Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM71E1 Gene

Aliases for FAM71E1 Gene

  • Family With Sequence Similarity 71 Member E1 2 3 5
  • Family With Sequence Similarity 71, Member E1 2

External Ids for FAM71E1 Gene

Previous GeneCards Identifiers for FAM71E1 Gene

  • GC19M055662
  • GC19M050970
  • GC19M047307

Summaries for FAM71E1 Gene

GeneCards Summary for FAM71E1 Gene

FAM71E1 (Family With Sequence Similarity 71 Member E1) is a Protein Coding gene. An important paralog of this gene is FAM71F1.

No data available for Entrez Gene Summary , UniProtKB/Swiss-Prot , Tocris Summary , Gene Wiki entry , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM71E1 Gene

Genomics for FAM71E1 Gene

Regulatory Elements for FAM71E1 Gene

Enhancers for FAM71E1 Gene
GeneHancer Identifier Score Enhancer Sources TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor Binding Sites within enhancer Other Gene Targets for Enhancer

Enhancers around FAM71E1 on UCSC Golden Path with GeneCards custom track

Promoters for FAM71E1 Gene
Ensembl Regulatory Elements (ENSRs) TSS Distance (bp) Size (bp) Binding Sites for Transcription Factors within promoters

ENSRs around FAM71E1 on UCSC Golden Path with GeneCards custom track

Genomic Location for FAM71E1 Gene

Chromosome:
19
Start:
50,466,643 bp from pter
End:
50,476,753 bp from pter
Size:
10,111 bases
Orientation:
Minus strand

Genomic View for FAM71E1 Gene

Genes around FAM71E1 on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM71E1 Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM71E1 Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM71E1 Gene

Proteins for FAM71E1 Gene

  • Protein details for FAM71E1 Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q6IPT2-F71E1_HUMAN
    Recommended name:
    Protein FAM71E1
    Protein Accession:
    Q6IPT2
    Secondary Accessions:
    • Q96EJ5
    • Q9BSM9

    Protein attributes for FAM71E1 Gene

    Size:
    247 amino acids
    Molecular mass:
    27609 Da
    Quaternary structure:
    No Data Available

    Alternative splice isoforms for FAM71E1 Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for FAM71E1 Gene

Proteomics data for FAM71E1 Gene at MOPED

Post-translational modifications for FAM71E1 Gene

  • Modification sites at PhosphoSitePlus
  • Modification sites at neXtProt

Other Protein References for FAM71E1 Gene

No data available for DME Specific Peptides for FAM71E1 Gene

Domains & Families for FAM71E1 Gene

Protein Domains for FAM71E1 Gene

InterPro:
ProtoNet:

Suggested Antigen Peptide Sequences for FAM71E1 Gene

GenScript: Design optimal peptide antigens:

Graphical View of Domain Structure for InterPro Entry

Q6IPT2

UniProtKB/Swiss-Prot:

F71E1_HUMAN :
  • Belongs to the FAM71 family.
Family:
  • Belongs to the FAM71 family.
genes like me logo Genes that share domains with FAM71E1: view

No data available for Gene Families for FAM71E1 Gene

Function for FAM71E1 Gene

Phenotypes for FAM71E1 Gene

genes like me logo Genes that share phenotypes with FAM71E1: view

Animal Model Products

CRISPR Products

miRNA for FAM71E1 Gene

miRTarBase miRNAs that target FAM71E1

No data available for Molecular function , Enzyme Numbers (IUBMB) , Gene Ontology (GO) - Molecular Function , Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for FAM71E1 Gene

Localization for FAM71E1 Gene

Subcellular locations from

COMPARTMENTS
Jensen Localization Image for FAM71E1 Gene COMPARTMENTS Subcellular localization image for FAM71E1 gene
Compartment Confidence
nucleus 5
cytosol 2
peroxisome 1

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for FAM71E1 Gene

Pathways & Interactions for FAM71E1 Gene

SuperPathways for FAM71E1 Gene

No Data Available

Interacting Proteins for FAM71E1 Gene

Gene Ontology (GO) - Biological Process for FAM71E1 Gene

None

No data available for Pathways by source and SIGNOR curated interactions for FAM71E1 Gene

Drugs & Compounds for FAM71E1 Gene

No Compound Related Data Available

Transcripts for FAM71E1 Gene

mRNA/cDNA for FAM71E1 Gene

(5) REFSEQ mRNAs :
(5) Additional mRNA sequences :
(6) Ensembl transcripts including schematic representations, and UCSC links where relevant :

Unigene Clusters for FAM71E1 Gene

Family with sequence similarity 71, member E1:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for FAM71E1 Gene

No ASD Table

Relevant External Links for FAM71E1 Gene

GeneLoc Exon Structure for
FAM71E1
ECgene alternative splicing isoforms for
FAM71E1

Expression for FAM71E1 Gene

mRNA expression in normal human tissues for FAM71E1 Gene

mRNA differential expression in normal tissues according to GTEx for FAM71E1 Gene

This gene is overexpressed in Testis (x24.6).

