Set Analyses:
Advanced Search

Advanced Search

 
Search By
Section (entire)
for


 
or upload a file of gene symbols


Category   Symbol Source: HGNC EntrezGene Ensembl GeneCards RNA genes CroW21
GIFtS

FLJ44790 Gene

protein-coding   GIFtS: 22
GCID: GC20P060808

FLJ44790


  Search for FLJ44790
in our new
 Human Malady Compendium 
Biological research products
for FLJ44790
    

(According to 1HGNC, 2Entrez Gene,
3UniProtKB/Swiss-Prot, 4UniProtKB/TrEMBL, 5OMIM, 6GeneLoc, 7Ensembl, 8DME, 9miRBase, and/or 10fRNAdb)
About This Section

This gene clusters with an RNA gene
Subcategory (RNA class): lncRNA

Quality score for the ORGUL clustered with this gene is 7

Aliases
Uncharacterized FLJ447902
Uncharacterized Protein4

External Ids:    Entrez Gene: 4008502   Ensembl: ENSG000002039517   UniProtKB: I3L0A84   
ORGUL members:         
NONCODE:n376537    

Export aliases for FLJ44790 gene to outside databases

Previous GC identifers: GC20P061492 GC20U900174 GC20P060240


(According to Entrez Gene, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB,
UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL)
About This Section

  --

(According to GeneLoc and/or HGNC, and/or
Entrez Gene (NCBI build 37),
and/or miRBase,
Genomic Views according to UCSC (hg19) and Ensembl (release 69), Regulatory elements and Epigenetics data according to QIAGEN, SABiosciences, and/or SwitchGear Genomics)
About This Section
RefSeq DNA sequence:
NC_000020.10  NT_011362.10  
Regulatory elements:
   SABiosciences Regulatory transcription factor binding sites in the FLJ44790 gene promoter:
         ER-alpha   USF1   Spz1   HTF   Olf-1   C/EBPalpha   Arnt   CBF-A   USF-1   CBF(2)   
         Other transcription factors

Browse SwitchGear Promoter luciferase reporter plasmids
   Search SABiosciences Chromatin IP Primers for FLJ44790

Epigenetics:
QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FLJ44790


Genomic Location:
Genomic View: UCSC Golden Path with GeneCards custom track

Entrez Gene cytogenetic band: 20q13.33   Ensembl cytogenetic band:  20q13.33   

FLJ44790 Gene in genomic location: bands according to Ensembl, locations according to (and/or Entrez Gene and/or Ensembl if different)
FLJ44790 gene location

GeneLoc information about chromosome 20         GeneLoc Exon Structure

GeneLoc location for GC20P060808:  view genomic region     (about GC identifiers)

Start:
60,806,978 bp from pter      End:
60,811,355 bp from pter
Size:
4,378 bases      Orientation:
plus strand

(According to 1UniProtKB, HORDE, neXtProt, Ensembl, and/or Reactome, Modification sites according to 2PhosphoSitePlus, Specific Peptides from DME, Protein expression images according to data from SPIRE MOPED and PaxDb, RefSeq according to NCBI, PDB rendering according to OCA and/or Proteopedia, Recombinant Proteins from EMD Millipore, R&D Systems, GenScript, Enzo Life Sciences, OriGene, Novus Biologicals, Sino Biological, ProSpec, and/or Uscn,
Biochemical Assays by EMD Millipore, R&D Systems, OriGene, GenScript, Cell Signaling Technology, Enzo Life Sciences, and/or Uscn, Ontologies according to Gene Ontology Consortium 01 Mar 2013 and Entrez Gene, Antibodies by EMD Millipore, R&D Systems, GenScript, Cell Signaling Technology, OriGene, Novus Biologicals, Thermo Fisher Scientific, Abcam, and/or Uscn)
About This Section

UniProtKB/TrEMBL: I3L0A8 (See protein sequence)
Recommended Name: FLJ44790 protein  
Size: 211 amino acids; 22137 Da

FLJ44790 Protein expression data from MOPED and PaxDb:    About this image 

Estimated protein expression log10 (pmol).


