Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FLT1 Gene

Aliases for FLT1 Gene

  • Fms Related Tyrosine Kinase 1 2 3 5
  • Vascular Permeability Factor Receptor 2 3 4
  • Fms-Related Tyrosine Kinase 1 (Vascular Endothelial Growth Factor/Vascular Permeability Factor Receptor) 2 3
  • Vascular Endothelial Growth Factor Receptor 1 2 3
  • Tyrosine-Protein Kinase Receptor FLT 3 4
  • Tyrosine-Protein Kinase FRT 3 4
  • Fms-Like Tyrosine Kinase 1 3 4
  • EC 4 58
  • VEGFR-1 3 4
  • VEGFR1 3 4
  • FLT-1 3 4
  • FLT 3 4
  • Fms-Related Tyrosine Kinase 1 2
  • EC 2.7.10 58
  • FRT 4

External Ids for FLT1 Gene

Previous HGNC Symbols for FLT1 Gene

  • FLT

Previous GeneCards Identifiers for FLT1 Gene

  • GC13M026854
  • GC13M022854
  • GC13M027805
  • GC13M026673
  • GC13M027773
  • GC13M028874
  • GC13M009695

Summaries for FLT1 Gene

Entrez Gene Summary for FLT1 Gene

  • This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]

GeneCards Summary for FLT1 Gene

FLT1 (Fms Related Tyrosine Kinase 1) is a Protein Coding gene. Diseases associated with FLT1 include Anal Canal Squamous Cell Carcinoma and Eclampsia. Among its related pathways are p70S6K Signaling and Focal Adhesion. GO annotations related to this gene include identical protein binding and protein kinase activity. An important paralog of this gene is KDR.

UniProtKB/Swiss-Prot for FLT1 Gene

  • Tyrosine-protein kinase that acts as a cell-surface receptor for VEGFA, VEGFB and PGF, and plays an essential role in the development of embryonic vasculature, the regulation of angiogenesis, cell survival, cell migration, macrophage function, chemotaxis, and cancer cell invasion. May play an essential role as a negative regulator of embryonic angiogenesis by inhibiting excessive proliferation of endothelial cells. Can promote endothelial cell proliferation, survival and angiogenesis in adulthood. Its function in promoting cell proliferation seems to be cell-type specific. Promotes PGF-mediated proliferation of endothelial cells, proliferation of some types of cancer cells, but does not promote proliferation of normal fibroblasts (in vitro). Has very high affinity for VEGFA and relatively low protein kinase activity; may function as a negative regulator of VEGFA signaling by limiting the amount of free VEGFA and preventing its binding to KDR. Likewise, isoforms lacking a transmembrane domain, such as isoform 2, isoform 3 and isoform 4, may function as decoy receptors for VEGFA. Modulates KDR signaling by forming heterodimers with KDR. Ligand binding leads to the activation of several signaling cascades. Activation of PLCG leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate and the activation of protein kinase C. Mediates phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, leading to activation of phosphatidylinositol kinase and the downstream signaling pathway. Mediates activation of MAPK1/ERK2, MAPK3/ERK1 and the MAP kinase signaling pathway, as well as of the AKT1 signaling pathway. Phosphorylates SRC and YES1, and may also phosphorylate CBL. Isoform 1 phosphorylates PLCG. Promotes phosphorylation of AKT1 at Ser-473. Promotes phosphorylation of PTK2/FAK1. Isoform 7 has a truncated kinase domain; it increases phosphorylation of SRC at Tyr-418 by unknown means and promotes tumor cell invasion.

Tocris Summary for FLT1 Gene

  • Vascular endothelial growth factor is a signaling protein involved in the regulation of angiogenesis and vasculogenesis. VEGF binds to and activates a receptor tyrosine kinase, VEGFR, through transphosphorylation. Three VEGFR isoforms have been identified in humans.

