Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FASLG Gene

Aliases for FASLG Gene

  • Fas Ligand 2 3 4 5
  • Fas Ligand (TNF Superfamily, Member 6) 2 3
  • Apoptosis Antigen Ligand 3 4
  • Fas Antigen Ligand 3 4
  • CD95 Ligand 3 4
  • APT1LG1 3 4
  • TNFSF6 3 4
  • CD95-L 3 4
  • CD95L 3 4
  • APTL 3 4
  • FASL 3 4
  • Tumor Necrosis Factor (Ligand) Superfamily, Member 6 2
  • Tumor Necrosis Factor Ligand Superfamily Member 6 3
  • Mutant Tumor Necrosis Factor Family Member 6 3
  • Apoptosis (APO-1) Antigen Ligand 1 3
  • Tumor Necrosis Factor Ligand 1A 3
  • CD178 Antigen 4
  • ALPS1B 3
  • TNLG1A 3
  • CD178 3

External Ids for FASLG Gene

Previous HGNC Symbols for FASLG Gene

  • APT1LG1
  • TNFSF6

Previous GeneCards Identifiers for FASLG Gene

  • GC01P169360
  • GC01P170894
  • GC01P143852

Summaries for FASLG Gene

Entrez Gene Summary for FASLG Gene

  • This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]

GeneCards Summary for FASLG Gene

FASLG (Fas Ligand) is a Protein Coding gene. Diseases associated with FASLG include Autoimmune Lymphoproliferative Syndrome and Lung Cancer. Among its related pathways are Development IGF-1 receptor signaling and Bacterial infections in CF airways. GO annotations related to this gene include receptor binding and tumor necrosis factor receptor binding. An important paralog of this gene is TNFSF14.

UniProtKB/Swiss-Prot for FASLG Gene

  • Cytokine that binds to TNFRSF6/FAS, a receptor that transduces the apoptotic signal into cells. May be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both. Binding to the decoy receptor TNFRSF6B/DcR3 modulates its effects.

  • The FasL intracellular domain (FasL ICD) cytoplasmic form induces gene transcription inhibition.

Gene Wiki entry for FASLG Gene

No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FASLG Gene

Genomics for FASLG Gene

Regulatory Elements for FASLG Gene

Enhancers for FASLG Gene
GeneHancer Identifier Enhancer Score Enhancer Sources Gene-Enhancer Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Gene Targets for Enhancer
GH01G172662 1.8 FANTOM5 Ensembl ENCODE dbSUPER 23.3 +4.4 4362 2.2 PKNOX1 CBX3 NFIB FEZF1 ZBTB40 TCF12 SCRT2 RELB FOS ETV6 FASLG SUCO SLC25A38P1
GH01G172892 1.7 FANTOM5 Ensembl ENCODE dbSUPER 14.9 +237.3 237262 7.3 PKNOX1 FEZF1 RAD21 BRCA1 GATA2 EGR1 SCRT2 RCOR1 FOS CEBPB FASLG TNFSF4 ENSG00000224228 SUCO AIMP1P2 ENSG00000224000
GH01G172703 0.9 FANTOM5 ENCODE dbSUPER 25.5 +45.2 45184 1.2 FOSL1 IKZF1 FASLG SUCO SLC25A38P1
GH01G172717 1.3 Ensembl ENCODE 10.9 +59.7 59723 2.8 PKNOX1 FOXA2 ATF1 MLX TCF12 ZNF766 ZNF143 ZHX2 REST ZNF592 ENSG00000224228 RNU6-693P FASLG SUCO C1orf105 PIGC SLC25A38P1
GH01G172696 1.6 FANTOM5 Ensembl ENCODE dbSUPER 8.6 +40.0 40041 5.4 TSC22D4 ZNF175 CEBPG FOSL1 GATA2 ETV6 FOS RNF2 L3MBTL2 CEBPB FASLG SUCO SLC25A38P1
- Elite enhancer and/or Elite enhancer-gene association Download GeneHancer data dump

Enhancers around FASLG on UCSC Golden Path with GeneCards custom track

Genomic Location for FASLG Gene

Chromosome:
1
Start:
172,659,008 bp from pter
End:
172,666,874 bp from pter
Size:
7,867 bases
Orientation:
Plus strand

Genomic View for FASLG Gene

Genes around FASLG on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FASLG Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FASLG Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FASLG Gene

Proteins for FASLG Gene

  • Protein details for FASLG Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    P48023-TNFL6_HUMAN
    Recommended name:
    Tumor necrosis factor ligand superfamily member 6
    Protein Accession:
    P48023
    Secondary Accessions:
    • Q9BZP9

