Free for academic non-profit institutions. Other users need a Commercial license

Aliases for FAM46A Gene

Aliases for FAM46A Gene

  • Family With Sequence Similarity 46 Member A 2 3 5
  • HBV X-Transactivated Gene 11 Protein 3 4
  • HBV XAg-Transactivated Protein 11 3 4
  • C6orf37 3 4
  • XTP11 3 4
  • Family With Sequence Similarity 46, Member A 2
  • Putative Nucleotidyltransferase FAM46A 3
  • Chromosome 6 Open Reading Frame 37 2
  • Retinal Expressed Gene C6orf37 3
  • Protein FAM46A 3
  • EC 2.7.7.- 4

External Ids for FAM46A Gene

Previous HGNC Symbols for FAM46A Gene

  • C6orf37

Previous GeneCards Identifiers for FAM46A Gene

  • GC06M082512
  • GC06M082201
  • GC06M079672

Summaries for FAM46A Gene

GeneCards Summary for FAM46A Gene

FAM46A (Family With Sequence Similarity 46 Member A) is a Protein Coding gene. Diseases associated with FAM46A include Posterior Cortical Atrophy and Retinitis Pigmentosa 25. An important paralog of this gene is FAM46C.

UniProtKB/Swiss-Prot for FAM46A Gene

  • Probable nucleotidyltransferase that may act as a non-canonical poly(A) RNA polymerase.

Gene Wiki entry for FAM46A Gene

Additional gene information for FAM46A Gene

No data available for Entrez Gene Summary , CIViC summary , Tocris Summary , PharmGKB "VIP" Summary , fRNAdb sequence ontologies and piRNA Summary for FAM46A Gene

Genomics for FAM46A Gene

GeneHancer (GH) Regulatory Elements for FAM46A Gene

Promoters and enhancers for FAM46A Gene
GeneHancer (GH) Identifier GH Type GH
Score
GH Sources Gene Association Score Total Score TSS distance (kb) Number of Genes Away Size (kb) Transcription Factor
Binding Sites
Gene Targets
GH06I081748 Promoter/Enhancer 2.2 EPDnew Ensembl ENCODE dbSUPER 550.8 +0.8 755 6.1 HDGF PKNOX1 MLX ARID4B SIN3A FEZF1 ZNF2 YY1 ZNF213 ZNF143 FAM46A LOC105377872
GH06I081787 Enhancer 0.9 Ensembl ENCODE 11.1 -34.8 -34755 1.1 IRF2 FOXA2 RARA FOSL2 NR2F6 FOS CREM MIXL1 GATAD2A RXRA ENSG00000206886 ENSG00000219702 FAM46A LINC02542 LOC105377873 LINC01526
GH06I081893 Enhancer 0.9 Ensembl ENCODE 10.7 -142.6 -142552 2.8 SOX13 MXI1 SAP130 MAX RAD21 ZNF7 YY1 CTBP1 GATA3 HNF4G FAM46A ENSG00000260574 LINC01526 LINC02542
GH06I081812 Enhancer 0.7 FANTOM5 Ensembl 13.5 -60.1 -60127 1.4 POLR2A MAFK RARA LINC01526 FAM46A ENSG00000206886 ENSG00000219702 LINC02542 LOC105377873
GH06I081831 Enhancer 0.8 ENCODE 11.7 -78.8 -78755 0.1 FOXA2 ARID4B RAD21 YY1 CREM THAP11 MIXL1 REST NFIL3 MIER3 FAM46A ENSG00000219702 ENSG00000206886 LINC01526 ENSG00000260574
- Elite GeneHancer and/or Elite GeneHancer-gene association Download GeneHancer data dump

GeneHancers around FAM46A on UCSC Golden Path with GeneCards custom track

Top Transcription factor binding sites by QIAGEN in the FAM46A gene promoter:

Genomic Locations for FAM46A Gene

Genomic Locations for FAM46A Gene
chr6:81,491,439-81,752,774
(GRCh38/hg38)
Size:
261,336 bases
Orientation:
Minus strand
chr6:82,201,156-82,462,491
(GRCh37/hg19)

Genomic View for FAM46A Gene

Genes around FAM46A on UCSC Golden Path with GeneCards custom track

Cytogenetic band:
FAM46A Gene in genomic location: bands according to Ensembl, locations according to GeneLoc (and/or Entrez Gene and/or Ensembl if different)
Genomic Location for FAM46A Gene
GeneLoc Logo Genomic Neighborhood Exon StructureGene Density

