Aliases for FANCF Gene
Aliases for FANCF Gene
External Ids for FANCF Gene
- HGNC: 3587
- Entrez Gene: 2188
- Ensembl: ENSG00000183161
- OMIM: 613897
- UniProtKB: Q9NPI8
Previous GeneCards Identifiers for FANCF Gene
- GC11M024061
- GC11M023445
- GC11M022683
- GC11M022608
- GC11M022327
Summaries for FANCF Gene
-
The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group F. [provided by RefSeq, Jul 2008]
GeneCards Summary for FANCF Gene
FANCF (Fanconi Anemia Complementation Group F) is a Protein Coding gene. Diseases associated with FANCF include Fanconi Anemia, Complementation Group F and Fanconi Anemia, Complementation Group A. Among its related pathways are Fanconi anemia pathway and Chks in Checkpoint Regulation. GO annotations related to this gene include ubiquitin-protein transferase activity.
UniProtKB/Swiss-Prot for FANCF Gene
-
DNA repair protein that may operate in a postreplication repair or a cell cycle checkpoint function. May be implicated in interstrand DNA cross-link repair and in the maintenance of normal chromosome stability (By similarity).
No data available for CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FANCF Gene
Genomics for FANCF Gene
Regulatory Elements for FANCF Gene
Enhancers for FANCF Gene
| GeneHancer Identifier | Enhancer Score | Enhancer Sources | Gene-Enhancer Score | TSS distance (kb) | Number of Genes Away | Size (kb) | Transcription Factor Binding Sites within enhancer | Gene Targets for Enhancer |
|---|---|---|---|---|---|---|---|---|
| GH11G022624 | 1.1 | ENCODE | 9.7 | +1.3 | 1330 | 2.7 | HDGF PKNOX1 CREB3L1 WRNIP1 ARID4B SIN3A DMAP1 ZNF2 YY1 ZNF143 | FANCF GAS2 GC11M022507 |
| GH11G022634 | 1.2 | ENCODE dbSUPER | 8.8 | -8.5 | -8531 | 1.8 | FOXA2 ARID4B DMAP1 SP5 TBX21 KAT8 GLIS1 RCOR2 NBN KDM1A | FANCF RNA5SP338 |
| GH11G022645 | 0.7 | dbSUPER | 7.9 | -19.7 | -19717 | 1.2 | HDGF KLF11 ZBED1 NR2F1 GATAD2B RAD51 IKZF1 NBN MLLT1 RELB | FANCF GAS2 RNA5SP338 |
| GH11G022701 | 1.5 | FANTOM5 Ensembl ENCODE | 1.8 | -76.1 | -76099 | 2.8 | ELF3 FOXA2 INSM2 RAD21 RARA GATA2 ZNF366 ZSCAN5C FOS RELB | GAS2 FANCF SLC17A6 RNA5SP338 GC11P022726 |
| GH11G022340 | 0.8 | FANTOM5 dbSUPER | 1.7 | +286.1 | 286070 | 0.2 | POLR2A CHD1 CBX2 EZH2 | SLC17A6 FANCF ENSG00000254768 ENSG00000254540 |
- Elite enhancer and/or Elite enhancer-gene association
Download GeneHancer data dump
Enhancers around FANCF on UCSC Golden Path with GeneCards custom track
Regulatory Element Products
Genomic Location for FANCF Gene
- Chromosome:
- 11
- Start:
- 22,622,519 bp from pter
- End:
- 22,626,787 bp from pter
- Size:
- 4,269 bases
- Orientation:
- Minus strand
Genomic View for FANCF Gene
Genes around FANCF on UCSC Golden Path with GeneCards custom track
- Cytogenetic band:
-
- 11p14.3 by Ensembl
- 11p14.3 by Entrez Gene
- 11p14.3 by HGNC
FANCF Gene in genomic location: bands according to
Ensembl, locations according to GeneLoc
(and/or Entrez Gene and/or Ensembl if different)
Genomic Neighborhood
• Exon Structure
• Gene Density
RefSeq DNA sequence for FANCF Gene
Proteins for FANCF Gene
-
Protein details for FANCF Gene (UniProtKB/Swiss-Prot)
- Protein Symbol:
- Q9NPI8-FANCF_HUMAN
- Recommended name:
- Fanconi anemia group F protein
- Protein Accession:
- Q9NPI8
- Q52LM0
Protein attributes for FANCF Gene
- Size:
- 374 amino acids
- Molecular mass:
- 42254 Da
- Quaternary structure:
-
- Belongs to the multisubunit FA complex composed of FANCA, FANCB, FANCC, FANCE, FANCF, FANCG, FANCL/PHF9 and FANCM. The complex is not found in FA patients. In complex with FANCA, FANCG and FANCL, but not with FANCC, nor FANCE, interacts with HES1; this interaction may be essential for the stability and nuclear localization of FA core complex proteins.