Protein differential expression in normal tissues from HIPED for FAM71E1 Gene

This gene is overexpressed in Urine (66.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB and MOPED for FAM71E1 Gene



SOURCE GeneReport for Unigene cluster for FAM71E1 Gene Hs.448941

genes like me logo Genes that share expression patterns with FAM71E1: view

Protein tissue co-expression partners for FAM71E1 Gene

- Elite partner

Primer Products

In Situ Assay Products

No data available for mRNA expression in embryonic tissues and stem cells from LifeMap Discovery and mRNA Expression by UniProt/SwissProt for FAM71E1 Gene

Orthologs for FAM71E1 Gene

This gene was present in the common ancestor of chordates.

Orthologs for FAM71E1 Gene

Organism Taxonomy Gene Similarity Type Details
cow
(Bos Taurus)
Mammalia FAM71E1 35
  • 86.51 (n)
  • 82.74 (a)
FAM71E1 36
  • 65 (a)
OneToOne
dog
(Canis familiaris)
Mammalia FAM71E1 35
  • 84.43 (n)
  • 80.84 (a)
FAM71E1 36
  • 63 (a)
OneToOne
mouse
(Mus musculus)
Mammalia Fam71e1 35
  • 77.37 (n)
  • 75.76 (a)
Fam71e1 16
Fam71e1 36
  • 58 (a)
OneToOne
chimpanzee
(Pan troglodytes)
Mammalia FAM71E1 35
  • 98.56 (n)
  • 98.27 (a)
FAM71E1 36
  • 92 (a)
OneToOne
rat
(Rattus norvegicus)
Mammalia Fam71e1 35
  • 76.57 (n)
  • 76.36 (a)
platypus
(Ornithorhynchus anatinus)
Mammalia FAM71E1 36
  • 44 (a)
OneToOne
lizard
(Anolis carolinensis)
Reptilia FAM71E1 36
  • 54 (a)
OneToOne
Species with no ortholog for FAM71E1:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African clawed frog (Xenopus laevis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • chicken (Gallus gallus)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • fruit fly (Drosophila melanogaster)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • oppossum (Monodelphis domestica)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea squirt (Ciona intestinalis)
  • sea squirt (Ciona savignyi)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • tropical clawed frog (Silurana tropicalis)
  • wheat (Triticum aestivum)
  • worm (Caenorhabditis elegans)
  • zebrafish (Danio rerio)

Evolution for FAM71E1 Gene

ENSEMBL:
Gene Tree for FAM71E1 (if available)
TreeFam:
Gene Tree for FAM71E1 (if available)

Paralogs for FAM71E1 Gene

(2) SIMAP similar genes for FAM71E1 Gene using alignment to 2 proteins:

genes like me logo Genes that share paralogs with FAM71E1: view

Variants for FAM71E1 Gene

Sequence variations from dbSNP and Humsavar for FAM71E1 Gene

SNP ID Clin Chr 19 pos Sequence Context AA Info Type
rs736769 - 50,467,752(-) CACCA(G/T)CCGCA reference, missense
rs16984956 -- 50,474,036(+) AGGCA(C/T)GTAAA intron-variant
rs71182722 -- 50,471,731(-) ACACA(-/TGCATGTATGCGTATACACACACG)TGCAT intron-variant
rs71182723 -- 50,472,243(-) ATATA(-/AAT/CAT/T/TAC)ATACA intron-variant
rs1274596 -- 50,470,219(-) TTGGA(C/T)TCTTT intron-variant

Structural Variations from Database of Genomic Variants (DGV) for FAM71E1 Gene

Variant ID Type Subtype PubMed ID
nsv912282 CNV Loss 21882294
nsv509750 CNV Insertion 20534489
nsv912283 CNV Gain 21882294
esv2718736 CNV Deletion 23290073

Variation tolerance for FAM71E1 Gene

Residual Variation Intolerance Score: 71.6% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.38; 42.19% of all genes are more intolerant (likely to be disease-causing)

Relevant External Links for FAM71E1 Gene

HapMap Linkage Disequilibrium report
FAM71E1

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot for FAM71E1 Gene

Disorders for FAM71E1 Gene

Relevant External Links for FAM71E1

Atlas of Genetics and Cytogenetics in Oncology and Haematology:
FAM71E1

No disorders were found for FAM71E1 Gene.

No data available for MalaCards , UniProtKB/Swiss-Prot and Genatlas for FAM71E1 Gene

Publications for FAM71E1 Gene

  1. The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). (PMID: 15489334) Gerhard D.S. … Malek J. (Genome Res. 2004) 4 67
  2. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. (PMID: 12477932) Strausberg R.L. … Marra M.A. (Proc. Natl. Acad. Sci. U.S.A. 2002) 3

Products for FAM71E1 Gene

Sources for FAM71E1 Gene

Content