Gene Wiki entry for FLT1 Gene

Additional gene information for FLT1 Gene

No data available for CIViC summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FLT1 Gene

Genomics for FLT1 Gene

Regulatory Elements for FLT1 Gene

Enhancers for FLT1 Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH13H028407 1.8 FANTOM5 Ensembl ENCODE dbSUPER 21.7 +86.3 86256 2 ATF1 ARNT TCF12 ZNF766 GATA2 ELK1 ATF7 RUNX3 NCOA1 REST FLT1 GC13M028385
GH13H028530 1.6 FANTOM5 Ensembl ENCODE 12.6 -37.1 -37122 2 HDGF PKNOX1 ATF1 ARNT ZNF133 YBX1 FEZF1 GLI4 ZNF2 TCF12 PAN3 PAN3-AS1 FLT1 POMP POLR1D EEF1A1P3 ENSG00000279393 LOC105370135
GH13H028573 1.7 FANTOM5 Ensembl ENCODE 11.8 -79.6 -79630 2 PKNOX1 ATF1 ARNT TCF12 ZNF766 GATA2 FOS ATF7 RUNX3 NCOA1 POMP FLT1 PAN3 LOC105370135 ENSG00000279393
GH13H028391 1.3 FANTOM5 ENCODE dbSUPER 11.4 +101.7 101704 3 HDAC1 JUN FEZF1 ZIC2 TCF12 ZNF316 NFE2 RUNX3 SMARCE1 MAFG FLT1 POMP PAN3 GC13M028385
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around FLT1 on UCSC Golden Path with GeneCards custom track

Promoters for FLT1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters
ENSR00000060438 745 2401 BMI1 ZNF121 GLIS2 SCRT2 EGR2 SP3 REST ZNF398 NR2F2 ZNF341

Genomic Location for FLT1 Gene

28,300,344 bp from pter
28,495,145 bp from pter
194,802 bases
Minus strand

Genomic View for FLT1 Gene

Genes around FLT1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FLT1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FLT1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FLT1 Gene

Proteins for FLT1 Gene

  • Protein details for FLT1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Vascular endothelial growth factor receptor 1
    Protein Accession:
    Secondary Accessions:
    • A3E342
    • A3E344
    • A8KA71
    • B0LPF1
    • B2BF46
    • B2BF47
    • B2BF48
    • B3FR89
    • B5A923
    • F5H5L6
    • O60722
    • P16057
    • Q12954

    Protein attributes for FLT1 Gene

    1338 amino acids
    Molecular mass:
    150769 Da
    Quaternary structure:
    • Interacts with VEGFA, VEGFB and PGF. Monomer in the absence of bound VEGFA, VEGFB or PGF. Homodimer in the presence of bound VEGFA, VEGFB and PGF. Can also form a heterodimer with KDR. Interacts (when tyrosine phosphorylated) with CBL, CRK, GRB2, NCK1, PIK3R1, PLCG, PSEN1 and PTPN11. Probably interacts also with PTPRB. Interacts with RACK1. Identified in a complex with CBL and CD2AP.

    Three dimensional structures from OCA and Proteopedia for FLT1 Gene

    Alternative splice isoforms for FLT1 Gene

neXtProt entry for FLT1 Gene

Selected DME Specific Peptides for FLT1 Gene


Post-translational modifications for FLT1 Gene

  • Autophosphorylated on tyrosine residues upon ligand binding. Autophosphorylation occurs in trans, i.e. one subunit of the dimeric receptor phosphorylates tyrosine residues on the other subunit. Phosphorylation at Tyr-1169 is important for interaction with PLCG. Phosphorylation at Tyr-1213 is important for interaction with PIK3R1, PTPN11, GRB2, and PLCG. Phosphorylation at Tyr-1333 is important for endocytosis and for interaction with CBL, NCK1 and CRK. Is probably dephosphorylated by PTPRB.
  • N-glycosylated.
  • Ubiquitinated after VEGFA-mediated autophosphorylation, leading to proteolytic degradation.
  • Glycosylation at posLast=100100, isoforms=2, 3, 4164, posLast=196196, isoforms=2, 3, 4251, posLast=323323, isoforms=2, 3, 4402, posLast=417417, posLast=474474, isoforms=2, 3547, posLast=597597, posLast=620620, posLast=625625, and posLast=666666
  • Modification sites at PhosphoSitePlus

