Aliases for FASLG Gene
Aliases for FASLG Gene
External Ids for FASLG Gene
- HGNC: 11936
- Entrez Gene: 356
- Ensembl: ENSG00000117560
- OMIM: 134638
- UniProtKB: P48023
Previous HGNC Symbols for FASLG Gene
- APT1LG1
- TNFSF6
Previous GeneCards Identifiers for FASLG Gene
- GC01P169360
- GC01P170894
- GC01P143852
Summaries for FASLG Gene
-
This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
GeneCards Summary for FASLG Gene
FASLG (Fas Ligand) is a Protein Coding gene. Diseases associated with FASLG include Autoimmune Lymphoproliferative Syndrome and Lung Cancer. Among its related pathways are Development IGF-1 receptor signaling and Bacterial infections in CF airways. GO annotations related to this gene include receptor binding and tumor necrosis factor receptor binding. An important paralog of this gene is TNFSF14.
UniProtKB/Swiss-Prot for FASLG Gene
-
Cytokine that binds to TNFRSF6/FAS, a receptor that transduces the apoptotic signal into cells. May be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both. Binding to the decoy receptor TNFRSF6B/DcR3 modulates its effects.
-
The FasL intracellular domain (FasL ICD) cytoplasmic form induces gene transcription inhibition.
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FASLG Gene
Genomics for FASLG Gene
Regulatory Elements for FASLG Gene
Enhancers for FASLG Gene
| GeneHancer Identifier | Enhancer Score | Enhancer Sources | Gene-Enhancer Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites within enhancer | Gene Targets for Enhancer |
|---|---|---|---|---|---|---|---|---|
| GH01G172662 | 1.8 | FANTOM5 Ensembl ENCODE dbSUPER | 23.2 | +4.4 | 4362 | 2.2 | PKNOX1 CBX3 NFIB FEZF1 ZBTB40 TCF12 SCRT2 RELB FOS ETV6 | FASLG SUCO SLC25A38P1 |
| GH01G172892 | 1.7 | FANTOM5 Ensembl ENCODE dbSUPER | 14.9 | +237.3 | 237262 | 7.3 | PKNOX1 FEZF1 RAD21 BRCA1 GATA2 EGR1 SCRT2 RCOR1 FOS CEBPB | FASLG TNFSF4 ENSG00000224228 SUCO AIMP1P2 ENSG00000224000 |
| GH01G172703 | 0.9 | FANTOM5 ENCODE dbSUPER | 25.6 | +45.2 | 45184 | 1.2 | FOSL1 IKZF1 | FASLG SUCO SLC25A38P1 |
| GH01G172717 | 1.3 | Ensembl ENCODE | 11 | +59.7 | 59723 | 2.8 | PKNOX1 FOXA2 ATF1 MLX TCF12 ZNF766 ZNF143 ZHX2 REST ZNF592 | ENSG00000224228 RNU6-693P FASLG SUCO PIGC C1orf105 SLC25A38P1 |
| GH01G172696 | 1.6 | FANTOM5 Ensembl ENCODE dbSUPER | 8.6 | +40.0 | 40041 | 5.4 | CTCF TSC22D4 ZNF175 CEBPG FOSL1 GATA2 ETV6 FOS RNF2 L3MBTL2 | FASLG SUCO SLC25A38P1 |
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around FASLG on UCSC Golden Path with GeneCards custom track
- Transcription factor binding sites by QIAGEN in the FASLG gene promoter:
Regulatory Element Products
Genomic Location for FASLG Gene
- Chromosome:
- 1
- Start:
- 172,659,008 bp from pter
- End:
- 172,666,874 bp from pter
- Size:
- 7,867 bases
- Orientation:
- Plus strand
Genomic View for FASLG Gene
Genes around FASLG on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 1q24.3 by Ensembl
- 1q24.3 by Entrez Gene
- 1q24.3 by HGNC
FASLG Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for FASLG Gene
Proteins for FASLG Gene
-
Protein details for FASLG Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- P48023-TNFL6_HUMAN
- Recommended name:
- Tumor necrosis factor ligand superfamily member 6
- Protein Accession:
- P48023
- Q9BZP9
Protein attributes for FASLG Gene
- Size:
- 281 amino acids
- Molecular mass:
- 31485 Da
- Quaternary structure:
-
- Homotrimer (Probable). Interacts with ARHGAP9, BAIAP2L1, BTK, CACNB3, CACNB4, CRK, DLG2, DNMBP, DOCK4, EPS8L3, FGR, FYB, FYN, HCK, ITK, ITSN2, KALRN, LYN, MACC1, MIA, MPP4, MYO15A, NCF1, NCK1, NCK2, NCKIPSD, OSTF1, PIK3R1, PSTPIP1, RIMBP3C, SAMSN1, SH3GL3, SH3PXD2B, SH3PXD2A, SH3RF2, SKAP2, SNX33, SNX9, SORBS3, SPTA1, SRC, SRGAP1, SRGAP2, SRGAP3, TEC, TJP3 and YES1.