ENSEMBL proteins: 
 ENSP00000359831  

Human Recombinant Protein Products: 
Browse Purified and Recombinant Proteins at EMD Millipore
Browse R&D Systems for human recombinant proteins
Browse recombinant and purified proteins available from Enzo Life Sciences
Browse OriGene full length recombinant human proteins expressed in human HEK293 cells
Browse OriGene Protein Over-expression Lysates
OriGene Custom Protein Services for FLJ44790 
GenScript Custom Purified and Recombinant Proteins Services for FLJ44790
Browse Sino Biological Recombinant Proteins
Browse ProSpec Recombinant Proteins
Browse Proteins at Uscn


FLJ44790 Antibody Products: 
Browse EMD Millipore's Extensive Line of Mono- and Polyclonal Antibodies
Browse R&D Systems for Antibodies
Browse OriGene Antibodies
OriGene Custom Antibody Services for FLJ44790 
GenScript Custom Superior Antibodies Services for FLJ44790
Search for Antibodies for FLJ44790 at Abcam  
Browse Antibodies at Uscn
Search ThermoFisher Antibodies for FLJ44790

Assay Products for FLJ44790: 
Browse Kits and Assays available from EMD Millipore
OriGene Custom Immunoassay Development
Browse OriGene Fluorogenic Cell Assay Kits
Browse R&D Systems for biochemical assays
GenScript Custom Assay Services for FLJ44790
Browse Enzo Life Sciences for kits & assays
Browse ELISAs and CLIAs at Uscn


(According to InterPro, ProtoNet, UniProtKB, and/or BLOCKS, Sets of similar genes according to GeneDecks)
About This Section

ProtoNet protein and cluster: I3L0A8


(According to 1UniProtKB, Genatlas, LifeMap Discovery™, IUBMB, and/or 2DME, Human phenotypes from GenomeRNAi, Animal models from MGI Mar 06 2013,
bound targets from SABiosciences, miRNA Gene Targets from miRTarBase shRNA from OriGene, RNAi from EMD Millipore, siRNAs from OriGene, QIAGEN, microRNA from QIAGEN, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, SwitchGear Genomics, GenScript, Sino Biological, DNA2.0, and Vector BioLabs, Cell Lines from GenScript, LifeMap BioReagents, In Situ Hybridization Assays from Advanced Cell Diagnostics, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene.)
About This Section

miRNA
Products:
    
Browse 3'-UTR reporter clones for miRNA target validation
Browse MicroRNA Expression Plasmids
QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FLJ44790
Search QIAGEN for miScript miRNA Assays for microRNAs that regulate FLJ44790
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
    
Browse for Gene Knock-down Tools from EMD Millipore
OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FLJ44790
OriGene shRNA RFP: FLJ44790
Browse OriGene siRNA
QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FLJ44790

Gene Editing
Products:
DNA2.0 Custom Protein Engineering Service for FLJ44790

Clone
Products:
     
Browse Clones for the Expression of Recombinant Proteins Available from EMD Millipore
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for FLJ44790
Browse Sino Biological Human cDNA Clones
DNA2.0 Custom Codon Optimized Gene Synthesis Service for FLJ44790
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat FLJ44790 

Cell Line
Products:
     
GenScript Custom overexpressing Cell Line Services for FLJ44790
Search LifeMap BioReagents cell lines for FLJ44790

In Situ Assay
Products:
   

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FLJ44790

1 GenomeRNAi human phenotype for FLJ44790:
 Increased HPV18 LCR reporter a 


(Pathways according to EMD Millipore, R&D Systems, Cell Signaling Technology, KEGG, PharmGKB, BioSystems, Reactome, Tocris Bioscience, GeneGo (Thomson Reuters), QIAGEN, and/or UniProtKB, Sets of similar genes according to GeneDecks, Interaction Networks according to SABiosciences, and/or STRING, Interactions according to 1UniProtKB, 2MINT, 3I2D, and/or 4STRING, with links to IntAct and Ensembl, Ontologies according to Gene Ontology Consortium 01 Mar 2013 via Entrez Gene).
About This Section



Interactions:

    Search SABiosciences Gene Network CentralTM Interacting Genes and Proteins Networks for FLJ44790