    Protein attributes for FASLG Gene

    Size:
    281 amino acids
    Molecular mass:
    31485 Da
    Quaternary structure:
    • Homotrimer (Probable). Interacts with ARHGAP9, BAIAP2L1, BTK, CACNB3, CACNB4, CRK, DLG2, DNMBP, DOCK4, EPS8L3, FGR, FYB, FYN, HCK, ITK, ITSN2, KALRN, LYN, MACC1, MIA, MPP4, MYO15A, NCF1, NCK1, NCK2, NCKIPSD, OSTF1, PIK3R1, PSTPIP1, RIMBP3C, SAMSN1, SH3GL3, SH3PXD2B, SH3PXD2A, SH3RF2, SKAP2, SNX33, SNX9, SORBS3, SPTA1, SRC, SRGAP1, SRGAP2, SRGAP3, TEC, TJP3 and YES1.

    Three dimensional structures from OCA and Proteopedia for FASLG Gene

    Alternative splice isoforms for FASLG Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for FASLG Gene

Post-translational modifications for FASLG Gene

  • Monoubiquitinated.
  • N-glycosylated.
  • Phosphorylated by FGR on tyrosine residues; this is required for ubiquitination and subsequent internalization.
  • The soluble form derives from the membrane form by proteolytic processing. The membrane-bound form undergoes two successive intramembrane proteolytic cleavages. The first one is processed by ADAM10 producing an N-terminal fragment, which lacks the receptor-binding extracellular domain. This ADAM10-processed FasL (FasL APL) remnant form is still membrane anchored and further processed by SPPL2A that liberates the FasL intracellular domain (FasL ICD). FasL shedding by ADAM10 is a prerequisite for subsequent intramembrane cleavage by SPPL2A in T-cells.
  • Glycosylation at Asn184, isoforms=250, and isoforms=260
  • Modification sites at PhosphoSitePlus

Other Protein References for FASLG Gene

ENSEMBL proteins:
REFSEQ proteins:

No data available for DME Specific Peptides for FASLG Gene

Domains & Families for FASLG Gene

Graphical View of Domain Structure for InterPro Entry

P48023

UniProtKB/Swiss-Prot:

TNFL6_HUMAN :
  • Belongs to the tumor necrosis factor family.
Family:
  • Belongs to the tumor necrosis factor family.
genes like me logo Genes that share domains with FASLG: view

Function for FASLG Gene

Molecular function for FASLG Gene

UniProtKB/Swiss-Prot Function:
Cytokine that binds to TNFRSF6/FAS, a receptor that transduces the apoptotic signal into cells. May be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both. Binding to the decoy receptor TNFRSF6B/DcR3 modulates its effects.
UniProtKB/Swiss-Prot Function:
The FasL intracellular domain (FasL ICD) cytoplasmic form induces gene transcription inhibition.

Gene Ontology (GO) - Molecular Function for FASLG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005102 receptor binding TAS 7826947
GO:0005123 death receptor binding IEA --
GO:0005125 cytokine activity IEA --
GO:0005164 tumor necrosis factor receptor binding IEA --
GO:0005515 protein binding IPI 12198154
genes like me logo Genes that share ontologies with FASLG: view
genes like me logo Genes that share phenotypes with FASLG: view

Human Phenotype Ontology for FASLG Gene

HPO Id HPO Name Alternative Ids Definition Synonyms

Animal Models for FASLG Gene

MGI Knock Outs for FASLG:

Animal Model Products

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for FASLG

No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for FASLG Gene

Localization for FASLG Gene

Subcellular locations from UniProtKB/Swiss-Prot for FASLG Gene

Cell membrane; Single-pass type II membrane protein. Cytoplasmic vesicle lumen. Lysosome lumen. Note=Is internalized into multivesicular bodies of secretory lysosomes after phosphorylation by FGR and monoubiquitination. Colocalizes with the SPPL2A protease at the cell membrane.
Tumor necrosis factor ligand superfamily member 6, soluble form: Secreted. Note=May be released into the extracellular fluid, probably by cleavage form the cell surface. {ECO:0000250}.
FasL intracellular domain: Nucleus. Note=The FasL ICD cytoplasmic form is translocated into the nucleus.