Three dimensional structures from OCA and Proteopedia for FASLG Gene
Protein Expression for FASLG Gene
Post-translational modifications for FASLG Gene
- Monoubiquitinated.
- N-glycosylated.
- Phosphorylated by FGR on tyrosine residues; this is required for ubiquitination and subsequent internalization.
- The soluble form derives from the membrane form by proteolytic processing. The membrane-bound form undergoes two successive intramembrane proteolytic cleavages. The first one is processed by ADAM10 producing an N-terminal fragment, which lacks the receptor-binding extracellular domain. This ADAM10-processed FasL (FasL APL) remnant form is still membrane anchored and further processed by SPPL2A that liberates the FasL intracellular domain (FasL ICD). FasL shedding by ADAM10 is a prerequisite for subsequent intramembrane cleavage by SPPL2A in T-cells.
- Glycosylation at Asn184, isoforms=250, and isoforms=260
- Modification sites at PhosphoSitePlus
Other Protein References for FASLG Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- EMD Millipore Complete listing of Mono and Polychlonal Antibodies for FASLG
- R&D Systems Antibodies for FASLG (Fas Ligand/TNFSF6)
- Cell Signaling Technology (CST) Antibodies for FASLG (FasL)
-
Custom Antibody ServicesOriGene Antibodies for FASLG
- TA590045
- TA590044
- TA353813
- TA352388
- TA350662
- TA347978
- TA347378
- TA330343
- TA328307
- TA320328
- TA313465
- SM2269PT
- SM2269PS
- SM2269P
- SM2268PS
- SM2268P
- SM2268LE
- DM1212
- AP23382PU-N
- AP23148PU-N
- AP22694PU-N
- AP22688PU-N
- AP15548PU-S
- AP15548PU-N
- AP15548PU-M
- AP08162PU-N
- AP06117PU-N
- AM31198PU-N
- AM31198BT-N
- AM31198AF-N
- AM26762RP-N
- AM26762PU-N
- AM26762LE-N
- AM00705PU-N
- AM00182PU-N
- Novus Biologicals Antibodies for FASLG
-
Cloud-Clone Corp. Antibodies for FASLG
- Invitrogen Antibodies for FASLG
- antibodies-online Antibodies for FASLG: See all 442
- GeneTex FASLG antibody for FASLG
-
Santa Cruz Biotechnology (SCBT) Antibodies for FASLG
Protein Products
- R&D Systems Proteins and Enzymes for FASLG (Fas Ligand/TNFSF6)
- Enzo Life Sciences proteins for FASLG
-
OriGene Purified Proteins for FASLG
- Search Origene for MassSpec and Protein Over-expression Lysates for FASLG
- Origene Custom Protein Services for FASLG
- Sino Biological Recombinant Proteins for FASLG
- Browse Sino Biological Cell Lysates
- ProSpec Recombinant Proteins for FASLG
-
Cloud-Clone Corp. Proteins for FASLG
- antibodies-online Proteins for FASLG: See all 52
- Search antibodies-online for peptides
- GeneTex Proteins for FASLG
Assay Products
- R&D Systems Proteome Profiler Antibody Arrays, Luminex Assays, ELISpot and FluoroSpot Kits, ELISAs, and other biochemical assays for FASLG (Fas Ligand/TNFSF6)
- Enzo Life Sciences assays for FASLG
-
Cloud-Clone Corp Assay Kits for FASLG
- eBioscience Human sFas Ligand Platinum ELISA 96 tests and Human sFas Ligand Platinum ELISA 96 tests for FASLG
- antibodies-online Kits for FASLG: See all 113
-
Abcam assays for FASLG
No data available for DME Specific Peptides for FASLG Gene
Domains & Families for FASLG Gene
Gene Families for FASLG Gene
Protein Domains for FASLG Gene
- InterPro:
- Blocks:
- ProtoNet:
Suggested Antigen Peptide Sequences for FASLG Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
P48023- Family:
-
- Belongs to the tumor necrosis factor family.