(Chemical Compounds according to UniProtKB, Enzo Life Sciences, EMD Millipore, Tocris Bioscience HMDB, BitterDB, and/or Novoseek, and Drugs according to DrugBank, Enzo Life Sciences, and/or PharmGKB, with drugs/clinical trials/news search links to CenterWatch)
About This Section
Browse Small Molecules at EMD Millipore
Browse drugs & compounds from Enzo Life Sciences

Browse Tocris compounds for FLJ44790
Search CenterWatch for drugs/clinical trials and news about FLJ44790 

(Secondary structures according to fRNAdb,
GenBank/EMBL/DDBJ Accessions according to
Unigene (Build 235 Homo sapiens; Mar 10 2013) or GenBank,
RefSeq according to Entrez Gene,
DOTS (version 10), and/or AceView, transcript ids from Ensembl with links to UCSC,
exon structure from GeneLoc, alternative splicing isoforms according to ASD and/or ECgene,
RNAi Products from EMD Millipore,
siRNAs from OriGene, QIAGEN, shRNA from OriGene, microRNA from QIAGEN,
Tagged/untagged cDNA clones from OriGene, SwitchGear Genomics, GenScript, DNA2.0, Vector BioLabs, Primers from OriGene, SABiosciences, and/or QIAGEN )
About This Section

REFSEQ mRNAs for FLJ44790 gene: 
NM_001001691.1  

Unigene Cluster for FLJ44790:

Uncharacterized FLJ44790
Hs.711994  [show with all ESTs]
Unigene Representative Sequence: AK126744
1 Ensembl transcript including schematic representation, and UCSC links where relevant:
ENST00000370795(uc002ycj.1)

miRNA
Products:
     
Browse 3'-UTR reporter clones for miRNA target validation
Browse OriGene MicroRNA Expression Plasmids
QIAGEN Custom miScript Target Protector blocks miRNA-binding site of human, mouse, rat FLJ44790
Search QIAGEN for miScript miRNA Assays for microRNAs that regulate FLJ44790
Browse SwitchGear 3'UTR luciferase reporter plasmids
Inhib. RNA
Products:
     
Browse for Gene Knock-down Tools from EMD Millipore
OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FLJ44790
OriGene shRNA RFP: FLJ44790
Browse OriGene siRNA
QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FLJ44790
Clone
Products:
     
Browse OriGene untagged/tagged cDNA clones in CMV expression vector
OriGene custom cloning services – gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
GenScript Custom all cDNA clones Services for FLJ44790
DNA2.0 Custom Codon Optimized Gene Synthesis Service for FLJ44790
Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat FLJ44790 
Primer
Products:
    
OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FLJ44790
Browse OriGene validated miRNA SYBR primer pairs
SABiosciences RT2 qPCR Primer Assay in human, mouse / rat FLJ44790
  QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FLJ44790
  QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FLJ44790

Additional cDNA sequence: 

AK126744.1 BC132993.1 XR_109635.1 XR_112171.1 

2 DOTS entries:

DT.101971283  DT.120813652 

GeneLoc Exon Structure


(RNA expression data according to H-InvDB, NONCODE, miRBase, and RNAdb, Expression images according to data from BioGPS, Illumina Human BodyMap, and CGAP SAGE, Sets of similar genes according to GeneDecks, in vivo and in vitro expression data from LifeMap Discovery™, plus additional links to Genevestigator, and/or SOURCE, and/or BioGPS, and/or UniProtKB,
PCR Arrays from SABiosciences, Primers from OriGene, SABiosciences, and/or QIAGEN, In Situ Hybridization Assays from Advanced Cell Diagnostics)
About This Section

FLJ44790 expression in normal human tissues (normalized intensities)
See probesets specificity/sensitivity at GeneAnnot
About this imageBioGPS
CGAP TAG: AGGTGACACT

Microarray
RNAseq (Illumina Body Map)
(100×FPKM)½
SAGE (Serial Analysis of Gene Expression)

About this image
See FLJ44790 Protein Expression from SPIRE MOPED and PaxDB
SOURCE GeneReport for Unigene cluster: Hs.711994
    SABiosciences Custom PCR Arrays for FLJ44790
Primer
Products:
OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FLJ44790
Browse OriGene validated miRNA SYBR primer pairs
SABiosciences RT2 qPCR Primer Assay in human, mouse / rat FLJ44790
QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FLJ44790
QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FLJ44790
In Situ
Assay Products:
 

