Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FGF16 Gene

Aliases for FGF16 Gene

  • Fibroblast Growth Factor 16 2 3 5
  • Metacarpal 4-5 Fusion 2 3
  • FGF-16 3 4
  • MF4 3

External Ids for FGF16 Gene

Previous HGNC Symbols for FGF16 Gene

  • MF4

Previous GeneCards Identifiers for FGF16 Gene

  • GC00U990451
  • GC13P020043
  • GC0XP076516
  • GC0XP076709
  • GC0XP070299

Summaries for FGF16 Gene

Entrez Gene Summary for FGF16 Gene

  • This gene encodes a member of a family of proteins that are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene is expressed in cardiac cells and is required for proper heart development. Mutation in this gene was also observed in individuals with metacarpal 4-5 fusion. [provided by RefSeq, Mar 2014]

GeneCards Summary for FGF16 Gene

FGF16 (Fibroblast Growth Factor 16) is a Protein Coding gene. Diseases associated with FGF16 include Metacarpal 4-5 Fusion. Among its related pathways are RET signaling and Apoptotic Pathways in Synovial Fibroblasts. Gene Ontology (GO) annotations related to this gene include growth factor activity and fibroblast growth factor receptor binding. An important paralog of this gene is FGF9.

UniProtKB/Swiss-Prot for FGF16 Gene

  • Plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation, and is required for normal cardiomyocyte proliferation and heart development.

Additional gene information for FGF16 Gene

No data available for CIViC summary , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FGF16 Gene

Genomics for FGF16 Gene

GeneHancer (GH) Regulatory Elements for FGF16 Gene

Promoters and enhancers for FGF16 Gene
GeneHancer (GH) Identifier GH Type GH
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH0XI077446 Promoter 0.5 Ensembl 550.8 -0.3 -304 1.8 FGF16 SPRYD7P1
GH0XI078102 Promoter/Enhancer 2.1 EPDnew Ensembl ENCODE 5.4 +657.6 657649 4.6 HDGF PKNOX1 SMAD1 MLX ARID4B SIN3A DMAP1 ZNF2 YY1 POLR2B GC0XP078104 GC0XP078105 PGK1 TAF9B CYSLTR1 FGF16 GC0XM078132 GC0XM078131 GC0XM078130
GH0XI077493 Enhancer 0.7 Ensembl ENCODE 13.3 +47.0 46978 0.9 ZNF148 OSR2 MAZ GLIS2 ZNF341 ZIC2 FGF16 GC0XP077687
GH0XI077527 Enhancer 0.7 ENCODE 12 +80.4 80390 1.2 NFRKB TEAD4 TAL1 CEBPG TCF12 NCOR1 VEZF1 CBFA2T2 PRDM10 RNF2 FGF16 MAGT1 GC0XP077687 ATRX
GH0XI078325 Promoter/Enhancer 1.5 EPDnew Ensembl ENCODE 5.2 +881.0 881025 5.8 SRF NR2F1 IKZF1 JUNB EBF1 BATF RUNX3 CYSLTR1 TAF9B FGF16 HMGN1P34
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around FGF16 on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FGF16 gene promoter:

Genomic Locations for FGF16 Gene

Genomic Locations for FGF16 Gene
9,874 bases
Plus strand

Genomic View for FGF16 Gene

Genes around FGF16 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FGF16 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FGF16 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FGF16 Gene

Proteins for FGF16 Gene

  • Protein details for FGF16 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Recommended name:
    Fibroblast growth factor 16
    Protein Accession:

    Protein attributes for FGF16 Gene

    207 amino acids
    Molecular mass:
    23759 Da
    Quaternary structure:
    • Interacts with FGFR1 and FGFR2.

neXtProt entry for FGF16 Gene

Post-translational modifications for FGF16 Gene

Other Protein References for FGF16 Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for FGF16 Gene

Domains & Families for FGF16 Gene

Gene Families for FGF16 Gene

Human Protein Atlas (HPA):
  • Disease related genes
  • Predicted intracellular proteins

Suggested Antigen Peptide Sequences for FGF16 Gene

Graphical View of Domain Structure for InterPro Entry



  • Belongs to the heparin-binding growth factors family.
  • Belongs to the heparin-binding growth factors family.
genes like me logo Genes that share domains with FGF16: view

Function for FGF16 Gene

Molecular function for FGF16 Gene

UniProtKB/Swiss-Prot Function:
Plays an important role in the regulation of embryonic development, cell proliferation and cell differentiation, and is required for normal cardiomyocyte proliferation and heart development.