Domains & Families for FLT1 Gene

Gene Families for FLT1 Gene

Human Protein Atlas (HPA):
  • Cancer-related genes
  • Disease related genes
  • Enzymes
  • FDA approved drug targets
  • Plasma proteins
  • Predicted intracellular proteins
  • Predicted membrane proteins
  • Predicted secreted proteins

Graphical View of Domain Structure for InterPro Entry



  • The second and third Ig-like C2-type (immunoglobulin-like) domains are sufficient for VEGFA binding.
  • Belongs to the protein kinase superfamily. Tyr protein kinase family. CSF-1/PDGF receptor subfamily.
  • The second and third Ig-like C2-type (immunoglobulin-like) domains are sufficient for VEGFA binding.
  • Belongs to the protein kinase superfamily. Tyr protein kinase family. CSF-1/PDGF receptor subfamily.
genes like me logo Genes that share domains with FLT1: view

Function for FLT1 Gene

Molecular function for FLT1 Gene

GENATLAS Biochemistry:
fms-related receptor tyrosine kinase 1,expressed on the surface on endothelial cells
UniProtKB/Swiss-Prot CatalyticActivity:
ATP + a [protein]-L-tyrosine = ADP + a [protein]-L-tyrosine phosphate.
UniProtKB/Swiss-Prot EnzymeRegulation:
Present in an inactive conformation in the absence of bound ligand. Binding of VEGFA, VEGFB or PGF leads to dimerization and activation by autophosphorylation on tyrosine residues.
UniProtKB/Swiss-Prot Function:
Tyrosine-protein kinase that acts as a cell-surface receptor for VEGFA, VEGFB and PGF, and plays an essential role in the development of embryonic vasculature, the regulation of angiogenesis, cell survival, cell migration, macrophage function, chemotaxis, and cancer cell invasion. May play an essential role as a negative regulator of embryonic angiogenesis by inhibiting excessive proliferation of endothelial cells. Can promote endothelial cell proliferation, survival and angiogenesis in adulthood. Its function in promoting cell proliferation seems to be cell-type specific. Promotes PGF-mediated proliferation of endothelial cells, proliferation of some types of cancer cells, but does not promote proliferation of normal fibroblasts (in vitro). Has very high affinity for VEGFA and relatively low protein kinase activity; may function as a negative regulator of VEGFA signaling by limiting the amount of free VEGFA and preventing its binding to KDR. Likewise, isoforms lacking a transmembrane domain, such as isoform 2, isoform 3 and isoform 4, may function as decoy receptors for VEGFA. Modulates KDR signaling by forming heterodimers with KDR. Ligand binding leads to the activation of several signaling cascades. Activation of PLCG leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate and the activation of protein kinase C. Mediates phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, leading to activation of phosphatidylinositol kinase and the downstream signaling pathway. Mediates activation of MAPK1/ERK2, MAPK3/ERK1 and the MAP kinase signaling pathway, as well as of the AKT1 signaling pathway. Phosphorylates SRC and YES1, and may also phosphorylate CBL. Isoform 1 phosphorylates PLCG. Promotes phosphorylation of AKT1 at Ser-473. Promotes phosphorylation of PTK2/FAK1. Isoform 7 has a truncated kinase domain; it increases phosphorylation of SRC at Tyr-418 by unknown means and promotes tumor cell invasion.
UniProtKB/Swiss-Prot Induction:
Up-regulated in coculture of VSMC/endothelial cell (EC) or by direct exposure to VEGF of VSMC monoculture. Up-regulated from the second trimester of pregnancy to the term and in the placenta of women with preeclampsia (PE). Up-regulated in monocytes exposed to bacterial lipopolysaccharide (LPS).