Protein Expression for FANCF Gene
Post-translational modifications for FANCF Gene
Other Protein References for FANCF Gene
- ENSEMBL proteins:
- REFSEQ proteins:
Antibody Products
- EMD Millipore Complete listing of Mono and Polychlonal Antibodies for FANCF
-
Custom Antibody ServicesOriGene Antibodies for FANCF
- Novus Biologicals Antibodies for FANCF
- Invitrogen Antibodies for FANCF
- antibodies-online Antibodies for FANCF: See all 48
- Search GeneTex for Antibodies for FANCF
-
Santa Cruz Biotechnology (SCBT) Antibodies for FANCF
Protein Products
-
OriGene Purified Proteins for FANCF
- Search Origene for MassSpec and Protein Over-expression Lysates for FANCF
- Origene Custom Protein Services for FANCF
- Search GeneTex for Proteins for FANCF
Assay Products
No data available for DME Specific Peptides for FANCF Gene
Domains & Families for FANCF Gene
Gene Families for FANCF Gene
Suggested Antigen Peptide Sequences for FANCF Gene
- GenScript: Design optimal peptide antigens:
Graphical View of Domain Structure for InterPro Entry
No data available for UniProtKB/Swiss-Prot for FANCF Gene
Function for FANCF Gene
Molecular function for FANCF Gene
- GENATLAS Biochemistry:
- putative RNA binding protein,highly homolog to the prokaryotic RNA-binding protein ROM,intronless
- UniProtKB/Swiss-Prot Function:
- DNA repair protein that may operate in a postreplication repair or a cell cycle checkpoint function. May be implicated in interstrand DNA cross-link repair and in the maintenance of normal chromosome stability (By similarity).
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0003674 | molecular_function | ND | -- |
| GO:0005515 | protein binding | IPI | 11063725 |
| GO:0061630 | ubiquitin protein ligase activity | IEA | -- |
Phenotypes for FANCF Gene
- GenomeRNAi human phenotypes for FANCF:
-
- Mitotic spindle defects
- Increased vaccinia virus (VACV) infection
- Dynamic nuclei (hole, folded or small irregular)
- Increased G1 DNA content
- G0/1 arrest
- Increased viability with MLN4924 (a NAE inhibitor)
- Decreased viability after sindbis virus (SIN) dsTE12Q infection
- Decreased mitophagy mCherry-Parkin protein expression after carbonyl cyanide m-chlorphenylhydrazone (CCCP) stimulation
- Decreased Sindbis virus (SIN) capsid and autophagosome LC3 protein colocalization
- Synthetic lethal with paclitaxel
Animal Model Products
- Taconic Biosciences: Generate A Custom CRISPR Mouse Model For Your Study