Function for FASLG Gene
Molecular function for FASLG Gene
- UniProtKB/Swiss-Prot Function:
- Cytokine that binds to TNFRSF6/FAS, a receptor that transduces the apoptotic signal into cells. May be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both. Binding to the decoy receptor TNFRSF6B/DcR3 modulates its effects.
- UniProtKB/Swiss-Prot Function:
- The FasL intracellular domain (FasL ICD) cytoplasmic form induces gene transcription inhibition.
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005102 | receptor binding | TAS | 7826947 |
| GO:0005123 | death receptor binding | IEA | -- |
| GO:0005125 | cytokine activity | IEA | -- |
| GO:0005164 | tumor necrosis factor receptor binding | IEA | -- |
| GO:0005515 | protein binding | IPI | 12198154 |
Phenotypes for FASLG Gene
- MGI mutant phenotypes for FASLG:
-
inferred from 11 alleles
- mortality/aging
- cellular phenotype
- normal phenotype
- immune system phenotype
- nervous system phenotype
- homeostasis/metabolism phenotype
- cardiovascular system phenotype
- respiratory system phenotype
- digestive/alimentary phenotype
- neoplasm
- reproductive system phenotype
- endocrine/exocrine gland phenotype
- vision/eye phenotype
- integument phenotype
- skeleton phenotype
- hematopoietic system phenotype
- renal/urinary system phenotype
- liver/biliary system phenotype
- GenomeRNAi human phenotypes for FASLG:
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
-
ViGene Biosciences lentiviral particle packaged cDNA for FASLG gene
-
ViGene Biosciences ready-to-package AAV shRNAs for FASLG gene
- Search ViGene Biosciences for FASLG
CRISPR Products
-
OriGene CRISPR knockouts for FASLG
-
Santa Cruz Biotechnology (SCBT) CRISPR for FASLG
- GenScript: Design CRISPR guide RNA sequences for FASLG
miRNA for FASLG Gene
- miRTarBase miRNAs that target FASLG
-
- hsa-mir-21-5p (MIRT006989)
- hsa-mir-26b-5p (MIRT029780)
- hsa-mir-3941 (MIRT611039)
- hsa-mir-5195-5p (MIRT611040)
- hsa-mir-603 (MIRT611041)
- hsa-mir-362-3p (MIRT611042)
- hsa-mir-329-3p (MIRT611043)
- hsa-mir-8485 (MIRT611044)
- hsa-mir-7849-3p (MIRT611045)
- hsa-mir-4325 (MIRT629081)
- hsa-mir-7703 (MIRT629082)
- hsa-mir-32-5p (MIRT629083)
- hsa-mir-363-3p (MIRT629084)
- hsa-mir-25-3p (MIRT629085)
- hsa-mir-92b-3p (MIRT629086)
- hsa-mir-367-3p (MIRT629087)
- hsa-mir-92a-3p (MIRT629088)
- hsa-mir-539-3p (MIRT658285)
- hsa-mir-485-3p (MIRT658286)
miRNA Products
- Search ViGene Biosciences for FASLG
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for FASLG
- Browse OriGene Inhibitory RNA Products For FASLG
-
ViGene Biosciences ready-to-package AAV shRNAs for FASLG gene
Clone Products
- Sino Biological Human cDNA Clone for FASLG
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Addgene plasmids for FASLG
Cell Line Products
-
Horizon Cell Lines for FASLG
-
ViGene Biosciences adenoviral particle packaged cDNA for FASLG gene
-
ViGene Biosciences lentiviral particle packaged cDNA for FASLG gene
-
ViGene Biosciences ready-to-package AAV shRNAs for FASLG gene
Flow Cytometry Products
No data available for Enzyme Numbers (IUBMB) , Transcription Factor Targets and HOMER Transcription for FASLG Gene
Localization for FASLG Gene
Subcellular locations from UniProtKB/Swiss-Prot for FASLG Gene
- Cell membrane; Single-pass type II membrane protein. Cytoplasmic vesicle lumen. Lysosome lumen. Note=Is internalized into multivesicular bodies of secretory lysosomes after phosphorylation by FGR and monoubiquitination. Colocalizes with the SPPL2A protease at the cell membrane.
- Tumor necrosis factor ligand superfamily member 6, soluble form: Secreted. Note=May be released into the extracellular fluid, probably by cleavage form the cell surface. {ECO:0000250}.