Enzyme Numbers (IUBMB) for FLT1 Gene

Phenotypes From GWAS Catalog for FLT1 Gene

Gene Ontology (GO) - Molecular Function for FLT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004672 protein kinase activity IEA --
GO:0004713 protein tyrosine kinase activity IEA --
GO:0004714 transmembrane receptor protein tyrosine kinase activity TAS 8248162
GO:0005021 vascular endothelial growth factor-activated receptor activity IMP 11312102
GO:0005515 protein binding IPI 1312256
genes like me logo Genes that share ontologies with FLT1: view
genes like me logo Genes that share phenotypes with FLT1: view

Animal Models for FLT1 Gene

MGI Knock Outs for FLT1:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for FLT1
  • Applied Biological Materials Clones for FLT1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

No data available for Human Phenotype Ontology , Transcription Factor Targets and HOMER Transcription for FLT1 Gene

Localization for FLT1 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FLT1 Gene

Isoform 1: Cell membrane; Single-pass type I membrane protein. Endosome. Note=Autophosphorylation promotes ubiquitination and endocytosis.
Isoform 2: Secreted.
Isoform 3: Secreted.
Isoform 4: Secreted.
Isoform 5: Cytoplasm.
Isoform 6: Cytoplasm.
Isoform 7: Cytoplasm.

Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FLT1 gene
Compartment Confidence
plasma membrane 5
extracellular 5
cytoskeleton 5
endosome 5
nucleus 2
endoplasmic reticulum 2
cytosol 2
mitochondrion 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Plasma membrane (3)
  • Actin filaments (2)
See all subcellular structures

Gene Ontology (GO) - Cellular Components for FLT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region IEA --
GO:0005615 extracellular space TAS 8248162
GO:0005737 cytoplasm IEA --
GO:0005768 endosome IEA --
GO:0005886 plasma membrane TAS --
genes like me logo Genes that share ontologies with FLT1: view

Pathways & Interactions for FLT1 Gene

genes like me logo Genes that share pathways with FLT1: view

SIGNOR curated interactions for FLT1 Gene

Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for FLT1 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0001525 angiogenesis IEA --
GO:0002548 monocyte chemotaxis IDA 8605350
GO:0006468 protein phosphorylation IEA --
GO:0006935 chemotaxis IEA --
GO:0007169 transmembrane receptor protein tyrosine kinase signaling pathway TAS 2158038
genes like me logo Genes that share ontologies with FLT1: view

Drugs & Compounds for FLT1 Gene

(105) Drugs for FLT1 Gene - From: DrugBank, PharmGKB, ApexBio, DGIdb, FDA Approved Drugs, IUPHAR, HMDB, Tocris, and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
Sunitinib Approved, Investigational Pharma inhibitor, Target VEGFR/PDGFRβ/ KIT/ FLT3/RET/CSF-1R inhibitor, RTK inhibitor, Kinase Inhibitors, Vascular endothelial growth factor (VEGF) and VEGF receptor (VEGFR) inhibitors, Potent VEGFR, PDGFRbeta and KIT inhibitor 514
Pazopanib Approved Pharma inhibitor, Target VEFGR, c-Kit, and PDGFR inhibitor, Kinase Inhibitors, Vascular endothelial growth factor (VEGF) and VEGF receptor (VEGFR) inhibitors 0
regorafenib Approved Pharma inhibitor, Target Inhibitor of VEGFR/PDGFR/FGFR/mutant kit/RET/Raf-1, Kinase Inhibitors, Vascular endothelial growth factor (VEGF) and VEGF receptor (VEGFR) inhibitors 0
Axitinib Approved, Investigational Pharma Inhibition, inhibitor, Target Kinase Inhibitors, Vascular endothelial growth factor (VEGF) and VEGF receptor (VEGFR) inhibitors, Potent VEGFR-1, -2 and -3 inhibitor 113
Lenvatinib Approved Pharma inhibitor, Target Kinase Inhibitors, Vascular endothelial growth factor (VEGF) and VEGF receptor (VEGFR) inhibitors 64