-
ViGene Biosciences lentiviral particle packaged cDNA for FANCF gene
-
ViGene Biosciences ready-to-package AAV shRNAs for FANCF gene
- Search ViGene Biosciences for FANCF
CRISPR Products
-
OriGene CRISPR knockouts for FANCF
-
Santa Cruz Biotechnology (SCBT) CRISPR for FANCF
- GenScript: Design CRISPR guide RNA sequences for FANCF
miRNA for FANCF Gene
- miRTarBase miRNAs that target FANCF
-
- hsa-mir-335-3p (MIRT567589)
- hsa-mir-2054 (MIRT567590)
- hsa-mir-7855-5p (MIRT567591)
- hsa-mir-664b-3p (MIRT567592)
- hsa-mir-579-3p (MIRT567593)
- hsa-mir-5696 (MIRT567594)
- hsa-mir-4710 (MIRT567595)
- hsa-mir-4792 (MIRT567596)
- hsa-mir-7153-5p (MIRT567597)
- hsa-mir-146b-5p (MIRT567598)
- hsa-mir-146a-5p (MIRT567599)
- hsa-mir-589-5p (MIRT567600)
- hsa-mir-605-3p (MIRT567601)
- hsa-mir-153-5p (MIRT567602)
- hsa-mir-1250-3p (MIRT567603)
- hsa-mir-5002-5p (MIRT567604)
- hsa-mir-590-3p (MIRT567605)
- hsa-mir-3910 (MIRT567606)
- hsa-mir-30c-5p (MIRT567607)
- hsa-mir-30a-5p (MIRT567608)
- hsa-mir-30b-5p (MIRT567609)
- hsa-mir-30d-5p (MIRT567610)
- hsa-mir-30e-5p (MIRT567611)
- hsa-mir-3187-3p (MIRT672158)
- hsa-mir-4435 (MIRT672159)
- hsa-mir-588 (MIRT672160)
- hsa-mir-4701-5p (MIRT672161)
- hsa-mir-7977 (MIRT672162)
- hsa-mir-548s (MIRT672163)
- hsa-mir-19b-2-5p (MIRT672164)
- hsa-mir-19b-1-5p (MIRT672165)
- hsa-mir-19a-5p (MIRT672166)
- hsa-mir-2052 (MIRT672167)
- hsa-mir-24-3p (MIRT672168)
- hsa-mir-4755-3p (MIRT672169)
- hsa-mir-4284 (MIRT672170)
miRNA Products
- Search ViGene Biosciences for FANCF
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for FANCF
- Browse OriGene Inhibitory RNA Products For FANCF
-
ViGene Biosciences ready-to-package AAV shRNAs for FANCF gene
Clone Products
-
OriGene ORF clones in human for FANCF
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for FANCF
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
Cell Line Products
-
Horizon Cell Lines for FANCF
-
ViGene Biosciences adenoviral particle packaged cDNA for FANCF gene
-
ViGene Biosciences lentiviral particle packaged cDNA for FANCF gene
-
ViGene Biosciences ready-to-package AAV shRNAs for FANCF gene
Flow Cytometry Products
No data available for Enzyme Numbers (IUBMB) , Animal Models , Transcription Factor Targets and HOMER Transcription for FANCF Gene
Localization for FANCF Gene
Subcellular locations from UniProtKB/Swiss-Prot for FANCF Gene
- Nucleus.