 
Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FLJ44790

(Orthologs according to 1,2HomoloGene (2older version, for species not in 1newer version), 3euGenes, 4SGD , 5MGI Mar 06 2013, with possible further links to Flybase and/or WormBase, and/or 6Ensembl pan taxonomic compara , Gene Trees according to Ensembl and TreeFam)
About This Section
  --

ENSEMBL Gene Tree for FLJ44790 (if available)
TreeFam Gene Tree for FLJ44790 (if available) 

(Paralogs according to 1HomoloGene,
2Ensembl, and 3SIMAP, Pseudogenes according to 4Pseudogene.org Build 68)
About This Section
  --

(SNPs/Variants according to the 1NCBI SNP Database, 2Ensembl, 3PupaSUITE, UniProtKB, and DNA2.0, Linkage Disequilibrium by HapMap, Structural Variations(CNVs/InDels/Inversions) from the Database of Genomic Variants, Mutations from the Human Gene Mutation Database (HGMD) and the Locus Specific Mutation Databases (LSDB), Blood group antigen gene mutations by BGMUT, Resequencing Primers from QIAGEN, Cancer Mutation PCR Arrays and Assays and Copy Number PCR Arrays from SABiosciences)
About This Section

10/127 NCBI SNPs in FLJ44790 are shown (see all 127    About this table
Genomic DataTranscription Related DataAllele Frequencies
SNP IDValidClinical
significance
Chr 20 posSequence#AA
Chg
TypeMore#Allele
freq
PopTotal
sample
More
----------
rs72728401,2
C,F,H,--57582655(+) GGAAAC/TATCTG 1 -- us2k19Minor allele frequency- T:0.02NS EA NA CSA WA 647
rs580767831,2
F,--57582660(+) CATCTG/TGGGCT 1 -- us2k11Minor allele frequency- T:0.09WA 118
rs60614601,2
H,--57582739(+) GATGAG/AGAGAG 1 -- us2k1 trp35Minor allele frequency- A:0.00NS EA WA 500
rs61215331,2
F,--57583383(+) CGGCAG/CCTAGG 1 -- nc-transcript-variantese32Minor allele frequency- C:0.50NA 4
rs561910551,2
C--57583402(+) CGGCA-/CCTAGGACCTCCATCGGC
ACCTAGGACCTCCATCGGCA
GCTAG
1 -- nc-transcript-variant1Minor allele frequency- CCTAGGACCTCCATCGGCACCTAGGACCTCCATCGGCA:0.00NA 2
rs1154697501,2
C,F,--57584240(+) GGCTGT/GCTCTT 1 -- nc-transcript-variant1Minor allele frequency- G:0.03WA 118
rs72624801,2
C,H,--57584777(+) TCAGTC/AAGGGT 1 -- nc-transcript-variantese35Minor allele frequency- A:0.00NS EA CSA 419
rs800646231,2
--57584892(+) GGGAAT/CGTGTG 1 -- nc-transcript-variant2Minor allele frequency- C:0.07CSA WA 120
rs17395841,2
C,F,A,H,--57584959(-) AGAAGC/TGACCC 1 -- nc-transcript-variantese318Minor allele frequency- T:0.15MN NS EA NA CSA WA 2405
rs17600351,2
F,--57585343(-) gggacG/Tcagct 1 -- int11Minor allele frequency- T:0.04WA 118

HapMap Linkage Disequilibrium report for FLJ44790 (60806978 - 60811355 bp)
Structural Variations (Copy Number Variations, Insertions/Deletions, Inversions)
      Database of Genomic Variants (DGV) variations for FLJ44790: --

SABiosciences Cancer Mutation PCR Assays
Search QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FLJ44790
DNA2.0 Custom Variant and Variant Library Synthesis for FLJ44790

(in which this Gene is Involved, According to MalaCards, OMIM, UniProtKB, the University of Copenhagen DISEASES database, Genatlas, GeneTests, GAD, HuGE Navigator, and/or TGDB.)
About This Section
  --