(23) Additional Compounds for FLT1 Gene - From: Novoseek, HMDB, and Tocris

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
  • Adenosindiphosphorsaeure
  • Adenosine 5'-pyrophosphate
  • Adenosine diphosphate
  • Adenosine pyrophosphate
  • Adenosine-5'-diphosphate
Full agonist, Agonist 58-64-0
EG 00229
XL 184
ZM 323881 hydrochloride

(5) Tocris Compounds for FLT1 Gene

Compound Action Cas Number
Axitinib Potent VEGFR-1, -2 and -3 inhibitor 319460-85-0
EG 00229 Neuropilin 1 (NRP1) receptor antagonist; inhibits VEGFA binding to NRP1 1018927-63-3
Sunitinib malate Potent VEGFR, PDGFRbeta and KIT inhibitor 341031-54-7
XL 184 Potent VEGFR inhibitor; also inhibits other RTKs 849217-68-1
ZM 323881 hydrochloride Potent, selective inhibitor of VEGFR-2 193000-39-4

(30) ApexBio Compounds for FLT1 Gene

Compound Action Cas Number
(E)-FeCP-oxindole 884338-18-5
(Z)-FeCP-oxindole 1137967-28-2
Axitinib (AG 013736) VEGFR1/ c-Kit inhibitor 319460-85-0
BIBF 1120 VEGFR/PDGF/FGFR inhibitor 656247-17-5
Cabozantinib (XL184, BMS-907351) VEGFR2/Met/Ret/Kit/FLT//AXL inhibitor 849217-68-1
Cediranib (AZD217) VEGFR inhibitor receptor,highly potent 288383-20-0
DMH4 515880-75-8
Dovitinib (TKI258) Lactate Oral tyrosine kinase inhibitor (TKI) against FGFR1–3, VEGFR1–3, and platelet-derived growth factor receptor (PDGFR) 915769-50-5
Dovitinib (TKI-258, CHIR-258) Multitargeted RTK inhibitor 405169-16-6
Dovitinib Dilactic acid 852433-84-2
Foretinib (GSK1363089) VEGF and HGF receptor inhibitor 849217-64-7
Fruquintinib(HMPL-013) Potent and selective inhibitor of VEGFR 1, 2, 3 1194506-26-7
Ki8751 VEGFR-2 inhibitor,potent and selective 228559-41-9
KRN 633 VEGFR inhibitor,ATP-competitive 286370-15-8
Lenvatinib (E7080) VEGFR inhibitor 417716-92-8
Linifanib (ABT-869) VEGFR/PDGFR inhibitor 796967-16-3
MGCD-265 Met/Flt/Flk/Ron/Tie-2 inhibitor 875337-44-3
Motesanib Diphosphate (AMG-706) VEGFR/ PDGFR/c-Kit/Ret inhibitor 857876-30-3
OSI-930 Inhibitor of Kit, KDR, Flt, CSF-1R, c-Raf and Lck 728033-96-3
Pazopanib (GW-786034) VEGFR/PDGFR/FGFR inhibitor 635702-64-6
Pazopanib Hydrochloride VEGFR/PDGFR/FGFR/c-Kit/ c-Fms inhibitor 635702-64-6
PD 173074 FGFR inhibitor 219580-11-7
SKLB610 Potent VEGFR inhibitor 1125780-41-7
SU 4312 5812-07-7
Sunitinib RTK inhibitor 557795-19-4
Sunitinib malate VEGFR/PDGFRβ/ KIT/ FLT3/RET/CSF-1R inhibitor 341031-54-7
Tivozanib (AV-951) VEGFR inhibitor,potent and selective 475108-18-0
Vatalanib VEGFR-1/-2 inhibitor,cell-permeable 212141-54-3
Vatalanib (PTK787) 2HCl Tyrosine kinase receptor inhibitor 212141-51-0
ZM 306416 VEGFR (Flt and KDR) inhibitor 690206-97-4
genes like me logo Genes that share compounds with FLT1: view