RefSeq DNA sequence for FAM46A Gene

Proteins for FAM46A Gene

  • Protein details for FAM46A Gene (UniProtKB/Swiss-Prot)

    Protein Symbol:
    Q96IP4-FA46A_HUMAN
    Recommended name:
    Putative nucleotidyltransferase FAM46A
    Protein Accession:
    Q96IP4
    Secondary Accessions:
    • A8K7U4
    • Q5TF86
    • Q8NFZ9
    • Q9BW32
    • Q9NXV5

    Protein attributes for FAM46A Gene

    Size:
    442 amino acids
    Molecular mass:
    49666 Da
    Quaternary structure:
    No Data Available
    SequenceCaution:
    • Sequence=AAH00683.1; Type=Erroneous initiation; Evidence={ECO:0000305};

    Alternative splice isoforms for FAM46A Gene

    UniProtKB/Swiss-Prot:

neXtProt entry for FAM46A Gene

Post-translational modifications for FAM46A Gene

No Post-translational modifications

Other Protein References for FAM46A Gene

No data available for DME Specific Peptides for FAM46A Gene

Domains & Families for FAM46A Gene

Gene Families for FAM46A Gene

Human Protein Atlas (HPA):
  • Predicted intracellular proteins

Protein Domains for FAM46A Gene

Graphical View of Domain Structure for InterPro Entry

Q96IP4

UniProtKB/Swiss-Prot:

FA46A_HUMAN :
  • Belongs to the FAM46 family.
Family:
  • Belongs to the FAM46 family.
genes like me logo Genes that share domains with FAM46A: view

Function for FAM46A Gene

Molecular function for FAM46A Gene

UniProtKB/Swiss-Prot Function:
Probable nucleotidyltransferase that may act as a non-canonical poly(A) RNA polymerase.

Enzyme Numbers (IUBMB) for FAM46A Gene

Phenotypes From GWAS Catalog for FAM46A Gene

Gene Ontology (GO) - Molecular Function for FAM46A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0003723 RNA binding HDA 22658674
GO:0005515 protein binding IPI 25814554
GO:0016740 transferase activity IEA --
GO:0016779 nucleotidyltransferase activity IEA --
genes like me logo Genes that share ontologies with FAM46A: view
genes like me logo Genes that share phenotypes with FAM46A: view

No data available for Human Phenotype Ontology , Animal Models , Transcription Factor Targets and HOMER Transcription for FAM46A Gene

Localization for FAM46A Gene

Subcellular locations from

COMPARTMENTS
Extracellular space Cytosol Plasma membrane Cytoskeleton Lysosome Endosome Peroxisome ER Golgi Apparatus Nucleus Mitochondrion 0 1 2 3 4 5 Confidence
COMPARTMENTS Subcellular localization image for FAM46A gene
Compartment Confidence
nucleus 3
cytosol 3
plasma membrane 1
extracellular 1
cytoskeleton 1
mitochondrion 1
peroxisome 1

Subcellular locations from the

Human Protein Atlas (HPA)
  • Cytosol (2)
  • Nucleoplasm (2)
See all subcellular structures

No data available for Subcellular locations from UniProtKB/Swiss-Prot and Gene Ontology (GO) - Cellular Components for FAM46A Gene

Pathways & Interactions for FAM46A Gene

SuperPathways for FAM46A Gene

No Data Available

Gene Ontology (GO) - Biological Process for FAM46A Gene

GO ID Qualified GO term Evidence PubMed IDs
GO:0010468 regulation of gene expression IMP --
GO:0030193 regulation of blood coagulation IMP --
genes like me logo Genes that share ontologies with FAM46A: view

No data available for Pathways by source and SIGNOR curated interactions for FAM46A Gene

Drugs & Compounds for FAM46A Gene

No Compound Related Data Available

Transcripts for FAM46A Gene

Unigene Clusters for FAM46A Gene

Family with sequence similarity 46, member A:
Representative Sequences:

Alternative Splicing Database (ASD) splice patterns (SP) for FAM46A Gene

ExUns: 1a · 1b · 1c ^ 2 ^ 3 ^ 4
SP1: - -
SP2: -
SP3:
SP4:

Relevant External Links for FAM46A Gene

GeneLoc Exon Structure for
FAM46A
ECgene alternative splicing isoforms for
FAM46A

Expression for FAM46A Gene

mRNA expression in normal human tissues from GTEx, Illumina, BioGPS, and CGAP SAGE for FAM46A Gene

mRNA expression in embryonic tissues and stem cells from LifeMap Discovery

Protein differential expression in normal tissues from HIPED for FAM46A Gene

This gene is overexpressed in Placenta (28.3), Salivary gland (20.9), and Skin (19.8).