(in PubMed. Associations of this gene to articles via 1Entrez Gene, 2UniProtKB/Swiss-Prot, 3HGNC, 4GAD, 5PharmGKB, 6HMDB, 7DrugBank, 8UniProtKB/TrEMBL, 9 Novoseek, and/or 10fRNAdb)
About This Section

PubMed article for FLJ44790 gene integrated from 9 sources:
(articles sorted by number of sources associating them with FLJ44790)
    Utopia: connect your pdf to the dynamic
world of online information

  1. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PubMed id 12477932)1 Strausberg R.L....Marra M.A. (2002)

(in PubMed, OMIM, and NCBI Bookshelf)
About This Section
 ANDOR
Aliases
Free Text  

  Query String
PubMed
OMIM
NCBI Bookshelf
  (Note: In FireFox, select the above section and copy using Ctrl-C)

(According to Entrez Gene, HGNC, AceView, euGenes, Ensembl, miRBase, ECgene, Kegg, and/or H-InvDB)
About This Section
Entrez Gene: 400850 Ensembl:ENSG00000203951 euGenes: HUgn400850

(According to HUGE)
About This Section
  --

(According to PharmGKB, ATLAS, HORDE, IMGT, LEIDEN, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL,
Wikipedia and/or GeneReviews via UniProtKB/Swiss-Prot)
About This Section
  --

(Patent information from GeneIP,
Licensable technologies from WIS Yeda, Salk, Tufts,
IP news from LifeMap Sciences, Inc.)
About This Section
Patent Information for FLJ44790 gene:
Search GeneIP for patents involving FLJ44790

GeneCards and IP:
Japan Patent Office Licenses GeneCards     European Patent Office Licenses GeneCards     Improving the IP Search



(Antibodies, recombinant proteins, and assays from EMD Millipore, R&D Systems, OriGene, QIAGEN, GenScript, Cell Signaling Technology, SABiosciences, Novus Biologicals, Sino Biological, Enzo Life Sciences, Abcam, ProSpec, Uscn, Thermo Fisher Scientific, Gene Editing from DNA2.0, Clones from EMD Millipore, OriGene, GenScript, Sino Biological, DNA2.0, SwitchGear Genomics, Vector BioLabs, Cell lines from GenScript and LifeMap BioReagents, PCR Arrays from SABiosciences, Drugs and/or compounds from EMD Millipore, Tocris Bioscience, and/or Enzo Life Sciences),
In Situ Hybridization Assays from
Advanced Cell Diagnostics
About This Section

 
 EMD Millipore Custom Antibody & Bulk Services
 EMD Millipore Preclinical / Clinical Development Services
 EMD Millipore Immunoassay Services
 EMD Millipore Target Screening & Profiling Services

  
 Browse Antibodies   Browse Cell Culture Products  
 Browse ELISAs   Browse Flow Cytometry Kits  
 Browse Primer Pairs   Browse Kinase Activity Assays/Reagents  
 Browse ELISpot Kits/Development Modules   Browse TFB/Immunoprecipitation Assays  
 Browse Apoptosis Detection Kits/Reagents   Browse Ubiquitin Proteasome Pathway (UPP) Assay Kits/Reagents  
 Browse DNA Damage/Repair Kits/Reagents   Browse Multiplex/Array Assay Kits/Reagents  
 Browse Cell Selection/Detection Kits/Reagents   Browse Secondary Antibodies/Controls/Staining Reagents  
 Browse Phosphatase Activity Assays/Reagents   Browse Recombinant/Natural Proteins  
 Browse OriGene Antibodies   OriGene shRNA RFP for FLJ44790  
 OriGene 29mer shRNA kits in GFP-retroviral vector in human, mouse, rat for FLJ44790   OriGene genome-wide validated SYBR primer pairs in human, mouse, rat for FLJ44790  
 Browse OriGene Protein Over-expression Lysates   Browse OriGene Fluorogenic Cell Assay Kits  
 Browse OriGene siRNAs   Browse 3'-UTR reporter clones for miRNA target validation  
 Browse OriGene untagged cDNA clones in CMV expression vector   Browse OriGene Myc/DDK tagged cDNA clones in CMV expression vector  
 Browse OriGene GFP tagged cDNA clones in CMV expression vector   Browse OriGene MicroRNA Expression Plasmids  
 Browse OriGene basic RS shRNAs   Browse OriGene validated miRNA SYBR primer pairs  
 Browse OriGene full length recombinant human proteins expressed in human HEK293 cells   OriGene custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling  
 OriGene Custom Antibody Services for FLJ44790   OriGene Custom Protein Services for FLJ44790  
 OriGene Custom Immunoassay Development  