Drug Products

Transcripts for FLT1 Gene

Unigene Clusters for FLT1 Gene

Fms-related tyrosine kinase 1:
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for FLT1
  • Applied Biological Materials Clones for FLT1
  • Vectors and viruses for ORF, Lenti, Retro, Adenovirus, AAV, and more

Alternative Splicing Database (ASD) splice patterns (SP) for FLT1 Gene

No ASD Table

Relevant External Links for FLT1 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FLT1 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FLT1 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for FLT1 Gene

This gene is overexpressed in Heart (19.3), Placenta (18.5), Pancreatic juice (11.0), and Plasma (8.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FLT1 Gene

NURSA nuclear receptor signaling pathways regulating expression of FLT1 Gene:


SOURCE GeneReport for Unigene cluster for FLT1 Gene:


mRNA Expression by UniProt/SwissProt for FLT1 Gene:

Tissue specificity: Detected in normal lung, but also in placenta, liver, kidney, heart and brain tissues. Specifically expressed in most of the vascular endothelial cells, and also expressed in peripheral blood monocytes. Isoform 2 is strongly expressed in placenta. Isoform 3 is expressed in corneal epithelial cells (at protein level). Isoform 3 is expressed in vascular smooth muscle cells (VSMC).

Evidence on tissue expression from TISSUES for FLT1 Gene

  • Heart(3.7)
  • Nervous system(3.5)
  • Lung(3)
  • Blood(2.9)
  • Muscle(2.8)
  • Eye(2.7)
  • Liver(2.7)
  • Kidney(2.6)
  • Spleen(2.5)
  • Intestine(2.2)
  • Thyroid gland(2.2)
  • Bone marrow(2.1)
genes like me logo Genes that share expression patterns with FLT1: view

Primer Products

No data available for mRNA differential expression in normal tissues , Protein tissue co-expression partners and Phenotype-based relationships between genes and organs from Gene ORGANizer for FLT1 Gene

Orthologs for FLT1 Gene

This gene was present in the common ancestor of animals.

Orthologs for FLT1 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia FLT1 33 34
  • 99.43 (n)
(Canis familiaris)
Mammalia FLT1 33 34
  • 90.3 (n)
(Bos Taurus)
Mammalia FLT1 33 34
  • 85.19 (n)
(Monodelphis domestica)
Mammalia FLT1 34
  • 82 (a)
(Mus musculus)
Mammalia Flt1 33 16 34
  • 81.89 (n)
(Ornithorhynchus anatinus)
Mammalia FLT1 34
  • 72 (a)
(Gallus gallus)
Aves FLT1 33 34
  • 73.02 (n)
(Anolis carolinensis)
Reptilia FLT1 34
  • 65 (a)
(Danio rerio)
Actinopterygii flt1 33 34
  • 58.31 (n)
-- 33
fruit fly
(Drosophila melanogaster)
Insecta tor 35
  • 46 (a)
CG3277 35
  • 34 (a)
Cad96Ca 34
  • 29 (a)
Pvr 34
  • 21 (a)
(Caenorhabditis elegans)
Secernentea Y50D4B.6 35
  • 43 (a)
kin-16 35
  • 32 (a)
R09D1.12 35
  • 30 (a)
ver-2 35
  • 27 (a)
ver-3 35
  • 22 (a)
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 36 (a)
sea squirt
(Ciona intestinalis)
Ascidiacea Cin.3210 33
Species where no ortholog for FLT1 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rat (Rattus norvegicus)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)

