Library Synthesis for FOXD4

    (in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
    About This Section

    FOXD4 for disorders           About GeneDecksing

    OMIM gene information: 601092    OMIM disorders: --

    5 diseases for FOXD4:    About MalaCards
    obsessive-compulsive disorder    dilated cardiomyopathy    cardiomyopathy    leukemia
    neuronitis


    Export disorders for FOXD4 gene to outside databases

    (in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
    About This Section

    PubMed articles for FOXD4 gene, integrated from 9 sources (see all 17):
    (articles sorted by number of sources associating them with FOXD4)
        Utopia: connect your pdf to the dynamic
    world of online information

    1. FOXD4a and FOXD4b, two new winged helix transcription factors, are expressed in human leukemia cell lines. (PubMed id 12234674)1, 2, 3 Freyaldenhoven B.S.... Wielckens K. (2002)
    2. Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending. (PubMed id 7957066)1, 2, 3 Pierrou S....Carlsson P. (1994)
    3. DNA sequence and analysis of human chromosome 9. (PubMed id 15164053)1, 2 Humphray S.J.... Dunham I. (2004)
    4. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PubMed id 15489334)1, 2 Gerhard D.S....Malek J. (2004)
    5. Gene content and function of the ancestral chromosome fusion site in human chromosome 2q13-2q14.1 and paralogous regions. (PubMed id 12421752)1, 2 Fan Y.... Trask B.J. (2002)
    6. Chromosomal localization of six human forkhead genes, freac-1 (FKHL5), -3 (FKHL7), -4 (FKHL8), -5 (FKHL9), -6 (FKHL10), and -8 (FKHL12). (PubMed id 8825632)1, 3 Larsson C....Carlsson P. (1995)
    7. Pure distal 9p deletion in a female infant with cerebr al palsy. (PubMed id 22876580)1 Chen C.P....Wang W. (2012)
    8. Inv dup del(9p): prenatal diagnosis and molecular cyto genetic characterization by fluorescence in situ hybridization and array compara tive genomic hybridization. (PubMed id 21482378)1 Chen C.P....Wang W. (2011)
    9. Maternally inherited partial monosomy 9p (pter -> p24. 1) and partial trisomy 20p (pter -> p12.1) characterized by microarray comparati ve genomic hybridization. (PubMed id 21948691)1 Freitas E.L....Gil-da-Silva-Lopes V.L. (2011)
    10. Update of human and mouse forkhead box (FOX) gene fami lies. (PubMed id 20650821)1 Jackson B.C....Vasiliou V. (2010)

    (in PubMed, OMIM, and NCBI Bookshelf)
    About This Section
     ANDOR
    Aliases
    Free Text  

      Query String
    PubMed
    OMIM
    NCBI Bookshelf
      (Note: In FireFox, select the above section and copy using Ctrl-C)

    (According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
    About This Section
    Entrez Gene: 2298 HGNC: 3805 AceView: FOXD4 Ensembl:ENSG00000170122 euGenes: HUgn2298
    ECgene: FOXD4 H-InvDB: FOXD4

    (According to HUGE)
    About This Section
      --

    (According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
    Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
    About This Section
    NameDescription
    PharmGKB entry for FOXD4 Pharmacogenomics, SNPs, Pathways

    (Patent information from GeneIP,
    Licensable technologies from WIS Yeda, Salk, Tufts,
    IP news from LifeMap Sciences, Inc.)
    About This Section
    Patent Information for FOXD4 gene:
    Search GeneIP for patents involving FOXD4

    GeneCards and IP:
    Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



    (Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
    In Situ Hybridization Assays from
    Advanced Cell Diagnostics
    About This Section

     
     EMD Millipore Custom Antibody & Bulk Services
     EMD Millipore Preclinical / Clinical Development Services
     EMD Millipore Immunoassay Services
     EMD Millipore Target Screening & Profiling Services

      
     Browse Antibodies   Browse Cell Culture Products  
     Browse ELISAs   Browse Flow Cytometry Kits  
     Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
     Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
     Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
     Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
     Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
     Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
     Browse OriGene Antibodies   OriGene shRNA RFP for FOXD4  
     OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FOXD4   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FOXD4  
     OriGene Protein Over-expression Lysate for FOXD4   Browse OriGene Fluorogenic Cell Assay Kits  
     OriGene siRNA for FOXD4   Browse 3'-UTR reporter clones for miRNA target validation  
     OriGene untagged cDNA clones in CMV expression vector in human, mouse, rat for FOXD4   OriGene Myc/DDK tagged cDNA clones in CMV expression vector in human, mouse, rat for FOXD4  
     Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
     Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
     Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
     OriGene Custom Antibody Services for FOXD4   OriGene Custom Protein Services for FOXD4  
     OriGene Custom Immunoassay Development  

     
     
     QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat FOXD4
     QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FOXD4
     QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FOXD4
     QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FOXD4
     QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FOXD4
     QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FOXD4
     GenScript Custom Purified and Recombinant Proteins Services for FOXD4 GenScript cDNA clones with any tag delivered in your preferred vector for FOXD4
     GenScript Custom Assay Services for FOXD4 GenScript Custom Superior Antibodies Services for FOXD4
     GenScript Custom overexpressing Cell Line Services for FOXD4 CloneReady with Over 120,000 Genes
     Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
     Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
     Custom Peptide Services
     Search for Antibodies & Assays

     Regulatory tfbs in FOXD4 promoter
     Search Chromatin IP Primers for FOXD4
     RT2 qPCR Primer Assay in human, mouse / rat FOXD4
     Search GNC Networks for FOXD4
     SABiosciences Custom PCR Arrays for FOXD4
     Search Tocris compounds for FOXD4
     Browse Sino Biological Proteins and Antibodies
     Browse Sino Biological cDNA Clones
     Antibodies/Proteins Production Services
     Rabbit Monoclonal Antibody Platform
     Bulk Purchasing
     Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
     Novus Tissue Slides
     FOXD4 antibodies
     FOXD4 proteins
     FOXD4 lysates
     Search for Antibodies for FOXD4 at Abcam
     See all of Abcam's Antibodies, Kits and Proteins for FOXD4
     Custom Antibody / Protein Production Service
     Bulk Purchasing
     Advantages of Rabbit Monoclonal antibodies
     Abcam protocols and scientific support
     Browse ProSpec Recombinant Proteins




     FOXD4 Proteins, Antibodies, CLIAs, and ELISAs
     Search LifeMap BioReagents cell lines for FOXD4
     Gene Synthesis
     Protein Engineering
     Variant Library Synthesis
     Codon Optimization
     Protein Production and Purification
     Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FOXD4
     SwitchGear 3'UTR luciferase reporter plasmids for FOXD4
     SwitchGear Promoter luciferase reporter plasmids for FOXD4
     Search ThermoFisher Antibodies for FOXD4
     Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat FOXD4
           
    GeneCards Homepage - Last full update: 18 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 27 Apr 2013

    View Random Gene

    Category
    VWF
    (GIFTS: 73)
    von Willebrand factor
    GIFtS Group
    The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


    Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

    Hot genes      Disease genes      FOXD4 gene at Home site.
    hostname: 356977-web1.xennexinc.com index build: 100 solr: 1.4