- FasL intracellular domain: Nucleus. Note=The FasL ICD cytoplasmic form is translocated into the nucleus.
| Compartment | Confidence |
|---|---|
| plasma membrane | 5 |
| extracellular | 5 |
| nucleus | 5 |
| lysosome | 5 |
| cytosol | 4 |
| mitochondrion | 3 |
| cytoskeleton | 1 |
| endoplasmic reticulum | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005576 | extracellular region | TAS | -- |
| GO:0005615 | extracellular space | IDA | 18835034 |
| GO:0005634 | nucleus | IDA,IEA | 17557115 |
| GO:0005764 | lysosome | IEA | -- |
| GO:0005886 | plasma membrane | IDA | 12201652 |
Pathways & Interactions for FASLG Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | PEDF Induced Signaling |
.61
.47
|
|
| 2 | Dimerization of procaspase-8 | ||
| 3 | Allograft rejection | ||
| 4 | Apoptosis Modulation and Signaling |
.41
|
.33
|
| 5 | TNFR1 Pathway |
.35
|
|
Pathways by source for FASLG Gene
2 Sino Biological pathways for FASLG Gene
1 GeneTex pathway for FASLG Gene
2 Cell Signaling Technology pathways for FASLG Gene
18 BioSystems pathways for FASLG Gene
22 Reactome pathways for FASLG Gene
22 KEGG pathways for FASLG Gene
10 GeneGo (Thomson Reuters) pathways for FASLG Gene
4 R&D Systems pathways for FASLG Gene
- Apoptosis Signaling Pathways
- IL-15 Signaling Pathways and their Primary Biological Effects in Different Immune Cell Types
- IL-2 Signaling Pathways and their Primary Biological Effects in Different Immune Cell Types
- TNF Superfamily Pathway: Human Ligand-Receptor Interactions and their Associated Functions
31 Qiagen pathways for FASLG Gene
Interacting Proteins for FASLG Gene
Selected Interacting proteins:
P48023-TNFL6_HUMAN
ENSP00000356694
for FASLG Gene via
IID
UniProtKB
STRING
MINT
SIGNOR curated interactions for FASLG Gene
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0000122 | negative regulation of transcription from RNA polymerase II promoter | IDA | 17557115 |
| GO:0006351 | transcription, DNA-templated | IEA | -- |
| GO:0006355 | regulation of transcription, DNA-templated | IEA | -- |
| GO:0006915 | apoptotic process | TAS | 8787672 |
| GO:0006919 | activation of cysteine-type endopeptidase activity involved in apoptotic process | TAS | -- |
Drugs & Compounds for FASLG Gene
| Name | Status | Disease Links | Group | Role | Mechanism of Action | Clinical Trials |
|---|---|---|---|---|---|---|
| APG101 | Pharma | 0 |
| Name | Synonyms | Role | CAS Number | PubChem IDs | PubMed IDs |
|---|
Transcripts for FASLG Gene
mRNA/cDNA for FASLG Gene
- (2) REFSEQ mRNAs :
- (9) Additional mRNA sequences :
- (14) Selected AceView cDNA sequences:
- (2) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for FASLG Gene
CRISPR Products
-
OriGene CRISPR knockouts for FASLG
-
Santa Cruz Biotechnology (SCBT) CRISPR for FASLG
- GenScript: Design CRISPR guide RNA sequences for FASLG
miRNA Products
- Search ViGene Biosciences for FASLG
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for FASLG
- Browse OriGene Inhibitory RNA Products For FASLG
-
ViGene Biosciences ready-to-package AAV shRNAs for FASLG gene
Clone Products
- Sino Biological Human cDNA Clone for FASLG
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
- Addgene plasmids for FASLG
Flow Cytometry Products
Expression for FASLG Gene
mRNA expression in embryonic tissues and stem cells from LifeMap Discovery
-
Blood (Hematopoietic System)
- Natural Killer Cells Peripheral Blood
- Natural killer-like cells(Woll PS et. al. 2009)
- nk cells
-
Placenta (Extraembryonic Tissues)
- Extravillous Cytotrophoblast Cells Extravillous Cytotrophoblast Layer
mRNA differential expression in normal tissues according to GTEx for FASLG Gene
This gene is overexpressed in Whole Blood (x17.4) and Spleen (x11.4).