Evolution for FLT1 Gene

Gene Tree for FLT1 (if available)
Gene Tree for FLT1 (if available)

Paralogs for FLT1 Gene

Paralogs for FLT1 Gene Pseudogenes for FLT1 Gene

genes like me logo Genes that share paralogs with FLT1: view

Variants for FLT1 Gene

Sequence variations from dbSNP and Humsavar for FLT1 Gene

SNP ID Clin Chr 13 pos Sequence Context AA Info Type
rs553261958 A glioma low grade oligodendroglioma sample 28,345,458(+) TTTTT(C/T)GGATA reference, missense
VAR_042048 A lung adenocarcinoma sample
VAR_042052 A bladder transitional cell carcinoma sample
rs796052115 Uncertain significance 28,339,190(-) CGGCT(-/CCCTTATGATGCCAGCAAGTGGGAGTTT)GCCCG reference, frameshift-variant
rs148695719 untested 28,322,872(+) CTATC(A/T)AGTCT reference, synonymous-codon

Structural Variations from Database of Genomic Variants (DGV) for FLT1 Gene

Variant ID Type Subtype PubMed ID
esv3388394 CNV duplication 20981092
esv34052 CNV loss 18971310
esv3412790 CNV duplication 20981092
esv3550237 CNV deletion 23714750
nsv455850 CNV loss 19166990
nsv561389 CNV loss 21841781

Variation tolerance for FLT1 Gene

Residual Variation Intolerance Score: 3.25% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.40; 42.46% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FLT1 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FLT1 Gene

Disorders for FLT1 Gene

MalaCards: The human disease database

(42) MalaCards diseases for FLT1 Gene - From: HGMD, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
anal canal squamous cell carcinoma
  • squamous cell carcinoma of the anal canal
  • eclampsia in puerperium
  • preeclampsia
twin-to-twin transfusion syndrome
  • twin twin transfusion syndrome
corneal neovascularization
- elite association - COSMIC cancer census association via MalaCards
Search FLT1 in MalaCards View complete list of genes associated with diseases


  • Note=Abnormally high expression of soluble isoforms (isoform 2, isoform 3 or isoform 4) may be a cause of preeclampsia.
  • Note=Can contribute to cancer cell survival, proliferation, migration, and invasion, and tumor angiogenesis and metastasis. May contribute to cancer pathogenesis by promoting inflammatory responses and recruitment of tumor-infiltrating macrophages.

Relevant External Links for FLT1

Genetic Association Database (GAD)
Human Genome Epidemiology (HuGE) Navigator
Tumor Gene Database (TGDB):
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
genes like me logo Genes that share disorders with FLT1: view

No data available for Genatlas for FLT1 Gene

Publications for FLT1 Gene

  1. Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family. (PMID: 2158038) Shibuya M … Sato M (Oncogene 1990) 2 3 4 22 60
  2. Allelic variations in angiogenic pathway genes are associated with preeclampsia. (PMID: 20223440) Srinivas SK … Elovitz MA (American journal of obstetrics and gynecology 2010) 3 22 45 60
  3. Dinucleotide repeat polymorphism in Fms-like tyrosine kinase-1 (Flt-1) gene is not associated with preeclampsia. (PMID: 18631405) Kim SY … Ryu HM (BMC medical genetics 2008) 3 22 45 60
  4. Natural selection of FLT1 alleles and their association with malaria resistance in utero. (PMID: 18779584) Muehlenbachs A … Duffy PE (Proceedings of the National Academy of Sciences of the United States of America 2008) 3 22 45 60
  5. Expression and function of vascular endothelial growth factor receptor-1 on human colorectal cancer cells. (PMID: 15735759) Fan F … Ellis LM (Oncogene 2005) 3 4 22 60

Products for FLT1 Gene

  • Addgene plasmids for FLT1

Sources for FLT1 Gene

Loading form....