Gene Ontology (GO) - Molecular Function for FGF16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0004713 protein tyrosine kinase activity TAS --
GO:0005088 Ras guanyl-nucleotide exchange factor activity TAS --
GO:0005104 fibroblast growth factor receptor binding IEA --
GO:0008083 growth factor activity IEA,TAS --
GO:0016303 1-phosphatidylinositol-3-kinase activity TAS --
genes like me logo Genes that share ontologies with FGF16: view
genes like me logo Genes that share phenotypes with FGF16: view

Human Phenotype Ontology for FGF16 Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for FGF16 Gene

MGI Knock Outs for FGF16:

Animal Model Products

miRNA for FGF16 Gene

miRTarBase miRNAs that target FGF16

Inhibitory RNA Products

Clone Products

No data available for Enzyme Numbers (IUBMB) , Phenotypes From GWAS Catalog , Transcription Factor Targets and HOMER Transcription for FGF16 Gene

Localization for FGF16 Gene

Subcellular locations from UniProtKB/Swiss-Prot for FGF16 Gene


Subcellular locations from

Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FGF16 gene
Compartment Confidence
extracellular 5
cytosol 2
mitochondrion 1

Gene Ontology (GO) - Cellular Components for FGF16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space TAS 9473496
GO:0005622 intracellular IEA --
genes like me logo Genes that share ontologies with FGF16: view

No data available for Subcellular locations from the Human Protein Atlas (HPA) for FGF16 Gene

Pathways & Interactions for FGF16 Gene

SuperPathways for FGF16 Gene

SuperPathway Contained pathways
1 RET signaling
2 Downstream signaling of activated FGFR2
3 Apoptotic Pathways in Synovial Fibroblasts
4 GPCR Pathway
5 PI3K/AKT activation
genes like me logo Genes that share pathways with FGF16: view

Gene Ontology (GO) - Biological Process for FGF16 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000165 MAPK cascade TAS --
GO:0001936 NOT regulation of endothelial cell proliferation IDA 16756958
GO:0007165 signal transduction TAS 9473496
GO:0007267 cell-cell signaling TAS 9473496
GO:0008152 metabolic process TAS 9473496
genes like me logo Genes that share ontologies with FGF16: view

No data available for SIGNOR curated interactions for FGF16 Gene

Drugs & Compounds for FGF16 Gene

No Compound Related Data Available

Transcripts for FGF16 Gene

mRNA/cDNA for FGF16 Gene

(1) REFSEQ mRNAs :
(2) Selected AceView cDNA sequences:
(1) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Inhibitory RNA Products

Clone Products

Alternative Splicing Database (ASD) splice patterns (SP) for FGF16 Gene

No ASD Table

Relevant External Links for FGF16 Gene

GeneLoc Exon Structure for
ECgene alternative splicing isoforms for

Expression for FGF16 Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FGF16 Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FGF16 Gene

This gene is overexpressed in Adipose - Subcutaneous (x5.7) and Breast - Mammary Tissue (x4.1).

Protein differential expression in normal tissues from HIPED for FGF16 Gene

This gene is overexpressed in Heart (69.0).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FGF16 Gene

Protein tissue co-expression partners for FGF16 Gene

NURSA nuclear receptor signaling pathways regulating expression of FGF16 Gene:


SOURCE GeneReport for Unigene cluster for FGF16 Gene:


Evidence on tissue expression from TISSUES for FGF16 Gene

  • Heart(4.3)

Phenotype-based relationships between genes and organs from Gene ORGANizer for FGF16 Gene

Germ Layers:
  • mesoderm
  • skeleton
  • digit
  • finger
  • hand
  • upper limb
genes like me logo Genes that share expression patterns with FGF16: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for FGF16 Gene

Orthologs for FGF16 Gene

This gene was present in the common ancestor of chordates.