This gene is overexpressed in Monocytes (45.4) and Neutrophil (23.6).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FASLG Gene
- Elite partner
NURSA nuclear receptor signaling pathways regulating expression of FASLG Gene:
FASLGSOURCE GeneReport for Unigene cluster for FASLG Gene:
Hs.2007Evidence on tissue expression from TISSUES for FASLG Gene
- Blood(4.6)
- Spleen(2.6)
- Lymph node(2.5)
- Intestine(2.4)
- Kidney(2.4)
- Pancreas(2.4)
- Liver(2.3)
- Eye(2.2)
- Lung(2.2)
- Bone marrow(2.1)
- Skin(2.1)
- Nervous system(2.1)
Phenotype-based relationships between genes and organs from Gene ORGANizer for FASLG Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- digestive
- immune
- integumentary
- lymphatic
- nervous
- respiratory
- skeleton
- urinary
Organs:
Head and neck:
- brain
- head
Thorax:
- lung
Abdomen:
- kidney
- liver
- spleen
Limb:
- ankle
- digit
- elbow
- finger
- foot
- hand
- hip
- knee
- lower limb
- shoulder
- toe
- upper limb
- wrist
General:
- blood
- blood vessel
- bone marrow
- coagulation system
- lymph node
- red blood cell
- skin
- spinal cord
- white blood cell
Primer Products
-
OriGene qPCR primer pairs for FASLG
-
OriGene qPCR primer pairs and template standards for FASLG
No data available for mRNA Expression by UniProt/SwissProt for FASLG Gene
Orthologs for FASLG Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | FASLG 34 35 |
|
||
| dog (Canis familiaris) |
Mammalia | FASLG 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | FASLG 34 35 |
|
||
| mouse (Mus musculus) |
Mammalia | Fasl 34 16 35 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Faslg 34 |
|
||
| platypus (Ornithorhynchus anatinus) |
Mammalia | FASLG 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | FASLG 34 35 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | FASLG 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | faslg 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | faslg 34 35 |
|
- Species where no ortholog for FASLG was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- oppossum (Monodelphis domestica)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for FASLG Gene
(1) SIMAP similar genes for FASLG Gene using alignment to 3 proteins:
Variants for FASLG Gene
| SNP ID | Clin | Chr 01 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| VAR_075568 | Autoimmune lymphoproliferative syndrome 1B (ALPS1B) [MIM:601859] | ||||
| rs587776450 | Pathogenic | 172,659,464(+) | GTTTT(-/T)CATGG | reference, frameshift-variant | |
| rs80358236 | Pathogenic | 172,665,642(+) | GGTCC(-/ATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAA)ACTGG | cds-indel | |
| rs80358238 | Pathogenic | 172,665,636(+) | ACTCA(A/G)GGTCC | reference, missense, utr-variant-3-prime | |
| rs138658215 | Likely benign | 172,666,422(+) | TTAAG(G/T)GATGG | utr-variant-3-prime |
Residual Variation Intolerance Score:
53.9% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
0.93;
19.26% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for FASLG Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for FASLG Gene
Disorders for FASLG Gene
(57) MalaCards diseases for FASLG Gene - From: OMIM, ClinVar, GeneTests, Orphanet, Swiss-Prot, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| autoimmune lymphoproliferative syndrome |
|
|
| lung cancer |
|
|
| faslg-related autoimmune lymphoproliferative syndrome |
|
|
| silicosis |
|
|
| lymphoproliferative syndrome |
|
Search FASLG in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
TNFL6_HUMAN- Autoimmune lymphoproliferative syndrome 1B (ALPS1B) [MIM:601859]: A disorder of apoptosis that manifests in early childhood and results in the accumulation of autoreactive lymphocytes. It is characterized by non-malignant lymphadenopathy with hepatosplenomegaly, and autoimmune hemolytic anemia, thrombocytopenia and neutropenia. {ECO:0000269 PubMed:26334989, ECO:0000269 PubMed:8787672}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Relevant External Links for FASLG
No data available for Genatlas for FASLG Gene
Publications for FASLG Gene
- Evaluation of functional single nucleotide polymorphisms of different genes coding for the immunoregulatory molecules in patients with monoclonal large granular lymphocyte lymphocytosis. (PMID: 18361934) Garrido P. … Ruiz-Cabello F. (Hum. Immunol. 2008) 3 22 46 64