Integrated Proteomics: protein expression in normal tissues and cell lines from ProteomicsDB, PaxDb, MaxQB, and MOPED for FAM46A Gene



Protein tissue co-expression partners for FAM46A Gene

NURSA nuclear receptor signaling pathways regulating expression of FAM46A Gene:

FAM46A

SOURCE GeneReport for Unigene cluster for FAM46A Gene:

Hs.10784

mRNA Expression by UniProt/SwissProt for FAM46A Gene:

Q96IP4-FA46A_HUMAN
Tissue specificity: Widely expressed, with preferential expression observed in the retina compared to other ocular tissues.

Evidence on tissue expression from TISSUES for FAM46A Gene

  • Skin(4.2)
  • Intestine(4.1)
  • Eye(4)
genes like me logo Genes that share expression patterns with FAM46A: view

No data available for mRNA differential expression in normal tissues and Phenotype-based relationships between genes and organs from Gene ORGANizer for FAM46A Gene

Orthologs for FAM46A Gene

This gene was present in the common ancestor of animals.

Orthologs for FAM46A Gene

Organism Taxonomy Gene Similarity Type Details
chimpanzee
(Pan troglodytes)
Mammalia FAM46A 33 34
  • 99.55 (n)
platypus
(Ornithorhynchus anatinus)
Mammalia FAM46A 34
  • 96 (a)
OneToOne
dog
(Canis familiaris)
Mammalia FAM46A 33 34
  • 94.9 (n)
cow
(Bos Taurus)
Mammalia FAM46A 33 34
  • 94.24 (n)
mouse
(Mus musculus)
Mammalia Fam46a 33 16 34
  • 91.36 (n)
rat
(Rattus norvegicus)
Mammalia Fam46a 33
  • 91.02 (n)
oppossum
(Monodelphis domestica)
Mammalia FAM46A 34
  • 89 (a)
OneToOne
chicken
(Gallus gallus)
Aves FAM46A 33 34
  • 85.54 (n)
lizard
(Anolis carolinensis)
Reptilia FAM46A 34
  • 82 (a)
OneToOne
tropical clawed frog
(Silurana tropicalis)
Amphibia fam46a 33
  • 83.38 (n)
Str.1648 33
African clawed frog
(Xenopus laevis)
Amphibia Xl.13086 33
zebrafish
(Danio rerio)
Actinopterygii fam46a 34
  • 83 (a)
OneToMany
FAM46A (1 of 2) 34
  • 83 (a)
OneToMany
LOC100330676 33
  • 76.71 (n)
fruit fly
(Drosophila melanogaster)
Insecta CG30497 34
  • 26 (a)
OneToMany
worm
(Caenorhabditis elegans)
Secernentea pqn-44 34
  • 35 (a)
OneToMany
sea squirt
(Ciona savignyi)
Ascidiacea -- 34
  • 50 (a)
OneToMany
Species where no ortholog for FAM46A was found in the sources mined by GeneCards:
  • A. gosspyii yeast (Ashbya gossypii)
  • Actinobacteria (Mycobacterium tuberculosis)
  • African malaria mosquito (Anopheles gambiae)
  • Alicante grape (Vitis vinifera)
  • alpha proteobacteria (Wolbachia pipientis)
  • amoeba (Dictyostelium discoideum)
  • Archea (Pyrococcus horikoshii)
  • baker's yeast (Saccharomyces cerevisiae)
  • barley (Hordeum vulgare)
  • beta proteobacteria (Neisseria meningitidis)
  • bread mold (Neurospora crassa)
  • Chromalveolata (Phytophthora infestans)
  • common water flea (Daphnia pulex)
  • corn (Zea mays)
  • E. coli (Escherichia coli)
  • filamentous fungi (Aspergillus nidulans)
  • Firmicute bacteria (Streptococcus pneumoniae)
  • fission yeast (Schizosaccharomyces pombe)
  • green algae (Chlamydomonas reinhardtii)
  • honey bee (Apis mellifera)
  • K. lactis yeast (Kluyveromyces lactis)
  • loblloly pine (Pinus taeda)
  • malaria parasite (Plasmodium falciparum)
  • medicago trunc (Medicago Truncatula)
  • moss (Physcomitrella patens)
  • orangutan (Pongo pygmaeus)
  • pig (Sus scrofa)
  • rainbow trout (Oncorhynchus mykiss)
  • rice (Oryza sativa)
  • rice blast fungus (Magnaporthe grisea)
  • schistosome parasite (Schistosoma mansoni)
  • sea anemone (Nematostella vectensis)
  • sea urchin (Strongylocentrotus purpuratus)
  • sorghum (Sorghum bicolor)
  • soybean (Glycine max)
  • stem rust fungus (Puccinia graminis)
  • sugarcane (Saccharum officinarum)
  • thale cress (Arabidopsis thaliana)
  • tomato (Lycopersicon esculentum)
  • toxoplasmosis (Toxoplasma gondii)
  • Trichoplax (Trichoplax adhaerens)
  • wheat (Triticum aestivum)