| Compartment | Confidence |
|---|---|
| nucleus | 5 |
| plasma membrane | 1 |
| extracellular | 1 |
| peroxisome | 1 |
| cytosol | 1 |
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0005634 | nucleus | IEA | -- |
| GO:0005654 | nucleoplasm | TAS | -- |
| GO:0043240 | Fanconi anaemia nuclear complex | IDA | 20347428 |
Pathways & Interactions for FANCF Gene
| SuperPathway | Contained pathways | ||
|---|---|---|---|
| 1 | Fanconi anemia pathway | ||
| 2 | BRCA1 Pathway | ||
| 3 | Chks in Checkpoint Regulation | ||
| 4 | DNA Double-Strand Break Repair |
.53
|
|
| 5 | BARD1 signaling events | ||
Pathways by source for FANCF Gene
1 BioSystems pathway for FANCF Gene
2 Reactome pathways for FANCF Gene
1 KEGG pathway for FANCF Gene
3 Qiagen pathways for FANCF Gene
Interacting Proteins for FANCF Gene
Selected Interacting proteins:
Q9NPI8-FANCF_HUMAN
ENSP00000330875
for FANCF Gene via
MINT
STRING
IID
UniProtKB
| GO ID | Qualified GO term | Evidence | PubMed IDs |
|---|---|---|---|
| GO:0001541 | ovarian follicle development | IEA | -- |
| GO:0006281 | DNA repair | IEA | -- |
| GO:0006974 | cellular response to DNA damage stimulus | IEA | -- |
| GO:0007283 | spermatogenesis | IEA | -- |
| GO:0008150 | biological_process | ND | -- |
Transcripts for FANCF Gene
mRNA/cDNA for FANCF Gene
- (1) REFSEQ mRNAs :
- (12) Additional mRNA sequences :
- (1) Ensembl transcripts including schematic representations, and UCSC links where relevant :
Unigene Clusters for FANCF Gene
CRISPR Products
-
OriGene CRISPR knockouts for FANCF
-
Santa Cruz Biotechnology (SCBT) CRISPR for FANCF
- GenScript: Design CRISPR guide RNA sequences for FANCF
miRNA Products
- Search ViGene Biosciences for FANCF
Inhibitory RNA Products
- Origene RNAi, siRNA, and shRNA products in human, mouse, rat for FANCF
- Browse OriGene Inhibitory RNA Products For FANCF
-
ViGene Biosciences ready-to-package AAV shRNAs for FANCF gene
Clone Products
-
OriGene ORF clones in human for FANCF
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Sino Biological Human cDNA Clone for FANCF
- Vector BioLabs ready-to-use adenovirus/AAV for human, mouse, rat
Flow Cytometry Products
Expression for FANCF Gene
This gene is overexpressed in Bone (35.6), Liver, secretome (13.2), Lung (11.2), and Plasma (6.7).
Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, and MOPED for FANCF Gene
NURSA nuclear receptor signaling pathways regulating expression of FANCF Gene:
FANCFSOURCE GeneReport for Unigene cluster for FANCF Gene:
Hs.632151Evidence on tissue expression from TISSUES for FANCF Gene
- Nervous system(4.7)
- Skin(4.1)
Phenotype-based relationships between genes and organs from Gene ORGANizer for FANCF Gene
Germ Layers:
- ectoderm
- endoderm
- mesoderm
Systems:
- cardiovascular
- digestive
- endocrine
- immune
- integumentary
- lymphatic
- nervous
- reproductive
- respiratory
- skeletal muscle
- skeleton
- urinary
Organs:
Head and neck:
- brain
- cerebellum
- cranial nerve
- ear
- eye
- eyelid
- face
- head
- neck
- nose
- outer ear
- pituitary gland
- skull
Thorax:
- breast
- esophagus
- heart
- lung
- rib
- rib cage
Abdomen:
- intestine
- kidney
- large intestine
- liver
- stomach
Pelvis:
- anus
- ovary
- pelvis
- penis
- prostate
- rectum
- testicle
- ureter
- uterus
- vagina
- vulva
Limb:
- arm
- digit
- finger
- forearm
- hand
- radius
- upper limb
General:
- blood
- blood vessel
- bone marrow
- coagulation system
- hair
- peripheral nervous system
- red blood cell
- skin
- spinal column
- vertebrae
- white blood cell
Primer Products
-
OriGene qPCR primer pairs for FANCF
No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , mRNA differential expression in normal tissues , Protein tissue co-expression partners and mRNA Expression by UniProt/SwissProt for FANCF Gene
Orthologs for FANCF Gene
This gene was present in the common ancestor of chordates.
| Organism | Taxonomy | Gene | Similarity | Type | Details |
|---|---|---|---|---|---|
| chimpanzee (Pan troglodytes) |
Mammalia | FANCF 34 35 |
|
||
| cow (Bos Taurus) |
Mammalia | FANCF 34 35 |
|
||
| mouse (Mus musculus) |
Mammalia | Fancf 34 16 35 |
|
||
| rat (Rattus norvegicus) |
Mammalia | Fancf 34 |
|
||
| dog (Canis familiaris) |
Mammalia | FANCF 35 |
|
OneToOne | |
| oppossum (Monodelphis domestica) |
Mammalia | FANCF 35 |
|
OneToOne | |
| chicken (Gallus gallus) |
Aves | FANCF 34 35 |
|
||
| lizard (Anolis carolinensis) |
Reptilia | FANCF 35 |
|
OneToOne | |
| tropical clawed frog (Silurana tropicalis) |
Amphibia | fancf 34 |
|
||
| zebrafish (Danio rerio) |
Actinopterygii | fancf 34 35 |
|
- Species where no ortholog for FANCF was found in the sources mined by GeneCards:
-
- A. gosspyii yeast (Ashbya gossypii)
- Actinobacteria (Mycobacterium tuberculosis)
- African clawed frog (Xenopus laevis)
- African malaria mosquito (Anopheles gambiae)
- Alicante grape (Vitis vinifera)
- alpha proteobacteria (Wolbachia pipientis)
- amoeba (Dictyostelium discoideum)
- Archea (Pyrococcus horikoshii)
- baker's yeast (Saccharomyces cerevisiae)
- barley (Hordeum vulgare)
- beta proteobacteria (Neisseria meningitidis)
- bread mold (Neurospora crassa)
- Chromalveolata (Phytophthora infestans)
- common water flea (Daphnia pulex)
- corn (Zea mays)
- E. coli (Escherichia coli)
- filamentous fungi (Aspergillus nidulans)
- Firmicute bacteria (Streptococcus pneumoniae)
- fission yeast (Schizosaccharomyces pombe)
- fruit fly (Drosophila melanogaster)
- green algae (Chlamydomonas reinhardtii)
- honey bee (Apis mellifera)
- K. lactis yeast (Kluyveromyces lactis)
- loblloly pine (Pinus taeda)
- malaria parasite (Plasmodium falciparum)
- medicago trunc (Medicago Truncatula)
- moss (Physcomitrella patens)
- orangutan (Pongo pygmaeus)
- pig (Sus scrofa)
- platypus (Ornithorhynchus anatinus)
- rainbow trout (Oncorhynchus mykiss)
- rice (Oryza sativa)
- rice blast fungus (Magnaporthe grisea)
- schistosome parasite (Schistosoma mansoni)
- sea anemone (Nematostella vectensis)
- sea squirt (Ciona intestinalis)
- sea squirt (Ciona savignyi)
- sea urchin (Strongylocentrotus purpuratus)
- sorghum (Sorghum bicolor)
- soybean (Glycine max)
- stem rust fungus (Puccinia graminis)
- sugarcane (Saccharum officinarum)
- thale cress (Arabidopsis thaliana)
- tomato (Lycopersicon esculentum)
- toxoplasmosis (Toxoplasma gondii)
- Trichoplax (Trichoplax adhaerens)
- wheat (Triticum aestivum)
- worm (Caenorhabditis elegans)
Paralogs for FANCF Gene
(1) SIMAP similar genes for FANCF Gene using alignment to 2 proteins:
No data available for Paralogs for FANCF Gene
Variants for FANCF Gene
| SNP ID | Clin | Chr 11 pos | Sequence Context | AA Info | Type |
|---|---|---|---|---|---|
| rs104894221 | Pathogenic | 22,625,795(-) | TTCTG(C/G/T)AGCAC | upstream-variant-2KB, reference, missense, stop-gained | |
| rs104894222 | Pathogenic | 22,625,484(-) | CGTTA(C/G)CACCT | upstream-variant-2KB, reference, stop-gained | |
| rs587778340 | Pathogenic | 22,625,326(-) | ACTCT(-/CT)GATGA | upstream-variant-2KB, reference, frameshift-variant | |
| rs730880277 | Pathogenic | 22,625,559(-) | TCCAG(-/TTCCGGGATTAGCGAACTTCCAG)GCCCT | upstream-variant-2KB, reference, frameshift-variant | |
| rs730880278 | Pathogenic | 22,625,416(-) | TCTTT(-/CCCGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAG)CCTGG | upstream-variant-2KB, reference, frameshift-variant |
| Variant ID | Type | Subtype | PubMed ID |
|---|---|---|---|
| nsv1046773 | CNV | loss | 25217958 |
Residual Variation Intolerance Score:
61.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score:
2.31;
41.26% of all genes are more intolerant (likely to be disease-causing)
Relevant External Links for FANCF Gene
No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FANCF Gene
Disorders for FANCF Gene
(8) MalaCards diseases for FANCF Gene - From: OMIM, ClinVar, GeneTests, Orphanet, DISEASES, Novoseek, and GeneCards
| Disorder | Aliases | PubMed IDs |
|---|---|---|
| fanconi anemia, complementation group f |
|
|
| fanconi anemia, complementation group a |
|
|
| fancf-related fanconi anemia |
|
|
| fanconi anemia, complementation group e |
|
|
| gnathodiaphyseal dysplasia |
|
|
Search FANCF in MalaCards
View complete list of genes associated with diseases
UniProtKB/Swiss-Prot
FANCF_HUMAN- Fanconi anemia complementation group F (FANCF) [MIM:603467]: A disorder affecting all bone marrow elements and resulting in anemia, leukopenia and thrombopenia. It is associated with cardiac, renal and limb malformations, dermal pigmentary changes, and a predisposition to the development of malignancies. At the cellular level it is associated with hypersensitivity to DNA-damaging agents, chromosomal instability (increased chromosome breakage) and defective DNA repair. {ECO:0000269 PubMed:10615118}. Note=The disease is caused by mutations affecting the gene represented in this entry.
Relevant External Links for FANCF
No data available for Genatlas for FANCF Gene
Publications for FANCF Gene
- Structural determinants of human FANCF protein that function in the assembly of a DNA damage signaling complex. (PMID: 17082180) Kowal P. … Ellenberger T. (J. Biol. Chem. 2007) 3 4 22 64
- The Fanconi anaemia gene FANCF encodes a novel protein with homology to ROM. (PMID: 10615118) de Winter J.P. … Joenje H. (Nat. Genet. 2000) 3 4 22 64
- The Fanconi anemia protein FANCF forms a nuclear complex with FANCA, FANCC and FANCG. (PMID: 11063725) de Winter J.P. … Joenje H. (Hum. Mol. Genet. 2000) 3 4 22 64
- Comprehensive screen of genetic variation in DNA repair pathway genes and postmenopausal breast cancer risk. (PMID: 20496165) Monsees G.M. … Han J. (Breast Cancer Res. Treat. 2011) 3 46 64
- Evaluating new candidate SNPs as low penetrance risk factors in sporadic breast cancer: a two-stage Spanish case-control study. (PMID: 18950845) Vega A. … Carracedo A. (Gynecol. Oncol. 2009) 3 46 64
Products for FANCF Gene
- Browse R&D Systems for Antibodies
- Browse R&D Systems for Human Recombinant Proteins
- Browse R&D Systems for biochemical assays
- Browse Primary Antibodies
- Browse Proteins and Enzymes
- Browse ELISAs
- Browse Activity Assays
- Browse cDNA Clones
- Browse Cell Culture Products
- Browse Cell Selection and Detection Kits
- Browse DNA Damage and Repair Kits
- Browse ELISpot/FluoroSpot Kits and Development Modules
- Browse Flow Cytometry Kits
- Browse Immunoprecipitation Assays
- Browse Luminex Assays
- Browse Peptides
- Browse Proteome Profiler Antibody Arrays
- Browse Small Molecules
- Custom Antibody ServicesOriGene Antibodies for FANCF
- Browse OriGene ELISA Kits
- Custom Assay Services
- OriGene Purified Proteins for FANCF
- Search Origene for MassSpec and Protein Over-expression Lysates for FANCF
- Origene Custom Protein Services for FANCF
- Origene shRNA, siRNA, and RNAi products in human, mouse, rat for FANCF
- Browse OriGene Inhibitory RNA Products For FANCF
- OriGene qPCR primer pairs for FANCF
- OriGene CRISPR knockouts for FANCF
- OriGene ORF clones in human for FANCF
- Custom cloning services - gene synthesis, subcloning, mutagenesis, variant library, vector shuttling
- Browse OriGene miRNA Products For FANCF
- GenScript: Next-day shipping cDNA ORF clone for FANCF in any vector
- GenScript Custom Purified and Recombinant Proteins Services for FANCF
- GenScript Custom Assay Services for FANCF
- GenScript Custom overexpressing Cell Line Services for FANCF
- GenScript: Design CRISPR guide RNA sequences for FANCF
- Design optimal peptide antigens
- CloneReady with Over 120,000 Genes
- Gene Synthesis: Any Gene in Any Vector
- Vector-based siRNA and miRNA, Ready for Transfection
- Gene Mutant Library, Variants up to 10^11
- Plasmid Preparation
- GenScript Custom Peptide Services for FANCF
- Sino Biological Human cDNA Clone for FANCF
- Browse Sino Biological Cell Lysates
- Browse Sino Biological Proteins
- Sino Biological Antibodies
- Sino Biological ELISA Kits and Pair Sets
- Sino Biological Cell Lysates
- Sino Biological qPCR Primers
- Sino Biological CRO Services for Proteins, Antibodies and Genes
- Sino Biological Transfection Reagents
- Novus Biologicals Antibodies for FANCF
- Novus Biologicals proteins and lysates for FANCF
- Novus Biologicals
- Novus Biologicals Tissue Microarrays
- ViGene Biosciences adenoviral particle packaged cDNA for FANCF gene
- ViGene Biosciences lentiviral particle packaged cDNA for FANCF gene
- ViGene Biosciences ready-to-package AAV shRNAs for FANCF gene
- Search ViGene Biosciences for FANCF
- Santa Cruz Biotechnology (SCBT) Antibodies for FANCF
- Search Santa Cruz Biotechnology (SCBT) for FANCF siRNA/shRNA
- Santa Cruz Biotechnology (SCBT) CRISPR for FANCF
- Horizon Cell Lines for FANCF
- Cyagen custom Knockout/knockin (KOKI) mouse models for FANCF
- VectorBuilder custom plasmid, inducible vectors for FANCF