- Sorting of Fas ligand to secretory lysosomes is regulated by mono- ubiquitylation and phosphorylation. (PMID: 17164290) Zuccato E. … Griffiths G.M. (J. Cell Sci. 2007) 3 4 22 64
- The Fas ligand intracellular domain is released by ADAM10 and SPPL2a cleavage in T-cells. (PMID: 17557115) Kirkin V. … Zornig M. (Cell Death Differ. 2007) 3 4 22 64
- Association analysis of chromosome 1 migraine candidate genes. (PMID: 17727731) Fernandez F. … Griffiths L.R. (BMC Med. Genet. 2007) 3 22 46 64
- Disparate distribution of 16 candidate single nucleotide polymorphisms among racial and ethnic groups of pediatric heart transplant patients. (PMID: 17198275) Girnita D.M. … Zeevi A. (Transplantation 2006) 3 22 46 64
Products for FASLG Gene
- R&D Systems Antibodies for FASLG (Fas Ligand/TNFSF6)
- R&D Systems Proteins and Enzymes for FASLG (Fas Ligand/TNFSF6)
- R&D Systems ELISAs, ELISpot and FluoroSpot Kits, Luminex Assays, Proteome Profiler Antibody Arrays, and other biochemical assays for FASLG (Fas Ligand/TNFSF6)
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for FASLG
- AM00182PU-N
- AM00705PU-N
- AM26762LE-N
- AM26762PU-N
- AM26762RP-N
- AM31198AF-N
- AM31198BT-N
- AM31198PU-N
- AP06117PU-N
- AP08162PU-N
- AP15548PU-M
- AP15548PU-N
- AP15548PU-S
- AP22688PU-N
- AP22694PU-N
- AP23148PU-N
- AP23382PU-N
- DM1212
- SM2268LE
- SM2268P
- SM2268PS
- SM2269P
- SM2269PS
- SM2269PT
- TA313465
- TA320328
- TA328307
- TA330343
- TA347378
- TA347978
- TA350662
- TA352388
- TA353813
- TA590044
- TA590045
- Custom Assay ServicesOriGene ELISA Kits for FASLG
- OriGene Purified Proteins for FASLG
- Search Origene for MassSpec and Protein Over-expression Lysates for FASLG
- Origene Custom Protein Services for FASLG
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for FASLG
- Browse OriGene Inhibitory RNA Products For FASLG
- OriGene qPCR primer pairs and template standards for FASLG
- OriGene qPCR primer pairs for FASLG
- OriGene CRISPR knockouts for FASLG
- OriGene ORF clones in human for FASLG
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For FASLG
- GenScript: Next-day shipping cDNA ORF clone for FASLG in any vector
- GenScript Custom Purified and Recombinant Proteins Services for FASLG
- GenScript Custom Assay Services for FASLG
- GenScript Custom overexpressing Cell Line Services for FASLG
- GenScript: Design CRISPR guide RNA sequences for FASLG
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for FASLG
- Cell Signaling Technology (CST) Antibodies for FASLG (FasL)
- Search for Antibodies & Assays
- Sino Biological Human cDNA Clone for FASLG
- Sino Biological Recombinant Proteins for FASLG
- Browse Sino Biological Cell Lysates
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Enzo Life Sciences proteins for FASLG
- Enzo Life Sciences assays for FASLG
- Browse drugs & compounds from Enzo Life Sciences
- Search Enzo Life Sciences for proteins, assays, substrates, inhibitors & antibodies
- Novus Biologicals Antibodies for FASLG
- Novus Biologicals proteins and lysates for FASLG
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- ProSpec Recombinant Proteins for FASLG
- Cloud-Clone Corp. Antibodies for FASLG
- Cloud-Clone Corp. Proteins for FASLG
- Cloud-Clone Corp Assay Kits for FASLG
- Addgene plasmids for FASLG
- antibodies-online Antibodies for FASLG: See all 442
- antibodies-online Kits for FASLG: See all 113
- antibodies-online Proteins for FASLG: See all 52
- Search antibodies-online for peptides
- GeneTex FASLG antibody for FASLG
- GeneTex Proteins for FASLG
- ViGene Biosciences adenoviral particle packaged cDNA for FASLG gene
- ViGene Biosciences lentiviral particle packaged cDNA for FASLG gene
- ViGene Biosciences ready-to-package AAV shRNAs for FASLG gene
- Search ViGene Biosciences for FASLG
- Santa Cruz Biotechnology (SCBT) Antibodies for FASLG
- Search Santa Cruz Biotechnology (SCBT) for FASLG siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for FASLG
- Horizon Cell Lines for FASLG
- Cyagen custom Knockout/knockin (KOKI) mouse models for FASLG
- VectorBuilder custom plasmid, inducible vectors for FASLG
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for FASLG
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for FASLG Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer