Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM74A4 Gene

Subcategory (RNA class) for FAM74A4 Gene

lncRNA

Quality Score for this RNA gene is

3

Aliases for FAM74A4 Gene

  • Family With Sequence Similarity 74, Member A4 2 3
  • Family With Sequence Similarity 74, Member A2 3
  • FAM74A4 FAM74A6 4
  • FAM74A2 3

External Ids for FAM74A4 Gene

ORGUL Members for FAM74A4 Gene

Previous GeneCards Identifiers for FAM74A4 Gene

  • GC09M065227
  • GC09M065487

Summaries for FAM74A4 Gene

GeneCards Summary for FAM74A4 Gene

FAM74A4 (Family With Sequence Similarity 74, Member A4) is an RNA Gene, and is affiliated with the lncRNA class.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM74A4 Gene

Genomics for FAM74A4 Gene

Regulatory Elements for FAM74A4 Gene

Genomic Location for FAM74A4 Gene

Start:
61,205,258 bp from pter
End:
61,212,373 bp from pter
Size:
7,116 bases
Orientation:
Plus strand

Genomic View for FAM74A4 Gene

UCSC Golden Path with GeneCards custom track
Cytogenetic band:
Genomic Location for FAM74A4 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM74A4 Gene

Proteins for FAM74A4 Gene

  • Protein details for FAM74A4 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q5TZK3-FAM74_HUMAN
    Recommended name:
    Protein FAM74A4/A6
    Protein Accession:
    Q5TZK3
    Secondary Accessions:
    • A6NH89
    • Q6ZSU6

    Protein attributes for FAM74A4 Gene

    Size:
    123 amino acids
    Molecular mass:
    14773 Da
    Quaternary structure:
    No Data Available

neXtProt entry for FAM74A4 Gene

Proteomics data for FAM74A4 Gene at MOPED

Post-translational modifications for FAM74A4 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

No data available for DME Specific Peptides for FAM74A4 Gene

Domains for FAM74A4 Gene

Gene Families for FAM74A4 Gene

HGNC:
  • LNCRNA :Long non-coding RNAs

Protein Domains for FAM74A4 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for FAM74A4 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q5TZK3

UniProtKB/Swiss-Prot:

FAM74_HUMAN :
  • Q5TZK3
Family:
  • Belongs to the FAM74 family.
genes like me logo Genes that share domains with FAM74A4: view

Function for FAM74A4 Gene

Gene Ontology (GO) - Molecular Function for FAM74A4 Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0005515 protein binding IPI 25416956
genes like me logo Genes that share ontologies with FAM74A4: view

No data available for Molecular function , Enzyme Numbers (IUBMB) , Phenotypes , Animal Models , miRNA , Transcription Factor Targeting and HOMER Transcription for FAM74A4 Gene

Localization for FAM74A4 Gene

No data available for Subcellular locations from UniProtKB/Swiss-Prot , Subcellular locations from COMPARTMENTS and Gene Ontology (GO) - Cellular Components for FAM74A4 Gene

Pathways for FAM74A4 Gene

SuperPathways for FAM74A4 Gene

No Data Available

Interacting Proteins for FAM74A4 Gene

Gene Ontology (GO) - Biological Process for FAM74A4 Gene

None

No data available for Pathways by source for FAM74A4 Gene

Transcripts for FAM74A4 Gene

mRNA/cDNA for FAM74A4 Gene

(4) Selected AceView cDNA sequences:
(1) REFSEQ mRNAs :
(3) Ensembl transcripts including schematic representations, and UCSC links where relevant :

miRNA Products

Inhibitory RNA Products

  • Predesigned siRNA for gene silencing in human,mouse,rat for FAM74A4

Primer Products

  • QuantiTect SYBR Green Assays in human,mouse,rat
  • Pre-validated RT² qPCR Primer Assay in human,mouse,rat
  • QuantiFast Probe-based Assays in human,mouse,rat

Flow Cytometry Products

Alternative Splicing Database (ASD) splice patterns (SP) for FAM74A4 Gene

No ASD Table

Relevant External Links for FAM74A4 Gene

GeneLoc Exon Structure for
FAM74A4
ECgene alternative splicing isoforms for
FAM74A4

Expression for FAM74A4 Gene

mRNA expression in normal human tissues for FAM74A4 Gene

mRNA differential expression in normal tissues according to GTEx for FAM74A4 Gene

This gene is overexpressed in Fallopian Tube (11.7), Brain - Hippocampus (9.5), Whole Blood (7.4), Brain - Hypothalamus (5.4), and Brain - Nucleus accumbens (basal ganglia) (5.2).

SOURCE GeneReport for Unigene cluster for FAM74A4 Gene Hs.741141

genes like me logo Genes that share expressions with FAM74A4: view

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery , Protein differential expression in normal tissues , Protein expression , mRNA Expression by UniProt/SwissProt and Expression partners for FAM74A4 Gene

Orthologs for FAM74A4 Gene

Evolution for FAM74A4 Gene

ENSEMBL:
Gene Tree for FAM74A4 (if available)
TreeFam:
Gene Tree for FAM74A4 (if available)

No data available for Orthologs for FAM74A4 Gene

Paralogs for FAM74A4 Gene

Selected SIMAP similar genes for FAM74A4 Gene using alignment to 1 proteins:

genes like me logo Genes that share paralogs with FAM74A4: view

No data available for Paralogs for FAM74A4 Gene

Variants for FAM74A4 Gene

Sequence variations from dbSNP and Humsavar for FAM74A4 Gene

SNP ID Clin Chr 09 pos Sequence Context AA Info Type MAF
rs2252053 -- 61,205,813(-) ACAGC(C/G)TCTGA nc-transcript-variant
rs28616805 -- 61,205,834(-) TCTCT(C/G)CACGT nc-transcript-variant
rs28754525 -- 61,205,830(-) TGCAC(A/G)TCTTC nc-transcript-variant
rs59022509 -- 61,205,822(-) TCTTG(-/TGGACAGCCTTTGAGCTCTCTCCATGTCTTCTCCGGGACAGCCTCTGAACTCTCTGCACGTCTTCTTG)CAGAC nc-transcript-variant

Structural Variations from Database of Genomic Variants (DGV) for FAM74A4 Gene

Variant ID Type Subtype PubMed ID
nsv428215 CNV Gain+Loss 18775914
esv24325 CNV Gain+Loss 19812545

Relevant External Links for FAM74A4 Gene

HapMap Linkage Disequilibrium report
FAM74A4

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FAM74A4 Gene

Disorders for FAM74A4 Gene

No disorders were found for FAM74A4 Gene.

No data available for MalaCards , OMIM , UniProtKB/Swiss-Prot , University of Copenhagen DISEASES , Novoseek inferred disease relationships , Genatlas and External Links for FAM74A4 Gene

Publications for FAM74A4 Gene

  1. Complete sequencing and characterization of 21,243 full-length human cDNAs. (PMID: 14702039) Ota T. … Sugano S. (Nat. Genet. 2004) 3 4
  2. DNA sequence and analysis of human chromosome 9. (PMID: 15164053) Humphray S.J. … Dunham I. (Nature 2004) 3 4
  3. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 3
  4. A proteome-scale map of the human interactome network. (PMID: 25416956) Rolland T. … Vidal M. (Cell 2014) 3
  5. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3

Products for FAM74A4 Gene

Sources for FAM74A4 Gene

Back to Top

Content