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FASLG gene
Compartment Confidence
plasma membrane 5
extracellular 5
nucleus 5
lysosome 5
cytosol 4
mitochondrion 3
cytoskeleton 1
endoplasmic reticulum 1

Gene Ontology (GO) - Cellular Components for FASLG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005576 extracellular region TAS --
GO:0005615 extracellular space IDA 18835034
GO:0005634 nucleus IDA,IEA 17557115
GO:0005764 lysosome IEA --
GO:0005886 plasma membrane IDA 12201652
genes like me logo Genes that share ontologies with FASLG: view

Pathways & Interactions for FASLG Gene

genes like me logo Genes that share pathways with FASLG: view

Pathways by source for FASLG Gene

SIGNOR curated interactions for FASLG Gene

Activates:
Is activated by:
Is inactivated by:

Gene Ontology (GO) - Biological Process for FASLG Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0000122 negative regulation of transcription from RNA polymerase II promoter IDA 17557115
GO:0006351 transcription, DNA-templated IEA --
GO:0006355 regulation of transcription, DNA-templated IEA --
GO:0006915 apoptotic process TAS 8787672
GO:0006919 activation of cysteine-type endopeptidase activity involved in apoptotic process TAS --
genes like me logo Genes that share ontologies with FASLG: view

Drugs & Compounds for FASLG Gene

(88) Drugs for FASLG Gene - From: DGIdb and Novoseek

Name Status Disease Links Group Role Mechanism of Action Clinical Trials
APG101 Pharma 0

(59) Additional Compounds for FASLG Gene - From: Novoseek

Name Synonyms Role CAS Number PubChem IDs PubMed IDs
genes like me logo Genes that share compounds with FASLG: view

Transcripts for FASLG Gene

mRNA/cDNA for FASLG Gene

(2) REFSEQ mRNAs :
(9) Additional mRNA sequences :
(14) Selected AceView cDNA sequences:
(2) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FASLG Gene

Fas ligand (TNF superfamily, member 6):
Representative Sequences:

CRISPR Products

Inhibitory RNA Products

Clone Products

  • Addgene plasmids for FASLG

Alternative Splicing Database (ASD) splice patterns (SP) for FASLG Gene

No ASD Table

Relevant External Links for FASLG Gene

GeneLoc Exon Structure for
FASLG
ECgene alternative splicing isoforms for
FASLG

Expression for FASLG Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FASLG Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

mRNA differential expression in normal tissues according to GTEx for FASLG Gene

This gene is overexpressed in Whole Blood (x17.4) and Spleen (x11.4).

Protein differential expression in normal tissues from HIPED for FASLG Gene

This gene is overexpressed in Monocytes (45.4) and Neutrophil (23.6).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FASLG Gene



Protein tissue co-expression partners for FASLG Gene

- Elite partner

NURSA nuclear receptor signaling pathways regulating expression of FASLG Gene:

FASLG

SOURCE GeneReport for Unigene cluster for FASLG Gene:

Hs.2007

Evidence on tissue expression from TISSUES for FASLG Gene

  • Blood(4.6)
  • Spleen(2.6)
  • Lymph node(2.5)
  • Intestine(2.4)
  • Kidney(2.4)
  • Pancreas(2.4)
  • Liver(2.3)
  • Eye(2.2)
  • Lung(2.2)
  • Bone marrow(2.1)
  • Skin(2.1)
  • Nervous system(2.1)

Phenotype-based relationships between genes and organs from Gene ORGANizer for FASLG Gene

Germ Layers:
  • ectoderm
  • endoderm
  • mesoderm
Systems:
  • cardiovascular
  • digestive
  • immune
  • integumentary
  • lymphatic
  • nervous
  • respiratory
  • skeleton
  • urinary
Organs:
Head and neck:
  • brain
  • head
Thorax:
  • lung
Abdomen:
  • kidney
  • liver
  • spleen
Limb:
  • ankle
  • digit
  • elbow
  • finger
  • foot
  • hand
  • hip
  • knee
  • lower limb
  • shoulder
  • toe
  • upper limb
  • wrist
General:
  • blood
  • blood vessel
  • bone marrow
  • coagulation system
  • lymph node
  • red blood cell
  • skin
  • spinal cord
  • white blood cell
genes like me logo Genes that share expression patterns with FASLG: view

Primer Products

No data available for mRNA Expression by UniProt/SwissProt for FASLG Gene

Orthologs for FASLG Gene

This gene was present in the common ancestor of chordates.

Orthologs for FASLG Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FASLG 34 35
  • 99.64 (n)
dog
(Canis familiaris)
Mammalia FASLG 34 35
  • 87.9 (n)
cow
(Bos Taurus)
Mammalia FASLG 34 35
  • 87.24 (n)
mouse
(Mus musculus)
Mammalia Fasl 34 16 35
  • 82.8 (n)
rat
(Rattus norvegicus)
Mammalia Faslg 34
  • 81.65 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia FASLG 35
  • 68 (a)
OneToOne
chicken
(Gallus gallus)
Aves FASLG 34 35
  • 62.02 (n)
lizard
(Anolis carolinensis)
Reptilia FASLG 35
  • 50 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia faslg 34
  • 53.87 (n)
zebrafish
(Danio rerio)
Actinopterygii faslg 34 35
  • 48.95 (n)
Species where no ortholog for FASLG was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)

Evolution for FASLG Gene

ENSEMBL:
Gene Tree for FASLG (if available)
TreeFam:
Gene Tree for FASLG (if available)

Paralogs for FASLG Gene

Paralogs for FASLG Gene

(1) SIMAP similar genes for FASLG Gene using alignment to 3 proteins:

genes like me logo Genes that share paralogs with FASLG: view

Variants for FASLG Gene

Sequence variations from dbSNP and Humsavar for FASLG Gene

SNP ID Clin Chr 01 pos Sequence Context AA Info Type
VAR_075568 Autoimmune lymphoproliferative syndrome 1B (ALPS1B) [MIM:601859]
rs587776450 Pathogenic 172,659,464(+) GTTTT(-/T)CATGG reference, frameshift-variant
rs80358236 Pathogenic 172,665,642(+) GGTCC(-/ATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAA)ACTGG cds-indel
rs80358238 Pathogenic 172,665,636(+) ACTCA(A/G)GGTCC reference, missense, utr-variant-3-prime
rs138658215 Likely benign 172,666,422(+) TTAAG(G/T)GATGG utr-variant-3-prime

Variation tolerance for FASLG Gene

Residual Variation Intolerance Score: 53.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 0.93; 19.26% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FASLG Gene

Human Gene Mutation Database (HGMD)
FASLG
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FASLG

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for FASLG Gene

Disorders for FASLG Gene

MalaCards: The human disease database

(57) MalaCards diseases for FASLG Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards

Disorder Aliases PubMed IDs
autoimmune lymphoproliferative syndrome
  • autoimmune lymphoproliferative syndrome, type ib
lung cancer
  • lung cancer, protection against
faslg-related autoimmune lymphoproliferative syndrome
silicosis
  • pneumoconiosis due to silicates
lymphoproliferative syndrome
  • lymphoproliferative disorders
- elite association - COSMIC cancer census association via MalaCards
Search FASLG in MalaCards View complete list of genes associated with diseases

UniProtKB/Swiss-Prot

TNFL6_HUMAN
  • Autoimmune lymphoproliferative syndrome 1B (ALPS1B) [MIM:601859]: A disorder of apoptosis that manifests in early childhood and results in the accumulation of autoreactive lymphocytes. It is characterized by non-malignant lymphadenopathy with hepatosplenomegaly, and autoimmune hemolytic anemia, thrombocytopenia and neutropenia. {ECO:0000269 PubMed:26334989, ECO:0000269 PubMed:8787672}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Relevant External Links for FASLG

Genetic Association Database (GAD)
FASLG
Human Genome Epidemiology (HuGE) Navigator
FASLG
Atlas of Genetics and Cytogenetics in Oncology and Haematology:
FASLG
genes like me logo Genes that share disorders with FASLG: view

No data available for Genatlas for FASLG Gene

Publications for FASLG Gene

  1. Evaluation of functional single nucleotide polymorphisms of different genes coding for the immunoregulatory molecules in patients with monoclonal large granular lymphocyte lymphocytosis. (PMID: 18361934) Garrido P. … Ruiz-Cabello F. (Hum. Immunol. 2008) 3 22 46 64
  2. Sorting of Fas ligand to secretory lysosomes is regulated by mono- ubiquitylation and phosphorylation. (PMID: 17164290) Zuccato E. … Griffiths G.M. (J. Cell Sci. 2007) 3 4 22 64
  3. The Fas ligand intracellular domain is released by ADAM10 and SPPL2a cleavage in T-cells. (PMID: 17557115) Kirkin V. … Zornig M. (Cell Death Differ. 2007) 3 4 22 64
  4. Association analysis of chromosome 1 migraine candidate genes. (PMID: 17727731) Fernandez F. … Griffiths L.R. (BMC Med. Genet. 2007) 3 22 46 64
  5. Disparate distribution of 16 candidate single nucleotide polymorphisms among racial and ethnic groups of pediatric heart transplant patients. (PMID: 17198275) Girnita D.M. … Zeevi A. (Transplantation 2006) 3 22 46 64

Products for FASLG Gene

  • Addgene plasmids for FASLG

Sources for FASLG Gene

Content
Loading form....