 
 
 QIAGEN Custom miScript Target Protector blocks miRNA-binding site of in human, mouse, rat FLJ44790
 Search QIAGEN SeqTarget long-range PCR primers in human, mouse, rat for resequencing FLJ44790
 QIAGEN PyroMark CpG Assay predesigned Pyrosequencing DNA Methylation assays in human, mouse, rat FLJ44790
 QIAGEN FlexiTube/FlexiPlate siRNA for gene silencing in human, mouse, rat FLJ44790
 QIAGEN QuantiFast Probe-based Assays in human, mouse, rat FLJ44790
 QIAGEN QuantiTect SYBR Green Assays in human, mouse, rat FLJ44790
 GenScript Custom Purified and Recombinant Proteins Services for FLJ44790 GenScript Custom cDNA clones with any tag delivered in your preferred vector Services for FLJ44790
 GenScript Custom Assay Services for FLJ44790 GenScript Custom Superior Antibodies Services for FLJ44790
 GenScript Custom overexpressing Cell Line Services for FLJ44790 CloneReady with Over 120,000 Genes
 Gene Synthesis: Any Gene in Any Vector Vector-based siRNA and miRNA, Ready for Transfection
 Gene Mutant Library, Variants up to 10^11 Plasmid Preparation
 Custom Peptide Services
 Search for Antibodies & Assays

 Regulatory tfbs in FLJ44790 promoter
 Search Chromatin IP Primers for FLJ44790
 RT2 qPCR Primer Assay in human, mouse / rat FLJ44790
 Search GNC Networks for FLJ44790
 SABiosciences Custom PCR Arrays for FLJ44790
 Search Tocris compounds for FLJ44790
 Browse Sino Biological Proteins and Antibodies
 Browse Sino Biological cDNA Clones
 Antibodies/Proteins Production Services
 Rabbit Monoclonal Antibody Platform
 Bulk Purchasing
 Search www.enzolifesciences.com for proteins, assays, substrates, inhibitors & antibodies
 Novus Biologicals
 Novus Tissue Slides
 Search for Antibodies for FLJ44790 at Abcam
 See all of Abcam's Antibodies, Kits and Proteins for FLJ44790
 Custom Antibody / Protein Production Service
 Bulk Purchasing
 Advantages of Rabbit Monoclonal antibodies
 Abcam protocols and scientific support
 Browse ProSpec Recombinant Proteins




 Browse ELISAs, CLIAs, Proteins, and Antibodies at Uscn
 Search LifeMap BioReagents cell lines for FLJ44790
 Gene Synthesis
 Protein Engineering
 Variant Library Synthesis
 Codon Optimization
 Protein Production and Purification
 Advanced Cell Diagnostics RNAscope RNA in situ hybridization assays for FLJ44790
 Browse SwitchGear 3'UTR luciferase reporter plasmids for FLJ44790
 Browse SwitchGear Promoter luciferase reporter plasmids for FLJ44790
 Search ThermoFisher Antibodies for FLJ44790
 Search Vector BioLabs for ready-to-use adenovirus/AAV for human, mouse, rat FLJ44790
       
GeneCards Homepage - Last full update: 19 Mar 2013 - Incrementals: 21 Mar 2013 , 15 Apr 2013 , 26 Apr 2013

View Random Gene

Category
VWF
(GIFTS: 73)
von Willebrand factor
GIFtS Group
The GeneCards human gene database gene index: 1 3 5 6 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 


Developed at the Crown Human Genome Center, Department of Molecular Genetics, the Weizmann Institute of Science

Hot genes      Disease genes      FLJ44790 gene at Home site.
hostname: 356980-web2.xennexinc.com index build: 100 solr: 1.4