Evolution for FAM46A Gene

ENSEMBL:
Gene Tree for FAM46A (if available)
TreeFam:
Gene Tree for FAM46A (if available)

Paralogs for FAM46A Gene

Paralogs for FAM46A Gene

(4) SIMAP similar genes for FAM46A Gene using alignment to 5 proteins:

genes like me logo Genes that share paralogs with FAM46A: view

Variants for FAM46A Gene

Sequence variations from dbSNP and Humsavar for FAM46A Gene

SNP ID Clin Chr 06 pos Variation AA Info Type
rs754008809 benign, not specified 81,752,011(-) CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC/CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC/CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC/CCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCCGCCGAAGTCGCCGCC coding_sequence_variant, inframe_deletion, inframe_insertion
rs1000090701 -- 81,746,497(-) G/C 3_prime_UTR_variant
rs1001210075 -- 81,752,299(-) G/A intron_variant
rs1001353149 -- 81,745,701(-) A/G downstream_transcript_variant
rs1001769585 -- 81,753,797(-) G/A upstream_transcript_variant

Variation tolerance for FAM46A Gene

Residual Variation Intolerance Score: 37.1% of all genes are more intolerant (likely to be disease-causing)
Gene Damage Index Score: 2.14; 38.93% of all genes are more intolerant (likely to be disease-causing)

Additional Variant Information for FAM46A Gene

Human Gene Mutation Database (HGMD)
FAM46A
SNPedia medical, phenotypic, and genealogical associations of SNPs for
FAM46A

No data available for Polymorphic Variants from UniProtKB/Swiss-Prot and Structural Variations from Database of Genomic Variants (DGV) for FAM46A Gene

Disorders for FAM46A Gene

MalaCards: The human disease database

(3) MalaCards diseases for FAM46A Gene - From: HGMD, DISEASES, and GeneCards

- elite association - COSMIC cancer census association via MalaCards

Additional Disease Information for FAM46A

Genetic Association Database
(GAD)
Human Genome Epidemiology Navigator
(HuGE)
ATLAS of Genetics and Cytogenetics in Oncology and Haematology
genes like me logo Genes that share disorders with FAM46A: view

No data available for UniProtKB/Swiss-Prot and Genatlas for FAM46A Gene

Publications for FAM46A Gene

  1. FAM46 proteins are novel eukaryotic non-canonical poly(A) polymerases. (PMID: 27060136) Kuchta K … Ginalski K (Nucleic acids research 2016) 2 3 4 58
  2. Identification of a novel VNTR polymorphism in C6orf37 and its association with colorectal cancer risk in Chinese population. (PMID: 16545789) Cui J … Yao C (Clinica chimica acta; international journal of clinical chemistry 2006) 3 4 44 58
  3. Identification and characterization of C6orf37, a novel candidate human retinal disease gene on chromosome 6q14. (PMID: 12054608) Lagali PS … Ayyagari R (Biochemical and biophysical research communications 2002) 2 3 4 58
  4. A large-scale candidate gene association study of age at menarche and age at natural menopause. (PMID: 20734064) He C … Hunter DJ (Human genetics 2010) 3 44 58
  5. Genetic analysis of FAM46A in Spanish families with autosomal recessive retinitis pigmentosa: characterisation of novel VNTRs. (PMID: 17803723) Barragán I … Antiñolo G (Annals of human genetics 2008) 2 3 58

Products for FAM46A Gene

Sources for FAM46A Gene

Content
Loading form....