Orthologs for FGF16 Gene

Organism Taxonomy Gene Similarity Type Details
(Pan troglodytes)
Mammalia FGF16 33 34
  • 99.68 (n)
(Mus musculus)
Mammalia Fgf16 33 16 34
  • 95.33 (n)
(Bos Taurus)
Mammalia FGF16 33 34
  • 94.36 (n)
(Canis familiaris)
Mammalia FGF16 33 34
  • 94.04 (n)
(Rattus norvegicus)
Mammalia Fgf16 33
  • 94.04 (n)
(Monodelphis domestica)
Mammalia FGF16 34
  • 53 (a)
(Gallus gallus)
Aves FGF16 33 34
  • 82.13 (n)
(Anolis carolinensis)
Reptilia FGF16 34
  • 93 (a)
tropical clawed frog
(Silurana tropicalis)
Amphibia fgf16 33
  • 76.9 (n)
(Danio rerio)
Actinopterygii fgf16 33 34
  • 72.91 (n)
sea squirt
(Ciona savignyi)
Ascidiacea CS-FGF9/16/20 34
  • 15 (a)
Species where no ortholog for FGF16 was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • platypus (Ornithorhynchus anatinus)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FGF16 Gene

Gene Tree for FGF16 (if available)
Gene Tree for FGF16 (if available)

Paralogs for FGF16 Gene

Paralogs for FGF16 Gene

(19) SIMAP similar genes for FGF16 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with FGF16: view

Variants for FGF16 Gene

Sequence variations from dbSNP and Humsavar for FGF16 Gene

SNP ID Clin Chr 0X pos Variation AA Info Type
rs587777050 pathogenic, Metacarpal 4-5 fusion 77,456,433(+) C/T coding_sequence_variant, stop_gained
rs587777051 pathogenic, Metacarpal 4-5 fusion 77,456,368(+) C/A coding_sequence_variant, stop_gained
rs606231304 pathogenic, Metacarpal 4-5 fusion 77,454,155(+) AGGAATCCTGGAGTTTATCAG/AGGAATCCTGGAGTTTATCAGGAATCCTGGAGTTTATCAG coding_sequence_variant, splice_acceptor_variant
VAR_072396 Metacarpal 4-5 fusion (MF4) [MIM:309630] p.Arg68Leu
rs1000164355 -- 77,447,818(+) C/T coding_sequence_variant, synonymous_variant

Additional Variant Information for FGF16 Gene

Human Gene Mutation Database (HGMD)
SNPedia medical, phenotypic, and genealogical associations of SNPs for

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot , Structural Variations from Database of Genomic Variants (DGV) and Variation tolerance for FGF16 Gene

Disorders for FGF16 Gene

MalaCards: The human disease database

(1) MalaCards diseases for FGF16 Gene - From: HGMD, OMIM, ClinVar, Orphanet, Swiss-Prot, and GeneCards

Disorder Aliases PubMed IDs
metacarpal 4-5 fusion
  • mf4
- elite association - COSMIC cancer census association via MalaCards
Search FGF16 in MalaCards View complete list of genes associated with diseases


  • Metacarpal 4-5 fusion (MF4) [MIM:309630]: A rare congenital malformation of the hand characterized by the partial or complete fusion of the fourth and fifth metacarpals. The anomaly occurs as an isolated trait or part of a syndrome. {ECO:0000269 PubMed:23709756, ECO:0000269 PubMed:25333065}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Additional Disease Information for FGF16

genes like me logo Genes that share disorders with FGF16: view

No data available for Genatlas for FGF16 Gene

Publications for FGF16 Gene

  1. Whole exome sequencing identifies FGF16 nonsense mutations as the cause of X-linked recessive metacarpal 4/5 fusion. (PMID: 23709756) Jamsheer A … Mundlos S (Journal of medical genetics 2013) 2 3 4 58
  2. Structure and expression of a novel member, FGF-16, on the fibroblast growth factor family. (PMID: 9473496) Miyake A … Itoh N (Biochemical and biophysical research communications 1998) 2 3 4 58
  3. Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family. (PMID: 16597617) Zhang X … Ornitz DM (The Journal of biological chemistry 2006) 3 4 58
  4. Fibroblast growth factor 16 and 18 are expressed in human cardiovascular tissues and induce on endothelial cells migration but not proliferation. (PMID: 16756958) Antoine M … Kiefer P (Biochemical and biophysical research communications 2006) 3 22 58
  5. Secretion of FGF-16 requires an uncleaved bipartite signal sequence. (PMID: 12851399) Miyakawa K … Imamura T (The Journal of biological chemistry 2003) 3 22 58

Products for FGF16 Gene

Sources for FGF16 Gene

Loading form....