- VectorBuilder custom lentivirus, adenovirus, AAV vector/virus packaging for FANCF
- VectorBuilder Other custom vectors
- Mammalian expression: PiggyBac
- Mammalian Tet-on expression: plasmid
- Mammalian conditional (Cre-Lox): plasmid and PiggyBac
- Mammalian shRNA knockdown: lentiviral, adenoviral, AAV, and PiggyBac
- CRISPR: plasmid gRNA, lentiviral gRNA, and donor plasmid
- Bacterial expression: pET, pBAD, and pCS
- Yeast expression
Sources for FANCF Gene
- (1) GeneCards
- (2) HGNC
- (3) EntrezGene
- (4) Swiss-Prot
- (5) Ensembl
- (6) OMIM
- (7) GeneLoc
- (8) Gene Wiki
- (9) UCSC
- (10) PhosphoSitePlus
- (11) GO
- (12) TrEMBL
- (13) InterPro
- (14) ProtoNet
- (15) Blocks
- (16) MGI
- (17) IUBMB
- (18) KEGG
- (19) MINT
- (20) STRING
- (21) IntAct
- (22) Novoseek
- (23) PharmGKB
- (24) DrugBank
- (25) HMDB
- (26) UniGene
- (27) AceView
- (28) RNAdb
- (29) ASD
- (30) ECgene
- (31) GeneAnnot
- (32) CGAP SAGE
- (33) SOURCE
- (34) HomoloGene
- (35) PanEnsembl
- (36) euGenes
- (37) SGD
- (38) FlyBase
- (39) WormBase
- (40) Pseudogene
- (41) DGV
- (42) dbSNP
- (43) GenAtlas
- (44) GeneTests
- (45) HGMD
- (46) GAD
- (47) LSDB
- (48) BGMUT
- (49) HuGE
- (50) eBioscience
- (51) Atlas
- (52) Cell Signaling Technology
- (53) GenBank
- (54) H-invDB
- (55) HORDE
- (56) HUGE
- (57) IMGT
- (58) Leiden
- (59) MILLIPORE
- (60) miRBase
- (61) DME
- (62) NCBI
- (63) OriGene
- (64) PubMed
- (65) R&D Systems
- (66) TGDB
- (67) Tocris
- (68) Abcam
- (69) Novus
- (70) ProSpec
- (71) Sino Biological
- (72) GenScript
- (73) Qiagen
- (74) Cloud-Clone Corp.
- (75) Enzo Life Sciences
- (76) OCA
- (77) Proteopedia
- (78) MOPED
- (79) SPIRE
- (80) neXtProt
- (81) Reactome
- (82) GeneGo (Thomson Reuters)
- (83) fRNAdb
- (84) DISEASES
- (85) SIMAP
- (86) GenomeRNAi
- (87) LifeMap
- (88) miRTarBase
- (89) MalaCards
- (90) Invitrogen
- (91) BitterDB
- (92) Vector BioLabs
- (93) ESI-BIO
- (94) RefSeq
- (95) BioSystems
- (96) MaxQB
- (97) IUPHAR
- (98) BioGPS
- (99) Illumina
- (100) COMPARTMENTS
- (101) HOMER
- (102) PaxDb
- (103) ApexBio
- (104) Addgene
- (105) antibodies-online
- (106) CYP
- (107) NONCODE
- (108) SwitchGear Genomics
- (109) TreeFam
- (110) PathCards
- (111) GeneReviews
- (112) GeneTex
- (113) Taconic Biosciences
- (114) GTEx
- (115) ProteomicsDB
- (116) SCBT
- (117) DGIdb
- (118) ClinicalTrials
- (119) FDA Approved Drugs
- (120) RVIS
- (121) SIGNOR
- (122) diseasecard
- (123) NIH Rare Diseases
- (124) Orphanet
- (125) UMLS
- (126) GTR
- (127) Disease Ontology
- (128) Genetics Home Reference
- (129) MeSH
- (130) MedlinePlus
- (131) CDC
- (132) NINDS
- (133) NCBI Bookshelf
- (134) ClinVar
- (135) Gene Damage Index
- (136) ViGene Biosciences
- (137) HPO
- (138) UDN
- (139) VISTA
- (140) FANTOM5
- (141) ENCODE
- (142) ProSci
- (143) Horizon
- (144) NURSA
- (145) IID
- (146) Cyagen
- (147) VectorBuilder
- (148) SNPedia
- (149) BRCA Exchange
- (150) St John's Lab
- (151) CIViC
- (152) ProteoGenix
- (153) dbSUPER
- (154) TISSUES
- (155) Gene ORGANizer